ID: 1042788724

View in Genome Browser
Species Human (GRCh38)
Location 8:72579813-72579835
Sequence CAGAATAAGAAGATAGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 460}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042788724_1042788727 21 Left 1042788724 8:72579813-72579835 CCTTACTCTATCTTCTTATTCTG 0: 1
1: 0
2: 1
3: 37
4: 460
Right 1042788727 8:72579857-72579879 TACTGCTTCCTTCCCAGCCTGGG No data
1042788724_1042788726 20 Left 1042788724 8:72579813-72579835 CCTTACTCTATCTTCTTATTCTG 0: 1
1: 0
2: 1
3: 37
4: 460
Right 1042788726 8:72579856-72579878 ATACTGCTTCCTTCCCAGCCTGG No data
1042788724_1042788729 23 Left 1042788724 8:72579813-72579835 CCTTACTCTATCTTCTTATTCTG 0: 1
1: 0
2: 1
3: 37
4: 460
Right 1042788729 8:72579859-72579881 CTGCTTCCTTCCCAGCCTGGGGG No data
1042788724_1042788728 22 Left 1042788724 8:72579813-72579835 CCTTACTCTATCTTCTTATTCTG 0: 1
1: 0
2: 1
3: 37
4: 460
Right 1042788728 8:72579858-72579880 ACTGCTTCCTTCCCAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042788724 Original CRISPR CAGAATAAGAAGATAGAGTA AGG (reversed) Intronic
901941304 1:12664115-12664137 AAGAAGAAGAAGAAAGAGTGAGG + Intronic
902847616 1:19124327-19124349 CAGAATCAGAAGGTAAAGTATGG + Intronic
903085637 1:20855530-20855552 AAGAATAAGAAGAAAGAGATTGG + Intronic
903086477 1:20864213-20864235 CAGAAGAAGAAAAAAGAATATGG + Intronic
904354252 1:29928377-29928399 CAGAATAAAAAGGCAGAGGAAGG - Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905341979 1:37284677-37284699 CAGACTAAGAAGATGCAGGATGG - Intergenic
906373705 1:45276476-45276498 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
907582820 1:55587251-55587273 CAGAATAAGAAAAAACACTAGGG + Intergenic
907820907 1:57967462-57967484 CATAATAAGGACACAGAGTATGG - Intronic
907856916 1:58312651-58312673 CAGAATAAGAAGAGCCAGGAAGG + Intronic
909123672 1:71637606-71637628 TATAATTAGAAGATAGAATAGGG + Intronic
909248792 1:73326319-73326341 CAGATTAAGAATTTGGAGTATGG - Intergenic
909377475 1:74956709-74956731 AATAATAAGAAGAGATAGTATGG + Intergenic
910009517 1:82443823-82443845 CAGAAAGAGAAAATAGAGCAAGG + Intergenic
910819192 1:91328221-91328243 CAGACTAAGAAGAAAAAGAAGGG + Intronic
911879436 1:103216544-103216566 CACAATGAGAAGATACAGCAGGG - Intergenic
911993903 1:104737779-104737801 CAGAATAGGAAAATAGAGCTTGG + Intergenic
911994614 1:104749774-104749796 CAGAAAGAGAAGATAGTATAAGG - Intergenic
913266076 1:117046075-117046097 TAGAACAAAAAGATAGAGAAAGG - Intergenic
915137266 1:153741547-153741569 CAGAATCTGGAGATAGAGAAAGG - Intronic
915537054 1:156543114-156543136 AAGAAAAAGAAGATAAAGAATGG + Intronic
915721871 1:157992040-157992062 CACAATTAGAAGACAGAGAAAGG - Intergenic
915812081 1:158923765-158923787 CATAATAACAAGATTGAGGAAGG + Intergenic
915913902 1:159930102-159930124 CAAGATGAGAAGATAGAGTTTGG + Intronic
915952887 1:160201650-160201672 GAGAATCACAAGAAAGAGTATGG - Exonic
915980050 1:160414886-160414908 CAGAATCAGAAGGTGAAGTATGG + Intronic
917844671 1:179010804-179010826 AAGACTAAGAAGATAGAGATTGG + Intergenic
917875133 1:179279644-179279666 CAGAAGGAGAGGATAGAGAAAGG - Intergenic
