ID: 1042784665

View in Genome Browser
Species Human (GRCh38)
Location 8:72535202-72535224
Sequence GGAAATGCAGAGCTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042784661_1042784665 -10 Left 1042784661 8:72535189-72535211 CCTGCAGGTCCCTGGAAATGCAG No data
Right 1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042784665 Original CRISPR GGAAATGCAGAGCTGGAGCT TGG Intergenic
No off target data available for this crispr