ID: 1042787960

View in Genome Browser
Species Human (GRCh38)
Location 8:72570778-72570800
Sequence GTGTTTGTCCTCACTTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042787957_1042787960 5 Left 1042787957 8:72570750-72570772 CCCTTGTGTAGGAATGCTTGGAA 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1042787960 8:72570778-72570800 GTGTTTGTCCTCACTTGCTGAGG No data
1042787958_1042787960 4 Left 1042787958 8:72570751-72570773 CCTTGTGTAGGAATGCTTGGAAC 0: 1
1: 0
2: 1
3: 6
4: 69
Right 1042787960 8:72570778-72570800 GTGTTTGTCCTCACTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042787960 Original CRISPR GTGTTTGTCCTCACTTGCTG AGG Intronic
No off target data available for this crispr