ID: 1042787906

View in Genome Browser
Species Human (GRCh38)
Location 8:72569870-72569892
Sequence TTGCTTTATTTTTATACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042787906_1042787907 1 Left 1042787906 8:72569870-72569892 CCAACTGTATAAAAATAAAGCAA No data
Right 1042787907 8:72569894-72569916 TAAGTCAAAGAAAGTTTGAAAGG No data
1042787906_1042787908 10 Left 1042787906 8:72569870-72569892 CCAACTGTATAAAAATAAAGCAA No data
Right 1042787908 8:72569903-72569925 GAAAGTTTGAAAGGTTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042787906 Original CRISPR TTGCTTTATTTTTATACAGT TGG (reversed) Intronic