ID: 1042787223

View in Genome Browser
Species Human (GRCh38)
Location 8:72561517-72561539
Sequence CCTTGTCCTTAGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 510}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042787223 Original CRISPR CCTTGTCCTTAGAAAGTGGA AGG (reversed) Intronic
900206398 1:1433624-1433646 CCTTCTCCCTGGAGAGTGGAGGG + Intergenic
901397558 1:8992436-8992458 CCTTGGCCTCTGAAAGTGCAGGG + Intergenic
901605029 1:10452622-10452644 CCTTGGCCTCAGAAAGTGCTGGG + Intergenic
901846667 1:11987377-11987399 CCTTGTCCTCCGAAAGTGCTGGG - Intronic
901984994 1:13068350-13068372 CCTTGTCCTTCCAAAGTGCTGGG + Intronic
901996815 1:13158420-13158442 CCTTGTCCTTCCAAAGTGCTGGG - Intergenic
902907739 1:19571179-19571201 CCATGTCCTCACATAGTGGAAGG - Intergenic
903046812 1:20570554-20570576 CCTTGGCCTTCGAAAGTGCTGGG + Intergenic
903430065 1:23289955-23289977 CCTTGGCCTCAGAAAGTGCTGGG + Intergenic
903507334 1:23846968-23846990 CCTTGGCCTTAGAAAGTGCTGGG + Intronic
903904965 1:26678745-26678767 CCTGGTCCTATGAATGTGGATGG + Intergenic
903924479 1:26821886-26821908 CCTTGGCCTTCCAAAGTGGTGGG + Intergenic
904815934 1:33198413-33198435 CCTTGGCCTTACAAAGTGCTGGG - Intergenic
904960061 1:34325409-34325431 CCTTGTCCCTCAAGAGTGGAAGG - Intergenic
905130575 1:35753339-35753361 CCTTGTCCTTCCAAAGTGCTAGG + Intronic
905498444 1:38416176-38416198 CCTTGGCCTCCTAAAGTGGAAGG + Intergenic
907753415 1:57285572-57285594 ACTTGTCATTAGAAAGGTGAGGG - Intronic
908158726 1:61384979-61385001 CCTTGGCCTCAGAAAGTGCTAGG - Intronic
908259628 1:62329612-62329634 CCTTGTCCTTCCAAAGTGCTGGG - Intergenic
908307552 1:62838525-62838547 CCTTGGCCTCCCAAAGTGGAGGG - Intronic
908696909 1:66854139-66854161 CCTTGGCCTTACAAAGTGCTGGG - Intronic
908910311 1:69065340-69065362 CCATGTCCTTAGAGTCTGGAGGG + Intergenic
908921203 1:69194912-69194934 CCTTGTCCTTATAGAGTTTATGG - Intergenic
910247930 1:85162374-85162396 ACTTGGCCTGAGAAAGTTGATGG - Intronic
910978020 1:92928709-92928731 CCTTGGCCTTACAAAGTGCTGGG - Intronic
911610925 1:99958455-99958477 CCATGTCCTCACATAGTGGAAGG - Intergenic
911709995 1:101060766-101060788 CTGTGTCCTTACATAGTGGAAGG + Intergenic
912365214 1:109127812-109127834 CCTTGGCCTTCCAAAGTGGTGGG + Intronic
913082312 1:115399917-115399939 CTATGTCCTTACATAGTGGAAGG - Intergenic
913092918 1:115492167-115492189 CCCTGCCCTTTGAAAGTGGTGGG - Intergenic
913177874 1:116291679-116291701 GCTTTTCCTCAGGAAGTGGAAGG + Intergenic
914794892 1:150911681-150911703 CCTTGTCCTCACAAAGTGCTGGG + Intergenic
914876767 1:151518095-151518117 CCTTGGCCTTCCAAAGTGGTGGG + Intronic
914964632 1:152243834-152243856 CCTTGGCCTTCCAAAGTGGTGGG + Intergenic
915279737 1:154814212-154814234 CTTTCTCCTTAGAATGAGGAGGG + Intronic
915376912 1:155404421-155404443 CCTTGTCCTTCCAAAGTGTTGGG - Intronic
915385757 1:155490359-155490381 CCTTGGCCTTCCAAAGTGCAAGG - Intronic
915663080 1:157419855-157419877 CCATGTCCTCAGATGGTGGAAGG - Intergenic
915663109 1:157420037-157420059 CCTTGTCCTCACATGGTGGAAGG - Intergenic
917045159 1:170851602-170851624 CTTTGTCCTAAGAAGATGGAGGG - Intergenic
917224028 1:172762714-172762736 CTATGTCCTCAGAAAGTGGGAGG + Intergenic
917642812 1:176999213-176999235 CCTTCTCCAGAGAAAGAGGATGG + Intronic
918063940 1:181086917-181086939 CCTTGTCCTTCCAAAGTGATAGG + Intergenic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
919372664 1:196748902-196748924 CTATGTCCTTACAATGTGGAAGG + Intergenic
919379107 1:196833585-196833607 CTATGTCCTTACAATGTGGAAGG + Intronic
919785055 1:201253606-201253628 CCTAGTCCATAGAAAGTGCTGGG + Intergenic
920744970 1:208617562-208617584 CTTTGCCCTTAGAAAGGGGAGGG + Intergenic
922213949 1:223505885-223505907 CCTTGGCCTTTGAAAGTGCTGGG - Intergenic
922313081 1:224414727-224414749 CCTTGTCCTTCCAAAGTGCTAGG - Intronic
922471494 1:225879923-225879945 CATTGTCCCTGGAAAGGGGAGGG + Intronic
923995164 1:239485528-239485550 CCTTGGCCTTTCAAAGTGGTGGG + Intronic
924222611 1:241893839-241893861 CCTTGACCTCACAAAGTGGTAGG - Intronic
924634134 1:245768738-245768760 CTGTGTCCTTACACAGTGGAAGG - Intronic
1063713996 10:8509336-8509358 CCTTGGCCTTCCAAAGTGCAGGG - Intergenic
1064362284 10:14677092-14677114 CCTTGTGGATAGAAAGAGGAGGG - Intronic
1065069300 10:22005228-22005250 GCATGGCCTTAGAAAGAGGATGG - Intergenic
1065207758 10:23373306-23373328 CCTTGGCCTCACAAAGTGTAGGG + Intergenic
1065737370 10:28766358-28766380 CTTTGTCCTCACATAGTGGAAGG + Intergenic
1066129979 10:32383598-32383620 CCTTGGCCTCAGAAAGTGCTAGG + Intergenic
1067202095 10:44181968-44181990 CCTCGGCCTCAGAAAGTGGTGGG - Intergenic
1067306032 10:45064935-45064957 CTTTGTGTTTAGAAAGTGAAGGG + Intergenic
1067399747 10:45960281-45960303 CCTTGTCCTTCCAAAGTGCTGGG - Intergenic