918693196 1:187508463-187508485 TAGAAGAAGAAGGTAGAGCAAGG + Intergenic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
919888730 1:201954758-201954780 AAGAAAAAGAAGAGAGAGAAAGG + Intergenic
920645361 1:207799329-207799351 CTGAATAGGAAGATAGGGTAGGG + Intergenic
920764090 1:208814750-208814772 AAGAATAACAAGAAAGAGAAGGG + Intergenic
920794494 1:209125453-209125475 CAAAATAAGGAGATAGGGAAAGG - Intergenic
920982826 1:210854405-210854427 AAAAATAAGAAAATAGAGAAAGG + Intronic
921482885 1:215683711-215683733 GTGAATAAGAAGAAAGAGAAAGG - Intronic
923162518 1:231328157-231328179 CAGAATGAAAAAATACAGTATGG - Intergenic
923661629 1:235962171-235962193 CCAAATAAGAAAACAGAGTAGGG + Intergenic
1063517317 10:6709693-6709715 CAAAATGAGAAGAGAGAGCAGGG + Intergenic
1063647115 10:7896227-7896249 GAGAAAAAGAATATAGAGAAGGG - Intronic
1063859533 10:10292540-10292562 GAAAATCAGAAGATAGAGTCGGG + Intergenic
1064581116 10:16794002-16794024 TAGAATAAGAAGGCAGAGGAAGG + Intronic
1064635638 10:17363596-17363618 CATATTAATAAGATAAAGTATGG - Intronic
1064855127 10:19758984-19759006 AAGAAGAAGAAGACAGAGAATGG - Intronic
1064870683 10:19933750-19933772 CTGAAAAGGAAGATAAAGTATGG + Intronic
1065041567 10:21703048-21703070 CAAAGTAAGAAGAAAGAGAAAGG - Intronic
1065184577 10:23159397-23159419 CAGCATAAGAAGAAACAGTCGGG - Intergenic
1065347311 10:24760800-24760822 AAGAATAAGAAGAAAGAATCAGG + Intergenic
1065848938 10:29770702-29770724 AAGAAGAAGACGACAGAGTAGGG + Intergenic
1066053186 10:31656509-31656531 CAGAAGGAGATGATAGAGAAAGG - Intergenic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1067921762 10:50465675-50465697 CAGACTAAGAAAAGAGAGAATGG + Intronic
1068278801 10:54839557-54839579 CAGAAAAAGGAGAGAGAGAAGGG + Intronic
1068599797 10:58944642-58944664 CAGAAACAGAAGGAAGAGTATGG - Intergenic
1068801496 10:61145615-61145637 CAGAAGAAAAAGACAGAGTATGG - Intergenic
1069119432 10:64550605-64550627 CAGAAGAAGGAGATAGAAAAGGG - Intergenic
1069212161 10:65775862-65775884 CAGAATAATAAAATAAAGAAAGG + Intergenic
1069429124 10:68317925-68317947 CACAATAAAAAAATAAAGTAAGG + Intronic
1069459338 10:68579883-68579905 CAAAAAAAGAAGAGAGAGAAAGG - Intronic
1070354249 10:75624217-75624239 CAGAATTAGGAGAAAGACTAAGG + Intronic
1071699363 10:87913666-87913688 CAGAATAAAAAGAGAGAAAAGGG - Intronic
1071776263 10:88791776-88791798 CAGAAAAAAAAAATAGAGAAGGG - Intergenic
1072205414 10:93199829-93199851 TAAAATAAGATGATAGAGCAAGG + Intergenic
1072706371 10:97684077-97684099 CAGCAAAACAACATAGAGTAGGG - Intronic
1077347060 11:2065914-2065936 CAGAATATGGAGACTGAGTATGG - Intergenic
1077972337 11:7207506-7207528 TAAAATAAGAAAATATAGTAAGG + Intergenic
1078127201 11:8579067-8579089 CAGAATAAGAAAAAAGAAAAAGG - Intronic
1078631086 11:13005138-13005160 CAGAGGAAGAGGAGAGAGTATGG - Intergenic
1078667975 11:13341723-13341745 CAGAATAAGAGGAGAGAGCCTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078998177 11:16725871-16725893 CAGAATAAGAAGTTATTCTAAGG - Intronic
1080018557 11:27533937-27533959 GAGAAAAATAAGTTAGAGTAAGG + Intergenic
1080347459 11:31340882-31340904 CAGAATGAGTAGATAGAGAAGGG + Intronic
1080507671 11:32933055-32933077 CAGAAGAATAAGAAAGAGAAGGG - Exonic
1080930415 11:36804402-36804424 AAGAATAAGAAAAGAAAGTAAGG - Intergenic
