ID: 1042787906 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:72569870-72569892 |
| Sequence | TTGCTTTATTTTTATACAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1042787906_1042787908 | 10 | Left | 1042787906 | 8:72569870-72569892 | CCAACTGTATAAAAATAAAGCAA | No data | ||
| Right | 1042787908 | 8:72569903-72569925 | GAAAGTTTGAAAGGTTACTGTGG | No data | ||||
| 1042787906_1042787907 | 1 | Left | 1042787906 | 8:72569870-72569892 | CCAACTGTATAAAAATAAAGCAA | No data | ||
| Right | 1042787907 | 8:72569894-72569916 | TAAGTCAAAGAAAGTTTGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1042787906 | Original CRISPR | TTGCTTTATTTTTATACAGT TGG (reversed) | Intronic | ||