1068089018 10:52409798-52409820 CCTTGGCATTTGAAATTGGAGGG - Intergenic
1068670927 10:59722972-59722994 CCTTGGCCTTACAAAGTGCTGGG - Intronic
1069860747 10:71469853-71469875 CCTTGGCCTCACAAAGTGCAGGG + Intronic
1070416425 10:76194294-76194316 CCATGCCCTTGGAAAATGGAAGG + Intronic
1070573638 10:77660617-77660639 CCTTGGCCTTTGAAAGTGCTGGG + Intergenic
1071355130 10:84786108-84786130 CCTTGTCCTTCCAAAGTGCTGGG - Intergenic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1071576696 10:86732093-86732115 CCTTGGCCTTCCAAAGTGTAGGG + Intronic
1073200553 10:101731667-101731689 CCTTGTCCTTCCAAAGTGCTGGG - Intergenic
1073390166 10:103169364-103169386 CCTTGTCCTTCCAAAGTGCTGGG - Intronic
1073494230 10:103876790-103876812 CCTTGGCCTTTGAAAGTGCTGGG + Intergenic
1073982604 10:109172144-109172166 TCTTGAGCTTAGAAAGTAGATGG + Intergenic
1075056783 10:119224662-119224684 CCTTGGCCTTACAAAGTGCTAGG + Intronic
1075390007 10:122085083-122085105 CCTGGTCCTTAAAACCTGGATGG - Exonic
1075511571 10:123076768-123076790 CCTTGTCCTCCCAAAGTGCAGGG - Intergenic
1075538950 10:123296242-123296264 CCTTGTCCTTAGAGAGTTCCTGG + Intergenic
1076142369 10:128089871-128089893 CCTTTTCCTTAACAGGTGGATGG - Intergenic
1076361141 10:129889645-129889667 TCTGGTCATTAGAAAGTGAACGG - Intronic
1076470627 10:130715749-130715771 CCTTGGCCTTCCAAAGTGCAAGG + Intergenic
1077331782 11:1987176-1987198 GCTTGACCTTAGAAAGAGGCTGG - Intergenic
1077989534 11:7391648-7391670 CCTTGGCCTTCGAAAGTGCTGGG - Intronic
1078837566 11:15045829-15045851 TCTGGTCCTTGGAAAGAGGAAGG + Intronic
1078956115 11:16197082-16197104 CCTTGTCCTCCCAAAGTGGTGGG + Intronic
1079065356 11:17286285-17286307 CCTTGTCCTCACAAAGTGCTGGG + Intronic
1079625950 11:22618020-22618042 CTCTGCCCTTAGAAAGGGGAGGG - Intergenic
1080462568 11:32468381-32468403 CCTTGTCCTTCCAAAGTGCTGGG + Intergenic
1082077382 11:47984807-47984829 CCTTGGCCTCACAAAGTGCAGGG + Intronic
1082277180 11:50234503-50234525 CCTTGGCCTTCCAAAGTGGTGGG - Intergenic
1083048829 11:59758904-59758926 CCTGGCCCTTAGAAAGTTCATGG + Intronic
1083451788 11:62751148-62751170 CCTTGGCCTTAAAAAGTGCTGGG - Exonic
1084017902 11:66397447-66397469 CCTTGTCCTTCCAAAGTGCTAGG + Intergenic
1085327892 11:75621770-75621792 CCTTGGCCTTCCAAAGTGCAGGG - Intronic
1085594344 11:77794430-77794452 CCTTGTCCTTGCAAAGTGCGGGG - Intronic
1088209484 11:107438792-107438814 CCTTGTCCTGCCAAAGTGCAAGG - Intronic
1088298386 11:108327076-108327098 CCTTGTCCTCTGAAAGTGCTGGG + Intronic
1088306796 11:108419445-108419467 CCTTGGCCTTTGAAAGTGCCAGG - Intronic
1088331877 11:108662997-108663019 CCTTGGCCTCAGAAAGTGCTGGG + Intergenic
1088880502 11:113969960-113969982 CCTTGGCCTTTGAAAGTGCTGGG + Intergenic
1089299159 11:117488085-117488107 CCTTGTCCTCAGTAAGAGGCAGG + Intronic
1202814763 11_KI270721v1_random:42352-42374 GCTTGACCTTAGAAAGAGGCTGG - Intergenic
1091889358 12:4040850-4040872 CCTTTCTCTTGGAAAGTGGATGG - Intergenic
1092865332 12:12755588-12755610 CCTTGGCCTTGGAAAGTGCTGGG - Intronic
1093465670 12:19446359-19446381 CCTTGGCCTTCCAAAGTGCAGGG - Intronic
1093729046 12:22546672-22546694 CCTTGACCTCACAAAGTGGTGGG + Intergenic
1094596652 12:31872317-31872339 CCTTGGCCTTTGAAAGTGGTGGG + Intergenic
1097091727 12:56510839-56510861 CCTTGGCCTTACAAAGTGCTGGG - Intergenic
1097669168 12:62515563-62515585 CCTTGGCCTTACAAAGTGCTGGG - Intronic
1097672686 12:62558946-62558968 CCTTGGCCTTCCAAAGTGCAGGG + Intronic
1098265623 12:68716140-68716162 CCTTGGCCTTAAAAAGTGCTGGG + Intronic
1098415160 12:70225800-70225822 CTTTGTCCTTGGAAAATGTATGG + Intergenic
1098766575 12:74497738-74497760 CTGTGTCCTTACACAGTGGAAGG - Intergenic
1098848368 12:75565689-75565711 CCTTTTCCCTGGAAACTGGAAGG - Intergenic
1099657543 12:85513652-85513674 CCTTGTCTCTAGAATCTGGAAGG - Intergenic
1100319734 12:93479171-93479193 CCTTGGCCTTACAAAGTGCTGGG + Intronic
1101677846 12:106935918-106935940 CCTTGGCCTTCCAAAGTGCAGGG - Intergenic
1101780644 12:107832097-107832119 CATTGTCTTTGGAAAGGGGAGGG - Intergenic
1102383548 12:112487382-112487404 CCTTGTCCTTCCAAAGTGCTGGG + Intronic
1102854320 12:116279592-116279614 CCTTGGCCTTCCAAAGTGCACGG - Intergenic
1103528970 12:121586904-121586926 CCTTGGCCTTCCAAAGTGGTGGG - Intergenic
1104405844 12:128516023-128516045 CCTTGTACTTAGAAACTGAGTGG + Intronic
1105501744 13:20979010-20979032 CCTTGGCCTTCCAAAGTGGTGGG + Intronic
1105561665 13:21498003-21498025 CCTTAGCCTCAGAAAGTGCAGGG + Intronic
1107368821 13:39718508-39718530 CCTTCTACTTAGTAAGTGCAAGG + Intronic
1107901180 13:45016200-45016222 CCTTGGCCTTGGAAAGTGCTGGG - Intronic
1107919145 13:45185071-45185093 CCTTGGCCTTTGAAAGTGCCTGG + Intronic
1108238922 13:48441211-48441233 CCATGTCCTCAGATGGTGGAAGG + Intronic
1108537016 13:51393326-51393348 CCTTGGCCTTCGAAAGTGCTGGG + Intronic
