ID: 1042787904

View in Genome Browser
Species Human (GRCh38)
Location 8:72569844-72569866
Sequence ACTTTCTCTGGAAATTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042787904_1042787907 27 Left 1042787904 8:72569844-72569866 CCATCAAAATTTCCAGAGAAAGT No data
Right 1042787907 8:72569894-72569916 TAAGTCAAAGAAAGTTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042787904 Original CRISPR ACTTTCTCTGGAAATTTTGA TGG (reversed) Intronic