1081330858 11:41797981-41798003 CAGACTAAGAACAAAGAGTCAGG - Intergenic
1081338115 11:41892940-41892962 CAGAAAATGAAGATAGAGGTGGG - Intergenic
1082890484 11:58133621-58133643 CAGAATCAGAAGACATAGAAAGG + Intronic
1086224767 11:84494516-84494538 CAGATGGAGAAGATAGAGTCAGG + Intronic
1086796301 11:91107941-91107963 GAAAATAAAAATATAGAGTAAGG + Intergenic
1086810697 11:91306813-91306835 CAGAATTAGAGGACAGAGTTAGG + Intergenic
1087058463 11:93956058-93956080 CAGATTAAGTAGTTAGATTATGG - Intergenic
1087973609 11:104516604-104516626 AAGAAAAAGAAGATGGAGAAAGG - Intergenic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1089915056 11:122146369-122146391 CAGAATATGAAAATACAGCATGG + Intergenic
1090105474 11:123850589-123850611 CAGAAATAGAATACAGAGTAGGG - Intergenic
1090357884 11:126152220-126152242 CAGGAGAAGAATATAGAGAAAGG - Intergenic
1090545735 11:127765638-127765660 TATAACAAGAAGATAGACTAGGG + Intergenic
1090683722 11:129091019-129091041 CAGAATAAAAAGATAAGGGAGGG + Intronic
1090888624 11:130902162-130902184 CAGAATGAGAAAATAGAGCTTGG - Intronic
1091040061 11:132269177-132269199 TAGAACAAGAAAATAAAGTATGG + Intronic
1091523193 12:1268925-1268947 GAGAAAAAGATGAGAGAGTAAGG + Intronic
1091527035 12:1313191-1313213 CAGAATATGAAGAAAGACAAGGG + Intronic
1092138875 12:6168867-6168889 CAGAATAACAAGAGAAAGTCTGG + Intergenic
1092519983 12:9260657-9260679 CTGAATTTGAAGATAGAGAAAGG + Intergenic
1093714087 12:22361869-22361891 CACAATTAGAAGATAGGTTAAGG + Intronic
1093896755 12:24583366-24583388 AAGAAAAAGAAGAAAGAGAAGGG + Intergenic
1093988610 12:25565342-25565364 CAGAATAAGAAAACAGATAATGG - Intronic
1095214614 12:39533187-39533209 CAAAAAAAGAAAATAGAGAAAGG + Intergenic
1095429646 12:42119427-42119449 CAGAAAGAGAAGAAAGAGAAAGG + Intronic
1095734430 12:45541181-45541203 GGGAATAAGAAGAGAGAGGAGGG - Intergenic
1095769224 12:45933585-45933607 CAAAAGAAGAAAATAAAGTAGGG + Intronic
1097616587 12:61891344-61891366 CAGAATCAGAAGAAAAAGAAGGG + Intronic
1098808837 12:75057903-75057925 CAAAATAAAAATATAGAGGAAGG - Intronic
1098822720 12:75253126-75253148 CAGAAAAAGAAAAGAGAGTGTGG - Intergenic
1099131335 12:78836001-78836023 CAAAATAAGCAAATAGAGAATGG + Intergenic
1101856331 12:108446353-108446375 CTTAATAAGAAGATAGATTTAGG + Intergenic
1102776719 12:115526123-115526145 GAGAAAAAGAAGATAGAGACAGG - Intergenic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103814484 12:123642871-123642893 CAAAAAAAGAAAAAAGAGTATGG - Intronic
1106602902 13:31202322-31202344 CAGAATGAGAAGATTGAGTCAGG + Intronic
1106816778 13:33417584-33417606 CAGAATAAAAAAGTAAAGTATGG + Intergenic
1106949731 13:34870017-34870039 CAGAGTAAGAAGATACAGGCAGG + Intergenic
1107334327 13:39337936-39337958 CAGAATAAGAATATAAAGGAAGG + Intergenic
1107933229 13:45323724-45323746 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1108101314 13:46959314-46959336 GAGAATTAGAAAATAAAGTATGG - Intergenic
1108135918 13:47359549-47359571 AAGAATAAAAAGATAAAGTTAGG - Intergenic
1108263590 13:48681886-48681908 CAGTTTAAGAAGTTAGAGAAGGG - Intronic
1109082065 13:57916667-57916689 CACAATAAGAAAACAGAGTAAGG - Intergenic