1108904722 13:55453974-55453996 CCTTGTCCTTCCAAAGTGCTGGG - Intergenic
1109373642 13:61458885-61458907 CCTTGGCATTAGAAATTGAATGG - Intergenic
1110981772 13:81909434-81909456 CCTTGTCCTCTCAAAGTGCAGGG + Intergenic
1111449410 13:88394101-88394123 CCTTGGCCTTCCAAAGTGCAGGG + Intergenic
1111563034 13:89977794-89977816 CCTTGTCCTCCGAAAGTGCTGGG - Intergenic
1113103182 13:106743162-106743184 CCATGTGTTTAGGAAGTGGATGG - Intergenic
1113384512 13:109836339-109836361 TTTTGTCATTAGAAAGTGGATGG - Intergenic
1113570133 13:111347658-111347680 CTTATTCCATAGAAAGTGGATGG + Intergenic
1114385337 14:22248427-22248449 CCTTGACCTTCCAAAGTGCAGGG + Intergenic
1114475365 14:22990717-22990739 CCTTGACCTTCCAAAGTGGTGGG + Intronic
1115562097 14:34592135-34592157 CCTTGGCCTTCCAAAGTGCAGGG - Intronic
1116658725 14:47681076-47681098 CCTTGTCCTGACAATGAGGAAGG + Intergenic
1116976305 14:51119965-51119987 CCTTGACTTTGTAAAGTGGAAGG + Intergenic
1117135647 14:52732023-52732045 CCTTGTCCTCCGAAAGTGTTGGG + Intronic
1117303574 14:54451618-54451640 CCTTGGCCTTCCAAAGTGCAGGG - Intergenic
1118145890 14:63136330-63136352 CCTTGGCCTTCGAAAGTGCTGGG - Intergenic
1118847389 14:69558006-69558028 CCTTGACCTTCCAAAGTGTAGGG + Intergenic
1119726648 14:76925511-76925533 CCTTGTCCTCTCAAAGTGGTGGG - Intergenic
1120535256 14:85687219-85687241 CCTTGTCCTCACATGGTGGAAGG + Intergenic
1120546539 14:85819196-85819218 CCTTGGCCTTCCAAAGTGCAGGG - Intergenic
1121331292 14:93051363-93051385 CCTTGGCCTTCCAAAGTGCAGGG - Intronic
1121400082 14:93668458-93668480 CCTTGGCCTTCCAAAGTGAAGGG - Intronic
1121563012 14:94888048-94888070 ACTTGTCCTTGGAAGGAGGAGGG - Intergenic
1122261083 14:100523448-100523470 CCTGGTCCTCAGAAAGAAGAAGG - Intronic
1122558852 14:102596813-102596835 CCTTGTCCTTCCAAAGTGCTGGG + Intronic
1125340876 15:38674050-38674072 CCTTGGCCTCACAAAGTGGTGGG - Intergenic
1125923611 15:43542539-43542561 CCTTGGCCTTCGAAAGTGCTGGG + Intronic
1126013208 15:44323319-44323341 CCTTTTCCCTAGAAATTTGATGG - Intronic
1126018276 15:44374396-44374418 CCTTGACCTTGGAAAGTGCTGGG - Intronic
1126407836 15:48339992-48340014 CCTTGTTCTTAAAAAATGGGGGG + Intronic
1126749301 15:51860501-51860523 GCTTGTCTTCAGAAAGTGCAAGG - Intronic
1127171105 15:56302235-56302257 CCTTGGCCTCACAAAGTGGTGGG - Intronic
1127917195 15:63464525-63464547 CCTTGGCCTCAGAAAGTGCTGGG + Intergenic
1128948787 15:71852611-71852633 CCTTGGCCTCCCAAAGTGGAGGG + Intronic
1129008050 15:72391022-72391044 CCTTGGCCTTCCAAAGTGGTGGG + Intergenic
1129304668 15:74650745-74650767 CCTTGTCCTTCCAAAGTGCTGGG - Intronic
1129637976 15:77342657-77342679 CCTTGTCCTTCCAAAGTGCTGGG + Intronic
1129779381 15:78260125-78260147 GCCTGTCTTTAGGAAGTGGAAGG - Intergenic
1130066661 15:80610422-80610444 CCTTGGCCTTCCAAAGTGGTGGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130348607 15:83070732-83070754 CCTTGTCCTTCCAAAGTGCTGGG - Intergenic
1130967927 15:88710853-88710875 CCTTGGCCTTTGAAAGTGCTGGG + Intergenic
1131668617 15:94596261-94596283 CCTTGTCCTTCCAAAGTGCTGGG - Intergenic
1132673383 16:1111647-1111669 CCTTGGCCTTACAAAGTGCTGGG + Intergenic
1133416585 16:5611875-5611897 CCTTGGCCTTACAAAGTGCAGGG - Intergenic
1133950769 16:10390530-10390552 CCTTGGCCTCACAAAGTGGTGGG - Intronic
1134783356 16:16918686-16918708 CCTTGGCCTTCCAAAGTGCAGGG - Intergenic
1135030382 16:19033429-19033451 CCTTGTACTCAGAAAGTGCTAGG - Intronic
1135583061 16:23644548-23644570 CCTTGTCCTCCGAAAGTGCTGGG + Intronic
1135648822 16:24187629-24187651 CCTTGTGCCTAGAAAGTAGAAGG - Intronic
1136086485 16:27888866-27888888 CCTTGGCCTTCCAAAGTGCAGGG + Intronic
1136352873 16:29722638-29722660 CCTTGGCCTTGCAAAGTGCAGGG + Intergenic
1136901331 16:34041466-34041488 CCATGTCCTCACATAGTGGAAGG + Intergenic
1137562488 16:49511625-49511647 CCTTGTCCTTAGAAGGCCCAAGG - Intronic
1138265874 16:55659055-55659077 GCTTGTCTCTAGACAGTGGAAGG + Intronic
1138369695 16:56516954-56516976 CCTTGTCCTGTGTAACTGGATGG - Intronic
1138689036 16:58750656-58750678 CCTTGGCCTTTGAAAGTGCTGGG + Intergenic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139435916 16:66936271-66936293 CCTTGGCCTTCTAAAGTGGTGGG - Intronic
1140026637 16:71296715-71296737 CCTTGTCCTTTGAAAGCCCATGG - Intergenic
1140447321 16:75040856-75040878 CCTTGGCCTTCCAAAGTGCAGGG + Intronic
1141507863 16:84491187-84491209 CCTTGGCCTCCCAAAGTGGAGGG - Intronic
1141940937 16:87275747-87275769 CCTTGTCCTTATGAAATGAATGG + Intronic
1142830715 17:2547023-2547045 CCTTGGCCTTCGAAAGTGCTGGG - Intergenic
1143077906 17:4360970-4360992 CCTTGGCCTTCCAAAGTGGTGGG - Intronic
1144035979 17:11366388-11366410 CCTTGGCCTCAGAAAGTGCTGGG + Intronic
1144597074 17:16579169-16579191 CCTTGGCCTCCCAAAGTGGAGGG + Intergenic
