ID: 1042785758

View in Genome Browser
Species Human (GRCh38)
Location 8:72545186-72545208
Sequence GGGGCCATATCCAGACTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042785758_1042785762 7 Left 1042785758 8:72545186-72545208 CCATTTAGTCTGGATATGGCCCC No data
Right 1042785762 8:72545216-72545238 CTAGAAACTTTTGTACTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042785758 Original CRISPR GGGGCCATATCCAGACTAAA TGG (reversed) Intronic