1109100091 13:58172794-58172816 CAGCATAAGAATATAGAGCTGGG + Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109586751 13:64414194-64414216 CAGAACTAGAACGTAGAGTATGG + Intergenic
1109760959 13:66828220-66828242 CAGAATAAGAAGGTAAATCAAGG + Intronic
1109784496 13:67156284-67156306 CAGCAGAAGAAGATAGAGGCAGG + Intronic
1110150305 13:72243909-72243931 AAAAATAAAAAAATAGAGTAAGG - Intergenic
1110150629 13:72248718-72248740 CAGAATAAGAGGAAAAAGGATGG + Intergenic
1111299586 13:86330344-86330366 CAGAAATAGAAGAGAGAGAATGG - Intergenic
1112948662 13:104962464-104962486 CAGAATAAGAAGATGGACCGTGG - Intergenic
1113825376 13:113248519-113248541 CACAATAAAAAAATACAGTATGG - Intronic
1114348146 14:21819713-21819735 CAGAATAAGAACAAAGAACAAGG - Intergenic
1115718817 14:36137063-36137085 CAGAATAACAAGGTAGAAAATGG + Intergenic
1115899522 14:38129396-38129418 CAGAATAAGAACCAAGAGAAAGG + Intergenic
1116139430 14:40971733-40971755 CAGAATGAGCAAAAAGAGTAGGG - Intergenic
1116266658 14:42700175-42700197 AGGAAGAAGAAAATAGAGTAAGG + Intergenic
1117225023 14:53648350-53648372 CAGAAGGAGAAGAGAGAGAATGG + Intergenic
1117937349 14:60920993-60921015 CAGAAGAAGAAGAGAGACTTAGG - Intronic
1118867239 14:69713130-69713152 CAGAGTAACAAGATAGAAAAAGG - Exonic
1119073928 14:71616609-71616631 CAGAAAAAGAAGCTAGAGTGTGG + Intronic
1119126402 14:72131159-72131181 CAGAATAAGATGATTGAGTTAGG - Intronic
1120345300 14:83281335-83281357 CAGAATAATAACATAGAGGAGGG - Intergenic
1120498002 14:85260218-85260240 CAGGACAAGAAGATAGAGAGTGG + Intergenic
1121058686 14:90883228-90883250 CAGAAGGAGAAGAAAGAGAAAGG - Intronic
1121284493 14:92724763-92724785 CAGTACAAGCAGACAGAGTAGGG - Intronic
1121674846 14:95744099-95744121 CAGAACAAGAAGGTAGAGGAAGG + Intergenic
1122163744 14:99805438-99805460 GAGAATAAGTAAATAGAATATGG - Intronic
1122181133 14:99955624-99955646 CAGAACAAAAAGGTAGAGGAAGG + Intergenic
1202901220 14_GL000194v1_random:41162-41184 CAGATTTAGATGATAGAGTGAGG + Intergenic
1125156813 15:36596840-36596862 CAGAAGAAGAAGCTACAGAATGG + Intronic
1125303880 15:38288211-38288233 CAGAAGAGGAAGGTAGAGGAAGG + Intronic
1125582570 15:40797061-40797083 TAGAACAAGAAATTAGAGTAGGG + Intronic
1125846374 15:42858526-42858548 CATAATAAAAAATTAGAGTAAGG + Intronic
1126254683 15:46612502-46612524 CAGAACAAGAATAGAGAATAGGG - Intergenic
1127240113 15:57104266-57104288 CATAATTGGAAGATAGAGGAAGG + Intronic
1128021932 15:64399276-64399298 CAGAATAAGCTGATAGACAATGG + Intronic
1128095596 15:64952009-64952031 AAGAAAAAGAAGATAGAAGATGG - Intronic
1129102131 15:73275217-73275239 CAGAATCACAACATTGAGTAAGG - Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1131424628 15:92335422-92335444 CAGAAAAAGAAGAGAGAGGGAGG - Intergenic
1131516417 15:93080583-93080605 CAGAGCAAGAGGATGGAGTAGGG - Intronic
1131737997 15:95354885-95354907 CTGAATAAGAAGACAGGGCAGGG + Intergenic
1132924148 16:2418950-2418972 CTGAATAAGATGATAGATTTAGG + Intergenic
1135486315 16:22868667-22868689 CAGAATTGTAAGATAGAGCACGG - Intronic
1136032160 16:27511216-27511238 CAGAACAAGAAGCCAGAGGAAGG + Intronic
1137552228 16:49445493-49445515 CAGAAAAACAAGATAGAATTGGG + Intergenic
1137897169 16:52226509-52226531 TAGAACAAGAAAATAGAGGAAGG - Intergenic