1145090649 17:19983126-19983148 CCTTGGCCTTACAAAGTGCTGGG - Intergenic
1145956936 17:28861168-28861190 CCTTGGCCTCTGAAAGTGGTGGG + Intergenic
1146362427 17:32187817-32187839 CCTTGGCCTTTCAAAGTGCAGGG + Intronic
1146648022 17:34588249-34588271 CCTTGTTCTTAGAATAGGGATGG - Intronic
1146731491 17:35196290-35196312 CCTTGGCCTTCGAAAGTGCTGGG + Intergenic
1147023215 17:37556197-37556219 CCTTGGCCTTCCAAAGTGCAGGG - Intronic
1147803705 17:43113830-43113852 CCTTGGCCTTAAAAAGTGTTGGG - Intronic
1148008687 17:44456529-44456551 CCTTGTGCTTACAAAGTGCTAGG - Intronic
1148890677 17:50805132-50805154 CCTTGGCCTTCCAAAGTGGTGGG + Intergenic
1151779206 17:76231546-76231568 CCTTGGCCTCCCAAAGTGGAAGG + Intronic
1151783042 17:76260186-76260208 CCTTGACCTTACAAAGTGCTGGG - Intergenic
1153627731 18:7037914-7037936 CCTGGTCCTTTACAAGTGGAAGG - Intronic
1153691352 18:7597103-7597125 CCTTGTCCTTCTAAAGTGCTGGG + Intronic
1154076763 18:11210997-11211019 GCTTGTCCTTTGAAAGGGAAGGG + Intergenic
1154347306 18:13552606-13552628 CCCCGTCGTTAGGAAGTGGAGGG - Intronic
1155316556 18:24577662-24577684 CCTTTTCCTTAGAAAGTGGTTGG - Intergenic
1155483518 18:26315950-26315972 CCTTGGCCTTCGAAAGTGCTAGG - Intronic
1155489703 18:26388463-26388485 CCTTGTCCTCAGAAAGCTTATGG + Intronic
1155973424 18:32102879-32102901 CCTTGGCCTCACAAAGTGTAGGG + Intronic
1156180782 18:34601493-34601515 CCATGTGCTTAGAAAGAGAAAGG + Intronic
1157378526 18:47189505-47189527 CCTTGTCCTTCCAAAGTGCTGGG + Intergenic
1157903981 18:51549647-51549669 CCTTGTCCTCCGAAAGTGCTGGG + Intergenic
1159026046 18:63183089-63183111 CCTTGTCCATAGCAAGGGGTGGG - Intronic
1160078354 18:75699918-75699940 CCTTGTCCTTCCAAAGTGCTGGG + Intergenic
1161181491 19:2886034-2886056 CCTTGTCCTCCCAAAGTGGTGGG - Intergenic
1161960093 19:7518358-7518380 CCTTGGCCTCAGAAAGTGCTGGG - Intronic
1162109695 19:8393431-8393453 CCTTGTCCTTGGGCAGGGGAGGG - Intronic
1162127878 19:8509036-8509058 GCTGGTCCTGAGAAAGTGCAGGG - Intergenic
1163085040 19:14973302-14973324 CCTTGGCCTTAGAAAGTGTTGGG - Intronic
1163387334 19:17007915-17007937 CCTTGTCCTCCCAAAGTGGTGGG - Intronic
1163621190 19:18361387-18361409 CCTTGGCCTTACAAAGTGCTGGG + Intronic
1163998661 19:21076810-21076832 CCTTGGCCTTCCAAAGTGGTGGG + Intergenic
1164821679 19:31255766-31255788 CCTTGTCCTTAGAAATCTGGGGG + Intergenic
1165684914 19:37811666-37811688 CCTTGGCCTCACAAAGTGGCAGG - Intronic
1165781772 19:38438866-38438888 CCTTGTCCTCCGAAAGTGCTGGG + Intronic
1166551999 19:43671918-43671940 CCTTGTCCTTCCAAAGTGCTGGG + Intergenic
1166971607 19:46572305-46572327 CCTTGGCCTTCTAAAGTGGTAGG - Intronic
1167066220 19:47188096-47188118 CCTTGTCCTCTGAAAGTGCTGGG - Intronic
1167196832 19:48034926-48034948 CCTTGTCCTTCCAAAGTGCTAGG + Intronic
925808347 2:7674281-7674303 CCTTCTCTTTAGCAAATGGAGGG - Intergenic
925969738 2:9098058-9098080 CCTTGTTCTCAGGAAGTGGACGG + Intergenic
926478401 2:13357164-13357186 CTCTGTCTTTAGAAAGGGGAGGG + Intergenic
926671587 2:15581858-15581880 CCTTGGCCTTGGAAAGTGCTGGG - Intergenic
927706293 2:25298482-25298504 TCTTGTCCTCAGAAACTGGACGG + Intronic
927789452 2:25998982-25999004 CCTTGGCCTCCGAAAGTGGTAGG + Intergenic
929248392 2:39727118-39727140 CCTTGACCTTTGGAAATGGAGGG - Intergenic
929565563 2:42981944-42981966 CTGTGTCCTCAGACAGTGGAAGG + Intergenic
930765692 2:55083243-55083265 CCTTGGCCTTCCAAAGTGCAGGG - Intronic
930804717 2:55478958-55478980 CCTTCTGCTTACAAAGTCGAAGG - Intergenic
931450900 2:62366793-62366815 CCTTCTCCATAGAATATGGAAGG + Intergenic
931637322 2:64352195-64352217 CCTTTGCCTTGGAAAGGGGAGGG + Intergenic
932340388 2:70959649-70959671 CCTTGTGCTTTGGAAGTGGCAGG - Intronic
933675752 2:85055832-85055854 TCTGGTCCTTAGAAATTTGAAGG - Exonic
935412590 2:102781273-102781295 TTTTGTCCTTAGCAATTGGAGGG + Intronic
936351219 2:111714082-111714104 CCTTGGCCTTACAAAGTGCTGGG - Intergenic
936416518 2:112319393-112319415 CCTTGGCCTCCGAAAGTGGTGGG - Intronic
936896372 2:117432506-117432528 CTGTGTCCTCAGATAGTGGAAGG + Intergenic
937971130 2:127550313-127550335 CCTTGTCCTCTGAAAGTGCTGGG - Intronic
938047265 2:128132955-128132977 CCTTGTCCTTCCAAAGTGCTAGG + Intronic
940166473 2:150779256-150779278 ACTTTTCCTTTGTAAGTGGAAGG - Intergenic
941789756 2:169539015-169539037 CCTTGGCCTCACAAAGTGGTAGG - Intronic
942036605 2:172016365-172016387 CCTTGGCCTTCCAAAGTGGTGGG - Intronic
942166918 2:173250450-173250472 CCTTGTTTTTACAAACTGGAAGG + Intronic
942192230 2:173481616-173481638 CTTTGTCCTGAGCAACTGGAAGG + Intergenic
942363230 2:175195149-175195171 CCTTGGCCTTCCAAAGTGCAGGG + Intergenic
943700014 2:190979579-190979601 ACTTGTACTAAGAAAGTGTAAGG + Intronic
943850492 2:192715617-192715639 CCTTGGCCTTCCAAAGTGCAAGG - Intergenic
944029209 2:195213411-195213433 CTGTGTCCTTACATAGTGGAAGG - Intergenic
