ID: 1042788366

View in Genome Browser
Species Human (GRCh38)
Location 8:72575051-72575073
Sequence TTTCCCATGGGGCATATACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042788362_1042788366 2 Left 1042788362 8:72575026-72575048 CCAAATGCTAAGAGTTTATAGGA 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1042788366 8:72575051-72575073 TTTCCCATGGGGCATATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042788366 Original CRISPR TTTCCCATGGGGCATATACC TGG Intronic
No off target data available for this crispr