1137976056 16:53033124-53033146 CAGATTAACAAGAGAGAGCAAGG - Intergenic
1138807586 16:60108604-60108626 AAGAAAAAGAAGATTCAGTATGG - Intergenic
1138833484 16:60404561-60404583 CAGATTAAGAAGTTAGACTGTGG + Intergenic
1139057900 16:63208503-63208525 CAGAAAAAGAAGAAAGAAAAAGG + Intergenic
1139178901 16:64722586-64722608 CAAATGAAGGAGATAGAGTAAGG + Intergenic
1139935187 16:70565338-70565360 CAGAATAAGAAGCAAGAGTAAGG - Intronic
1140601764 16:76485055-76485077 CAAAATAATTAGTTAGAGTAAGG + Intronic
1141857904 16:86697136-86697158 CAGAAAAAGAACATCAAGTATGG - Intergenic
1144380539 17:14692976-14692998 CAGAAAGAGAAGATAAAGAAAGG - Intergenic
1146597343 17:34181713-34181735 AAGAAGAAGAAGAGAGAGAAAGG + Intergenic
1147021552 17:37537983-37538005 GAGAGAAAGAATATAGAGTATGG + Intronic
1148327410 17:46791210-46791232 CAGAAAAAAAAAAAAGAGTAAGG - Intronic
1148972821 17:51499259-51499281 CAGAAAATGAAGAAAGACTATGG + Intergenic
1149262310 17:54893384-54893406 CAGAATAAGAGGATAAAGAGAGG + Intergenic
1149358453 17:55868748-55868770 CAGAAGAAAGAGAGAGAGTAGGG + Intergenic
1149667004 17:58371886-58371908 GTGAATGAGAAGAGAGAGTAAGG - Intronic
1149731342 17:58949664-58949686 CAGAGAAAGAAGAAAGAGAAAGG - Intronic
1149749047 17:59127914-59127936 CTGGATAAGAAAATGGAGTATGG + Intronic
1150059464 17:62052686-62052708 TAGAAGAAGAAGATGGAGTGTGG - Exonic
1150608205 17:66712514-66712536 AAAAATAAGAAGAAAGAGTTAGG + Intronic
1150965057 17:69958755-69958777 CAGAGAGAGAAGGTAGAGTAGGG + Intergenic
1151133300 17:71920930-71920952 AAAAAGAAGAAGAAAGAGTAGGG + Intergenic
1153381482 18:4444745-4444767 CAGAAAAAAAATATACAGTATGG + Intronic
1153705946 18:7746039-7746061 CAGAAAAAGAGGAGAGAATAGGG + Intronic
1154292200 18:13118476-13118498 ACGAATAAAAAGAAAGAGTAAGG - Intronic
1155646592 18:28085726-28085748 GAGAATAGGAATATAGAGTATGG - Intronic
1155789262 18:29944850-29944872 CAGAATCAGAAGATTGATGAAGG - Intergenic
1156512040 18:37645473-37645495 CAGAAAAGGAAGAGAGAGAATGG + Intergenic
1156548634 18:37991113-37991135 AAGGAGAAGAAGATAGAATAGGG + Intergenic
1157484694 18:48078520-48078542 CAGCATAAGAAGAGTGAGTTGGG + Intronic
1157772601 18:50362486-50362508 GAGAATAAGAGGATAAAATAAGG - Intergenic
1158008082 18:52695983-52696005 CAGAATAAAAACTTTGAGTATGG - Intronic
1158029068 18:52940316-52940338 CAGAGTAAGAAGTCAGAGTAGGG + Intronic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158485216 18:57860145-57860167 CAGAAAGAGAAGAGAGAGAAAGG - Intergenic
1159926058 18:74269944-74269966 CAGAGGTAGAAGATAAAGTAGGG + Intronic
1161909657 19:7183712-7183734 CAGAACAAGAAAATATAATAAGG - Intronic
1164019189 19:21282380-21282402 AAGAATAACAAAATAGAGTGAGG - Intronic
1165163647 19:33834281-33834303 CAGAATGAGAAAAGAGAGTGTGG + Intergenic
1166616750 19:44255831-44255853 CACAATAAGAGGAGAGAGAAAGG + Intronic
1167841050 19:52120500-52120522 CACAATCAGAAGATAGAGACTGG + Intronic
926377817 2:12251269-12251291 CAAAAGAAGAACATGGAGTATGG - Intergenic
926864434 2:17342375-17342397 CAGAATAAGAACATGGAGATCGG + Intergenic
926960329 2:18351147-18351169 AAGACTAAGAAGAGACAGTAGGG - Intronic
927254687 2:21030019-21030041 CAGAATAAGAGAAGAGAGTCAGG + Intronic