944632444 2:201641240-201641262 CCTTGGCCTCTGAAAGTGGTGGG + Intronic
944829419 2:203518263-203518285 CCTTGTCCTTTCAAAGTGCTGGG - Intronic
945639036 2:212399191-212399213 CCTTGGCCTCAGAAAGTGCTGGG + Intronic
946364568 2:219240828-219240850 CCTTGGCCTCAGAAAGTGCTGGG - Intronic
946764469 2:223027323-223027345 CCTTGGCCTCAGAAAGTGCTAGG + Intergenic
946966731 2:225043671-225043693 CATTGGCTTTAGAAAGTGGCAGG - Intergenic
947396019 2:229687573-229687595 GCTTGTCCTTAGAAAGAAGTTGG - Intronic
947507079 2:230715945-230715967 CCTTGTCCTCCCAAAGTGCAGGG + Intronic
947721471 2:232371965-232371987 CCTTGTCCTTCCAAAGTGATAGG + Intergenic
948011572 2:234653244-234653266 CCTTGTCCTAAAAAAGGAGAAGG + Intergenic
948134252 2:235624369-235624391 CTGTGTCCTTAGACAGTAGATGG + Intronic
948534393 2:238635217-238635239 CCCTGCCCTTAGAAAAGGGAGGG - Intergenic
1169316573 20:4595960-4595982 CCTTGGCCTTACAAAGTGCTGGG + Intergenic
1169446756 20:5678231-5678253 CCTTGACCTTCGAAAGTGTTGGG - Intergenic
1169884991 20:10389267-10389289 CCTTGGCCTCACAAAGTGCAGGG - Intergenic
1170139538 20:13111956-13111978 CCTTGTCCTTCTGAAGTGGTGGG - Intronic
1170201567 20:13749815-13749837 CCTTGTCCTCCCAAAGTGGTGGG + Intronic
1170222680 20:13957624-13957646 CCTTGTCCTTCCAAAGTGTTGGG - Intronic
1170438776 20:16356712-16356734 ACTTGTTCTTATAAATTGGAAGG - Intronic
1170844406 20:19950100-19950122 CCCTGCCCTTCCAAAGTGGATGG + Intronic
1171469378 20:25357758-25357780 CCTTGTCCTTCCAAAGTGCTGGG - Intronic
1171781228 20:29420096-29420118 CCTTGTCATTACAAAGTGATGGG + Intergenic
1172068981 20:32242387-32242409 CCTTGGCCTTCCAAAGTGCAGGG - Intergenic
1172414414 20:34752676-34752698 CCTTGGCCTTCTAAAGTGGTGGG - Intronic
1172980383 20:38937228-38937250 TCTAGTCCTTAGAGAGTGGGTGG + Intronic
1173862558 20:46293764-46293786 CCTTGGCCTTCGAAAGTGCTGGG - Intronic
1174241370 20:49138032-49138054 CCTTGTCCTTAAAAAGTTTTGGG - Intronic
1174488631 20:50876792-50876814 CCTTGGCCTTCCAAAGTGGTGGG + Exonic
1174962104 20:55170117-55170139 CCTTTTTTTGAGAAAGTGGAAGG + Intergenic
1175734819 20:61377803-61377825 CCTTGTCCTTAGAAGGCTGGAGG + Intronic
1176804871 21:13470841-13470863 CCTTGGCCTCCGAAAGTGGTGGG - Intergenic
1176876682 21:14136476-14136498 CCCTGTCTTTGGAAAGGGGAGGG + Intronic
1178103688 21:29297098-29297120 CCTTGGCCTTTGAAAGTGCTGGG + Intronic
1178476333 21:32940474-32940496 TGTTGTCCTTGGAAAGTTGAAGG + Intergenic
1179810605 21:43866743-43866765 CCTTGGCCTTAGAAGGTGTAGGG + Intronic
1180162051 21:46002463-46002485 CCTTGTCCCCAGAAAGACGAGGG + Intronic
1181382438 22:22517154-22517176 CCTTGGCCTTACAAAGTGTTGGG - Intronic
1181801565 22:25350968-25350990 CCTTGGCCTCACAAAGTGGTGGG - Intergenic
1182029017 22:27142989-27143011 CCTTGTCCTTCCAAAGTGCTGGG + Intergenic
1182221983 22:28765965-28765987 CCTTGGCCTTCCAAAGTGGTGGG - Intergenic
1182258824 22:29058103-29058125 CCTTATTTTTATAAAGTGGATGG - Intergenic
1182400549 22:30073294-30073316 CCTTGGCCTCACAAAGTGCAGGG + Intergenic
1182650450 22:31847265-31847287 CCTTGGCCTTCCAAAGTGGTGGG - Intronic
1182678792 22:32062003-32062025 CCCTGTCCTCAGATATTGGAAGG + Intronic
1183813006 22:40273895-40273917 CCTTGTCCTTCCAAAGTGCTGGG + Intronic
1183914740 22:41108497-41108519 CCTTGGCCTTCCAAAGTGGTAGG + Intronic
1184537984 22:45100379-45100401 TTTTGTCCTGAGAATGTGGAAGG + Intergenic
1184736946 22:46404737-46404759 CCTTGGCCTTCCAAAGTGGTAGG + Intronic
950136909 3:10587628-10587650 CCTTGGCCTTCCAAAGTGCAGGG + Intronic
951230452 3:20172697-20172719 CCTTGGCCTTACAAAGTGCTGGG - Intronic
951797465 3:26556559-26556581 CCTTGTCCTCTCAAAGTGCAGGG - Intergenic
953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG + Intronic
954350298 3:50037752-50037774 CCTTGACCTTCTAAAGTGTAGGG + Intronic
954358592 3:50104385-50104407 CCTTGGCCTTGCAAAGTGGTGGG - Intronic
956632965 3:71334155-71334177 CCTTGGCCTCACAAAGTGGTGGG - Intronic
957525260 3:81371750-81371772 TATGGTCCTTAGTAAGTGGATGG - Intergenic
957661218 3:83156022-83156044 CCGTGTCCTCACATAGTGGAAGG + Intergenic
958502560 3:94933241-94933263 GATTGTCATTAGAAGGTGGATGG + Intergenic
961393818 3:126572206-126572228 CCTGGCCCTGGGAAAGTGGAGGG - Exonic
962202454 3:133413009-133413031 TCTGTTTCTTAGAAAGTGGAGGG + Intronic
962968655 3:140378682-140378704 CCTTGTACTCAGAAAGAGCATGG + Intronic
963530935 3:146472555-146472577 CCGGGTCCTCACAAAGTGGAAGG + Intronic
963681133 3:148378711-148378733 CCTTGGCCTCACAAAGTGGTGGG - Intergenic
963848553 3:150184049-150184071 CCTTTTCCTTAGAGACGGGAGGG - Intergenic
964665206 3:159164515-159164537 CCTTGGCCTTACAAAGTGCTGGG - Intronic
964952724 3:162316806-162316828 CTCTGCCTTTAGAAAGTGGAGGG - Intergenic
965542294 3:169882222-169882244 CCTTGGCCTCCGAAAGTGCAGGG + Intergenic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
967521794 3:190440615-190440637 TTTTCTCCTTAGAAATTGGAGGG + Intronic
967838754 3:193986467-193986489 CCTTGGCCTTCCAAAGTGCAGGG - Intergenic
968146002 3:196299471-196299493 CCTTGGCCTTCGAAAGTGGTAGG + Intronic
969967016 4:11007396-11007418 CCATGACCTTAGTAAGAGGACGG - Intergenic
970045027 4:11842323-11842345 CCTTGTCCTCCCAAAGTGCAGGG + Intergenic
970386640 4:15563222-15563244 CCTTGTCCTTTGAAGGTGGGTGG - Intronic
970808970 4:20068874-20068896 AATTGTCCTGAGAAAGGGGAAGG + Intergenic
970842787 4:20494899-20494921 CCTTTTCATTAGACAGTTGATGG - Intronic
971239730 4:24877432-24877454 CCTTGGCCTTACAAAGTAGTGGG + Intronic
971981283 4:33754338-33754360 CCTTGGCCTCTGAAAGTGCAGGG - Intergenic
972499902 4:39668093-39668115 CCTTGTCCTCCCAAAGTGGTGGG - Intergenic
972913624 4:43849134-43849156 CCTTGCCCTTAGAATGTTTAGGG - Intergenic
973975402 4:56257819-56257841 CCTTGGCCTTCCAAAGTGGTGGG - Intronic
974040544 4:56853500-56853522 CCTTGGCCTTCTAAAGTGGTAGG - Intergenic
974586641 4:63888572-63888594 CCTTGGCCTTCCAAAGTGGAGGG - Intergenic
975241582 4:72066190-72066212 CTGTGTCCTTACAAGGTGGAAGG + Intronic
976283837 4:83351555-83351577 CTTTGTCCTTCCAAAGTGGTGGG + Intergenic
976302410 4:83527804-83527826 CCTTGACCTTCCAAAGTGCAGGG + Intergenic
976380552 4:84393783-84393805 CCTTATCCTTTGAAATGGGATGG + Intergenic
976618477 4:87102505-87102527 CCTCATCCTTAGAATGTGAAGGG + Intronic
976755255 4:88491130-88491152 GCTTGTCCTTAGTAAGAAGAGGG + Intronic
977608118 4:99003226-99003248 CCTTATCATTATAAAGTGGGAGG + Intronic
978270054 4:106878066-106878088 CCTTGTCCATAGAAAGGGCCTGG - Intergenic
978703809 4:111680805-111680827 CTTAGTACTTAGAAAGTGCATGG + Intergenic
978862327 4:113465281-113465303 CCTTGGCCTTCCAAAGTGCAAGG + Intronic
979153807 4:117356688-117356710 CCTTGGCCTTACAAAGTGCTGGG - Intergenic
979519746 4:121652693-121652715 CCATGTCTTCAGATAGTGGAAGG + Intergenic
980061590 4:128136040-128136062 CCTTGGCCTCCGAAAGTGGTGGG - Intronic
980992113 4:139747116-139747138 CCCTGTCCTCAGAATGTGCAGGG + Intronic
982683319 4:158458903-158458925 CTCTGTCTTTGGAAAGTGGAGGG - Intronic
983199028 4:164840882-164840904 CCTTGACCTTACAAAGTGCTGGG - Intergenic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
984351219 4:178596603-178596625 CCTTGTCCTTCCAAAGTGCTGGG - Intergenic
985745924 5:1647712-1647734 CCATTACCTTGGAAAGTGGAAGG - Intergenic
987517981 5:18939368-18939390 CCATGTCCTCCGAAAGTGTATGG + Intergenic
987911749 5:24155488-24155510 GTTTGACTTTAGAAAGTGGAAGG + Intronic
989205051 5:38801888-38801910 CTTTGGCCTTAGAAAGGGAAAGG - Intergenic
990413271 5:55562228-55562250 CCTTGGCCTTCGAAAGTGCTAGG - Intergenic
990592947 5:57283944-57283966 CCTTATCTTTGGAAAGGGGAGGG + Intergenic
991583235 5:68178032-68178054 CCTTGGCCTCCCAAAGTGGAGGG - Intergenic
991770105 5:70032721-70032743 CCTTATCCTTAGAAACTGTGAGG - Intronic
991849400 5:70908140-70908162 CCTTATCCTTAGAAACTGTGAGG - Intronic
992464247 5:76988108-76988130 CTTTTTCCTTAGACAGTAGAGGG - Intergenic
993522026 5:88914880-88914902 CCTTCTCTTTATAAACTGGAGGG - Intergenic
993884351 5:93398443-93398465 CCTTGAACTTAGAAACAGGAAGG - Intergenic
994577467 5:101596841-101596863 CCTTGTCCTCACATGGTGGATGG - Intergenic
994790290 5:104216689-104216711 CTTTCTCATTAGAAAGTGTATGG - Intergenic
995243123 5:109907738-109907760 CCTTACCCTTGGAAAGCGGAGGG + Intergenic
995507978 5:112880296-112880318 CTTGGTAATTAGAAAGTGGAAGG - Intronic
995717798 5:115097316-115097338 CCTTGGCCTCAGAAAGTGCTGGG + Intergenic
996972835 5:129394176-129394198 CTTTGGCCTTAAAAAGAGGAAGG - Intergenic
998875415 5:146594067-146594089 CTTTCTCCTGAGCAAGTGGAAGG + Intronic
999778205 5:154827796-154827818 CCTTGGCCTTACAAAGTGGTAGG + Intronic
999779667 5:154839073-154839095 CCTTGGCCTCCGAAAGTGCAGGG - Intronic
1001054240 5:168436091-168436113 CCTTTTCCTCCGAAAGTGGTGGG + Intronic
1002262485 5:178004039-178004061 CCTTGTCCTCCCAAAGTGGGAGG + Intergenic
1002678199 5:180936157-180936179 CCTTGTCCTCCGAAAGTGCTGGG + Intronic
1002807196 6:588650-588672 TCTTTTCATTAGAAAGTGAAGGG - Intronic
1004236032 6:13875120-13875142 CCTGGTCCTTTGAAAGTGTGTGG - Intergenic
1004317354 6:14601341-14601363 CCTTATCATTAGCAAGTGGTTGG - Intergenic
1005949647 6:30622310-30622332 CCTTGGCCTCAGAAAGTGCTGGG - Intronic
1006083133 6:31579018-31579040 CCTTGGCCTTGCAAAGTGGTAGG - Intergenic
1006210446 6:32389098-32389120 CCTTGTCCTCAGAAAGTGTTGGG + Intergenic
1006756577 6:36421214-36421236 CCTTGTCCTTCCAAAGTGTTGGG - Intronic
1007027498 6:38591932-38591954 CCTTGGCCTCAGAAAGTGCTGGG - Intronic
1007028654 6:38605354-38605376 ACTAGTTCTTAGTAAGTGGATGG + Intronic
1007910486 6:45508476-45508498 CCTTGGCCTTCCAAAGTGGTGGG + Intronic