927488384 2:23504662-23504684 CAGAAAAAGAAGCTGGAGCAAGG + Intronic
928538484 2:32262361-32262383 AAGAGGAAGAAGATAGAGGAAGG + Intronic
928738141 2:34316719-34316741 GAGAATGTAAAGATAGAGTAAGG + Intergenic
929162421 2:38845695-38845717 GAGACTAAGAAGAGAAAGTAGGG + Intronic
929359232 2:41064164-41064186 GAGAATCTGAAGATAGAGAAAGG - Intergenic
930085943 2:47497353-47497375 AAGAAAAAGAAGATACTGTAAGG - Intronic
930409058 2:51000267-51000289 CAGGATAAGGACATAGAGAATGG - Intronic
933078522 2:77959304-77959326 CAGATCAATAAGAAAGAGTATGG - Intergenic
933175296 2:79167028-79167050 CAGAATCAGAACATGGAGAATGG - Intergenic
933427126 2:82127232-82127254 CAGAGCAAGAAAATAGGGTATGG + Intergenic
933530628 2:83506061-83506083 CCGAGGAAGAAGATAGAGAAGGG - Intergenic
933936829 2:87212753-87212775 CAGAAAAAGAATATATACTAAGG - Intergenic
934505563 2:94889927-94889949 CAGATTTAGATGATAGAGTGAGG - Intergenic
935224254 2:101039326-101039348 CAGAATAATAACATGGAGTTAGG + Intronic
936356314 2:111753072-111753094 CAGAAAAAGAATATATACTAAGG + Intergenic
936845637 2:116828101-116828123 CAGAATAAAAAGAAAGCATATGG - Intergenic
937269106 2:120636518-120636540 CAGAAAAAGAACAAAGATTATGG - Intergenic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
938260478 2:129892141-129892163 CAGACGAAGAACATAGAGAAAGG - Intergenic
939092446 2:137795069-137795091 CAGAATAGCAAGAGAGAGTAAGG + Intergenic
939160674 2:138584783-138584805 AAGAAAAAGAAGAAAGAGAAGGG + Intergenic
939212457 2:139194201-139194223 CAGACTAAGAAGAAAGAAAATGG - Intergenic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941535434 2:166717517-166717539 AAGAAGAATAAGATAGAGAAAGG - Intergenic
942533688 2:176940212-176940234 CAGAATTAGAAGCCAGAGTCAGG - Intergenic
942778320 2:179611921-179611943 GAGAATAAGAAGGGAGAGAAAGG - Intronic
943280330 2:185924073-185924095 CAGAACAGGGAGAGAGAGTATGG - Intergenic
944239231 2:197469693-197469715 CAGATTAAGGAAATAGGGTATGG + Intronic
944447401 2:199805295-199805317 CAGGATCAGAAAGTAGAGTATGG + Intronic
944845048 2:203659740-203659762 CAGGACAAGAAGAGAAAGTAGGG + Intergenic
945923221 2:215777685-215777707 CAGAAAACGTAGATAGTGTACGG + Intergenic
947048880 2:226019712-226019734 CAGAATGAGAACAAAGAGAAGGG + Intergenic
947271565 2:228342242-228342264 CATAATATGAAGATAGAGTGTGG - Intergenic
947759310 2:232592010-232592032 CAGAACAAAAAGGCAGAGTAGGG + Intergenic
1168735071 20:127725-127747 CAGAAGGAGAAGAAAGAGAAAGG + Intergenic
1170034090 20:11971955-11971977 CTGATTAAGAAAATAGAATATGG - Intergenic
1170215912 20:13891057-13891079 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
1170491733 20:16883967-16883989 CACAAAAAGAAGAAAGAGAAAGG - Intergenic
1170823450 20:19773413-19773435 CACAATCAGAAAATAGAGTCAGG + Intergenic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1171336127 20:24387387-24387409 CTGAATATGAAGACAGATTAGGG + Intergenic
1173452795 20:43180089-43180111 CAGAACAAAAAGGTAGAGAAGGG + Intronic
1174727921 20:52883534-52883556 CACAATTAGAAAATAGAGGAGGG - Intergenic
1175004409 20:55666981-55667003 AAGAAAAAGTAGATAGAGCAAGG + Intergenic
1175376659 20:58531477-58531499 CAGAATGAGAAGACAGAATGAGG - Intergenic