1009440060 6:63667093-63667115 CCTTGGCCTTCGAAAGTGCTGGG + Intronic
1010101698 6:72117222-72117244 CCTGGGCCATAGAAAATGGATGG + Intronic
1010211558 6:73366389-73366411 CCTTGGCCTTCCAAAGTGGTGGG - Intergenic
1011427774 6:87249376-87249398 CCTTGGCCTTCCAAAGTGGTGGG + Intronic
1012201195 6:96407986-96408008 CCTGTTCCTTAGAAAATTGATGG - Intergenic
1013733602 6:113200432-113200454 TCCTGTCCTCAGAAAATGGACGG - Intergenic
1015565294 6:134563722-134563744 CCTTGACCTTAGATTGTGTATGG - Intergenic
1015584466 6:134761186-134761208 CCTTGGCCTCAGAAAGTGCTGGG - Intergenic
1015859690 6:137662502-137662524 CCTTGGCCTTACAAAGTGCTGGG - Intergenic
1016291367 6:142531745-142531767 TTTTGTCCTAAGAAAGTGGATGG - Intergenic
1016345330 6:143106872-143106894 CCTAGTTCATAGACAGTGGAAGG + Intronic
1018372557 6:163181505-163181527 ACTTGTCCTTGGAAGGGGGAGGG - Intronic
1019781597 7:2943503-2943525 CCTTGGCCTTACAAAGTGGTGGG - Intronic
1019798558 7:3070784-3070806 TCTTGTCATTTAAAAGTGGATGG - Intergenic
1020160987 7:5771544-5771566 CCTTGGCCTTCCAAAGTGCAGGG - Intronic
1020588873 7:10108675-10108697 CCTTGGCCTTCCAAAGTGCAGGG + Intergenic
1022116606 7:27266489-27266511 CCTTGGCCTTCCAAAGTGGTGGG + Intergenic
1022539101 7:31119699-31119721 CCGTGTCCTCATAGAGTGGAAGG + Intergenic
1022787357 7:33651934-33651956 GCTTGTCTTTAGATAGTGGCTGG + Intergenic
1025099255 7:56121917-56121939 CCTTGGCCTCAGAAAGTGATGGG - Intergenic
1026380932 7:69798738-69798760 CCTTGGCCTTCCAAAGTGCAAGG - Intronic
1026777336 7:73238944-73238966 CCTTGGCCTTCCAAAGTGGTGGG + Intergenic
1027018186 7:74792316-74792338 CCTTGGCCTTCCAAAGTGGTGGG + Intergenic
1027069841 7:75153602-75153624 CCTTGGCCTTCCAAAGTGGTGGG - Intergenic
1027528907 7:79305658-79305680 CCTTGTCCTTCCAAAGTGCTGGG - Intronic
1027801837 7:82762890-82762912 CCTTGGCCTTACAAAGTGCTGGG + Intronic
1028213178 7:88100763-88100785 CCTTGGCCTTCTAAAGTGGTGGG + Intronic
1029153921 7:98501610-98501632 CCTTGGCCTCTGAAAGTGGTAGG + Intergenic
1031082370 7:117271258-117271280 CCTTGTCCTCTGAAAGTGCTGGG + Intergenic
1032105434 7:129025096-129025118 CCTTGGCCTCCGAAAGTGCAGGG - Intronic
1032139503 7:129314568-129314590 CCATGTCCTTGCATAGTGGAAGG + Intronic
1032162330 7:129520469-129520491 CCTTGTCCTTGCAAAGTGCTGGG + Intergenic
1032229906 7:130065466-130065488 CCTTGTCCTTCCAAAGTGCTAGG + Intergenic
1032350981 7:131163514-131163536 CCTTTTCCCTGTAAAGTGGAGGG + Intronic
1033037130 7:137885320-137885342 ACTTGGCCTTGGCAAGTGGAGGG + Intronic
1033115212 7:138619155-138619177 CCTTGTCCTTCCAAAGTGTTGGG - Intronic
1034207245 7:149328525-149328547 CCTTGTCCTTCCAAAGTGCTGGG + Intergenic
1034421602 7:150993737-150993759 CCTTTTCCTTAGGAAGAGGGAGG - Exonic
1034574556 7:151985884-151985906 CCTTGTTTTTAGAAAGAGGCAGG - Intronic
1034616846 7:152425323-152425345 CCTTGGCCTTCCAAAGTGCAGGG - Intronic
1034796058 7:154014753-154014775 CTTTGTTTTTAGAACGTGGAGGG - Intronic
1035731359 8:1855638-1855660 CCTTGGCCTTTGAAAGTGCTGGG + Intronic
1035969632 8:4233544-4233566 CTGTGTCCTCAGACAGTGGAAGG - Intronic
1036002634 8:4625221-4625243 ACTTGTGCTTAAACAGTGGAAGG - Intronic
1036743882 8:11390487-11390509 CCTTCTCCTGAGGATGTGGAGGG - Intronic
1037336005 8:17792611-17792633 CCTTGTCCTTCCAAAGTGCTGGG - Intronic
1037357260 8:18034534-18034556 GTTTGTCCTAAGAAAGTAGAAGG - Intergenic
1037604743 8:20428326-20428348 CCTTGGCCTTTGAAAGTGTTGGG + Intergenic
1038086649 8:24205306-24205328 GCCTTTCCTTAGAAAGTTGATGG + Intergenic
1038097278 8:24328675-24328697 CCTTGGCCTTCGAAAGTGCTGGG - Intronic
1038215588 8:25558950-25558972 CCTTGTCCTTGCAAAGTGCTGGG + Intergenic
1038355726 8:26827560-26827582 CCGTGTCCTCACAAGGTGGAAGG + Intronic
1038705390 8:29888918-29888940 CCTTGTCCTCCCAAAGTGGTGGG - Intergenic
1038923370 8:32110927-32110949 TCTTATCATTAGAAAGTGAAAGG + Intronic
1039080980 8:33733667-33733689 CCTTGTCCTTCCAAAGTGCTGGG + Intergenic
1039186013 8:34917060-34917082 CCTTGGCCTCAGAAAGTGCTAGG - Intergenic
1039681753 8:39746275-39746297 CCTTGGCCTCAGAAAGTGGTGGG + Intronic
1039705785 8:40005999-40006021 CCGTGTCCTCACATAGTGGAAGG - Intronic
1039891860 8:41690970-41690992 CTTTGGCCTTCTAAAGTGGAGGG - Intronic
1040429779 8:47327946-47327968 CCTTGGCCTTCGAAAGTGCTGGG + Intronic
1041044037 8:53875179-53875201 CCTTGGCCTCACAAAGTGGTGGG - Intronic
1041224377 8:55684150-55684172 CCTTGGCCTTTGAAAGTGTTGGG - Intergenic
1041520930 8:58755546-58755568 CCTTGGCCTTACAAAGTGTTGGG + Intergenic
1042215451 8:66426494-66426516 CCTTGGCCTTTCAAAGTGGTAGG - Intergenic
1042767132 8:72334834-72334856 CCTTGGCCTCAGAAAGTGTTGGG + Intergenic
1042787223 8:72561517-72561539 CCTTGTCCTTAGAAAGTGGAAGG - Intronic
1042914895 8:73866025-73866047 CCTTGGCCTTCCAAAGTGGTGGG - Intronic