1176620595 21:9055940-9055962 CAGATTTAGATGATAGAGTGAGG + Intergenic
1177357622 21:20030315-20030337 TAGAAGAAGAAGATGGAGAAAGG + Intergenic
1177722232 21:24922506-24922528 GAGAATGAGAAGACAGAGAAGGG - Intergenic
1178165306 21:29967939-29967961 AAGAATAAGAAGACTGAGAACGG - Intergenic
1178428905 21:32502098-32502120 AAGAAAAAGAAGAAAAAGTAAGG - Intronic
1178806162 21:35841383-35841405 CAGAGTGAGAAGACAGAGTGTGG + Intronic
1179649637 21:42799291-42799313 AAGTTTAAGAAAATAGAGTAAGG + Intergenic
1179969755 21:44828583-44828605 CAGAAGAAGAAGAGAGAATGAGG + Intergenic
1180231113 21:46427163-46427185 CTGAAAAAGACGATAAAGTAAGG - Intronic
1181735713 22:24879918-24879940 CAGAAAGAGCAGAAAGAGTAAGG + Intronic
1183566038 22:38616057-38616079 GAGAATATGTAGATACAGTAAGG + Intronic
1185295480 22:50051214-50051236 AAGAATGATAAGATAGAGTTTGG - Intronic
949094678 3:72119-72141 CAGAGGAAGAATATAGAGAAAGG + Intergenic
949179379 3:1109866-1109888 TATAATAAAAGGATAGAGTATGG - Intronic
949180872 3:1130096-1130118 CAAAACAAGAAGATTGATTAGGG + Intronic
949272103 3:2230068-2230090 CAAAACAAGTAAATAGAGTAGGG - Intronic
949570391 3:5286487-5286509 CAAAATAAGAAGACAGTGTCTGG - Intergenic
949783011 3:7711188-7711210 CAGTATATCAAGATAGAGTGTGG + Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
951511332 3:23506004-23506026 CATAATAATAATCTAGAGTAAGG - Intronic
951536894 3:23748442-23748464 AAGAATAAGAAAAGAAAGTATGG + Intergenic
951632663 3:24738460-24738482 CAGAATAAGAACAAAAACTATGG + Intergenic
951989081 3:28655795-28655817 CAGAGTAGGAAGACAGAGTCAGG - Intergenic
952164002 3:30725741-30725763 CAGAGTAAAAAGATAGAGCATGG - Intergenic
952344475 3:32471027-32471049 AAGAAGAAGAAGATAGAAGAAGG + Intronic
953068529 3:39497314-39497336 CAGAAGAGAAAGATAGAGAATGG - Intronic
953279994 3:41545722-41545744 CAGAAACAGAAGAGAGAGAATGG - Intronic
954634394 3:52063716-52063738 CAGAATAAGAAGGTAGTCAAAGG - Intergenic
954736264 3:52709378-52709400 CAAAATAAAAATATACAGTATGG + Exonic
955444556 3:58995733-58995755 CAGAATAAAATGGTGGAGTAAGG + Intronic
955465433 3:59231992-59232014 CAGAAAAATAAAATAGGGTAAGG + Intergenic
955523389 3:59796519-59796541 CAGAAAAACAAGACAGAGTAAGG - Intronic
956037768 3:65113811-65113833 GAGAAAAAGAAGACAGAGGAAGG + Intergenic
956304227 3:67806089-67806111 CAGAAAAAGAAGGAAGAGAAAGG - Intergenic
956321450 3:68001234-68001256 CAGAAGAAAAAGAAAGAATAAGG - Intergenic
956401541 3:68884760-68884782 CGTAAGAAGAAGATAGATTAGGG - Intronic
957421566 3:79978413-79978435 TAGAACAAAAAGAGAGAGTATGG - Intergenic
957617599 3:82551330-82551352 CAGACTTGGAAGATAGAGGAAGG - Intergenic
957979181 3:87486582-87486604 CAGAATATGAGGATAAATTATGG - Intergenic
959565854 3:107832476-107832498 CAGAATAAGCAAATAGATTTGGG + Intergenic
959935586 3:112025088-112025110 CAGAATAACAAGATAGGATTGGG - Intergenic
960157150 3:114307605-114307627 CAGTACAAGAAAATAGAGAATGG + Intronic
960398233 3:117163424-117163446 GAGAAGGAGAAGAAAGAGTAGGG - Intergenic
960684220 3:120280738-120280760 CAGAATAGCATGATAGAGTGAGG - Intronic
960931822 3:122859327-122859349 CAGTAGAAGAAGAGAGAGCAGGG + Intronic
960984629 3:123268015-123268037 CACAATAAGAGGGTAGAGGAGGG + Intronic
962445801 3:135463451-135463473 AAGAAAAAGAAGAGAGAGTGAGG + Intergenic