1043953009 8:86330338-86330360 CCTTGGCCTTACAAAGTGCTGGG - Intergenic
1043990012 8:86741411-86741433 CCTTGTCCTTGCAAAGTGTTGGG - Intronic
1044558540 8:93590411-93590433 CCTTGGCCTTCCAAAGTGGTGGG - Intergenic
1044644040 8:94419257-94419279 CCTTGGCCTCCGAAAGTGGTGGG - Intronic
1045253339 8:100499435-100499457 CCTTGTCCTTAGAAAATGTGTGG + Intergenic
1046347788 8:112957696-112957718 CCTTGTCCTTCCAAAGTGCTGGG + Intronic
1046637806 8:116691622-116691644 CCTTGTCCTTCTAAAGTGCTGGG - Intronic
1046686961 8:117238506-117238528 CCTTTTCTTATGAAAGTGGATGG - Intergenic
1046701001 8:117401395-117401417 CCTTGTCCTTAAATAGTGCCAGG - Intergenic
1046920721 8:119725527-119725549 CCTTGGCCTTGGAAAGTGCTGGG + Intergenic
1046923088 8:119755254-119755276 CCTTGGCCTTCCAAAGTGGTGGG - Intronic
1047668655 8:127120435-127120457 CCATGTCCTCAGATAGTAGAAGG - Intergenic
1047698706 8:127429226-127429248 CCTTGGCCTTCCAAAGTGCAGGG + Intergenic
1047940422 8:129823459-129823481 CCGTGTCCTGAGAATGTGCAGGG - Intergenic
1048499731 8:134964705-134964727 CCTTGTCCTTAAAAAAGAGAAGG - Intergenic
1049270285 8:141692027-141692049 CCTTGACCTTCCAAAGTGGTGGG + Intergenic
1050440305 9:5654801-5654823 CCTTGGCCTTTCAAAGTGTAGGG + Intronic
1051212481 9:14759257-14759279 CCTTGGCCTTCGAAAGTGCTGGG - Intronic
1051704935 9:19867657-19867679 CCTTGTCCTTCCAAAGTGCTGGG - Intergenic
1051991030 9:23153208-23153230 CTCTGTCTTTAGAAAGGGGACGG - Intergenic
1052574313 9:30272558-30272580 CCTTGCCCTTAGATTGTGGAGGG - Intergenic
1052743974 9:32421594-32421616 CCTTGGCCTCTGAAAGTGGTGGG - Intronic
1052788187 9:32849527-32849549 GGTTGACCTCAGAAAGTGGAAGG + Intergenic
1053944313 9:43290504-43290526 CTATGTCCTCAGACAGTGGAAGG - Intergenic
1053946481 9:43314287-43314309 CTATGTCCTCAGACAGTGGAAGG + Intergenic
1054150042 9:61595066-61595088 CCTTGTCCTTCCAAAGTGCTTGG - Intergenic
1054469806 9:65526168-65526190 CCTTGTCCTTCCAAAGTGCTTGG - Intergenic
1055941551 9:81655113-81655135 CCTTGGCCTCAGAAAGTGCTGGG - Intronic
1056989891 9:91400892-91400914 CCTTGTCCTTTCAAAGTGCTGGG + Intergenic
1057340243 9:94194447-94194469 CCTTGGCCTCTGAAAGTGGTGGG + Intergenic
1057415952 9:94862437-94862459 CCATGTCCTGAGAAAAGGGAGGG + Intronic
1058890363 9:109355870-109355892 CCTTGTCCTTCCAAAGTGTTGGG + Intergenic
1059906157 9:118989199-118989221 TTTTGACCTTAGAAAGTGGAGGG + Intergenic
1060330157 9:122660813-122660835 CCTTGGCCTTCCAAAGTGGTGGG - Intergenic
1061249443 9:129417891-129417913 CCTTGTCCTCACATGGTGGAAGG + Intergenic
1061306612 9:129736238-129736260 CCTTGAGCTTGGGAAGTGGAGGG - Intergenic
1061646977 9:132011549-132011571 CCTTGACCTTTGAAAGTGCTGGG - Intronic
1062033865 9:134374140-134374162 CCTTGTCCCCAGAAAGGGGATGG - Intronic
1203587449 Un_KI270747v1:19082-19104 CTATGTCCTCAGACAGTGGAAGG - Intergenic
1203589611 Un_KI270747v1:42845-42867 CTATGTCCTCAGACAGTGGAAGG + Intergenic
1186131039 X:6465541-6465563 CCTAGTCTTTAGAAAGGGAAAGG - Intergenic
1186407842 X:9319208-9319230 CATTGTCCTTAAAAAATTGAGGG - Intergenic
1186761006 X:12721477-12721499 GCTTGTACTGAGAAAGTGTAAGG - Exonic
1186798507 X:13069481-13069503 CCTTGGCCTTCCAAAGTGGTAGG - Intergenic
1187164152 X:16788916-16788938 CCTTGGCCTTCCAAAGTGGCGGG + Intronic
1187858027 X:23655750-23655772 CCTCGTCCTTCCAAAGTGGTGGG - Intergenic
1187918789 X:24180631-24180653 CCTTGGCCTTCCAAAGTGGGAGG + Intronic
1188731428 X:33650622-33650644 CCTTGGCCTCAGAAAGTGCTGGG + Intergenic
1189441220 X:41037929-41037951 CCTTGTCCTTCCAAAGTGCTGGG - Intergenic
1190810082 X:53874676-53874698 CCTTGGCCTTCCAAAGTGGTGGG - Intergenic
1192732631 X:73816553-73816575 CCTCGTCCTTCCAAAGTGGTGGG - Intergenic
1192747112 X:73950130-73950152 CCTTGGCCTCCGAAAGTGGTGGG + Intergenic
1193078725 X:77383058-77383080 CTTTGTCTTTGGAAAGGGGAAGG + Intergenic
1193204796 X:78736091-78736113 CCTTTGCTTTAGAAAGGGGAGGG - Intergenic
1194288990 X:92045687-92045709 CCTTGGCCTTCGAAAGTGCTGGG - Intronic
1194617878 X:96129655-96129677 CCTCGTCCTGAGATAGTGGCAGG - Intergenic
1195073039 X:101299680-101299702 CCTTGGCCTTCCAAAGTGCAGGG - Intergenic
1195546034 X:106113668-106113690 CCTTGGCCTTCCAAAGTGCAGGG + Intergenic
1195663434 X:107405318-107405340 TCTTGTCCATAGAAACTTGATGG - Intergenic
1196327774 X:114428530-114428552 CCTTGTCCTCACAAAGTGCTGGG - Intergenic
1196912414 X:120497728-120497750 CCTTGTCCTTGAAATGTCGAAGG - Intergenic
1197544471 X:127808308-127808330 CCTTGGGCTCTGAAAGTGGATGG + Intergenic
1198417256 X:136433414-136433436 CCTTTTCCTTTGAAACAGGAAGG - Intergenic
1199036125 X:143053003-143053025 CCTTGCCTTTGGAAAGGGGAAGG - Intergenic
1200606509 Y:5270255-5270277 CCTTGGCCTTCGAAAGTGCTGGG - Intronic
1200786112 Y:7261910-7261932 CCTTGGCCTTCCAAAGTGGTGGG + Intergenic
1200900139 Y:8423115-8423137 CCTTGGCCTTACAAAGTGATGGG + Intergenic