963075687 3:141344348-141344370 TAGAAGAAGAAGATGGAGGAAGG - Intronic
963426166 3:145127928-145127950 CAGAATAAGAAAATGCTGTATGG + Intergenic
963985227 3:151585579-151585601 AAGAATAAGAAAATACAGAAAGG - Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
965100266 3:164289146-164289168 AAGAATGAGAAGATAGAGTTTGG + Intergenic
965454380 3:168879752-168879774 AAGAAGAGGAAGAAAGAGTAGGG - Intergenic
966154539 3:176901878-176901900 AAGAATAAGAAAAGAGAGGAAGG + Intergenic
966970446 3:185040638-185040660 CAGAAACAGAATGTAGAGTAAGG - Intronic
967229746 3:187326190-187326212 TAGAATAAGAAAATACAATATGG + Intergenic
967676213 3:192301796-192301818 GAGAAGAAGAAAAGAGAGTATGG + Intronic
968289556 3:197527936-197527958 CAGGAAAAGAAGATAAAGCATGG - Intronic
969828868 4:9779918-9779940 CAGGAGAAGAAGATAGGGGAAGG + Intronic
971248759 4:24954068-24954090 CAGAAGGAGAAGAGAGAGAAAGG + Intronic
972010185 4:34169431-34169453 TAGAATTAGAAGATAGGCTAAGG + Intergenic
972228357 4:37041431-37041453 CAGAATAAAAAATTAGAGTAAGG + Intergenic
972373930 4:38452705-38452727 CAGCAGAAGAAGAAAGAATATGG + Intergenic
974144640 4:57931987-57932009 CAGAATAGGAAATAAGAGTATGG + Intergenic
974251969 4:59396255-59396277 CAGGATAGGAAGATAAAATATGG - Intergenic
974433295 4:61826504-61826526 TATAATAAGAGGAGAGAGTAGGG + Intronic
975533295 4:75422551-75422573 CAGAACAAGAAGGCAGAGAAAGG - Intergenic
975603065 4:76123813-76123835 CAGAATAAGAAGATACTGCATGG - Intronic
976527016 4:86104779-86104801 GAAAATAAGAACATACAGTAGGG - Intronic
976783956 4:88796089-88796111 CAGAATAAGAAGTTATAGAAAGG - Intronic
979786612 4:124722761-124722783 CAGAAACAGAAAATAAAGTATGG + Intergenic
979885472 4:126022656-126022678 CAGAAAAAAAAAATAGGGTAAGG + Intergenic
979939059 4:126737124-126737146 CAGGATAAGAAGATTGAGAGAGG + Intergenic
980480548 4:133381471-133381493 CAGAATAAAAAGTCAGAGAAGGG + Intergenic
981018249 4:139998092-139998114 TAGAATGAGAAGACAGAGAAAGG - Intronic
981986486 4:150863293-150863315 TAGAATAAGGATATAGAGAAAGG - Intronic
983259978 4:165444934-165444956 TAAAATAAGAAGAAAGAGAATGG - Intronic
984882731 4:184424752-184424774 CAGACTAAGACAATAGAGGATGG + Intronic
985554285 5:548779-548801 CAGAATGTGAAGATGGATTAAGG - Intergenic
986141839 5:5038359-5038381 CTGAGTAAGACGATAGAGGAAGG + Intergenic
986194826 5:5528152-5528174 CAGAATAACATGTAAGAGTAAGG + Intergenic
986669152 5:10127546-10127568 CAGAAGAAGGAGATAGACTATGG + Intergenic
986757734 5:10853803-10853825 TAGAATAAAAAGGTAGAGGAAGG + Intergenic
986785989 5:11114348-11114370 TAGAAGAAGAAGAGAAAGTAGGG + Intronic
987462987 5:18236367-18236389 TAGAGTAAGGAAATAGAGTAAGG + Intergenic
987543937 5:19288402-19288424 CAGATTAGCTAGATAGAGTATGG - Intergenic
988164942 5:27575534-27575556 CAGAATAAGAATATATACAAAGG - Intergenic
988166726 5:27600390-27600412 TAGAATAAGAATATAAAGAAAGG - Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
989311161 5:40019678-40019700 CACAAAAAGAAGATAGAAAATGG + Intergenic
990995150 5:61725744-61725766 AACAATAAGAAAATGGAGTAGGG + Intronic
992057254 5:73002827-73002849 CAGAACAAGAAGTTAGAGAGAGG + Intronic
992467595 5:77022481-77022503 GAGAAGAAGAAGAAAGAGAAGGG + Intergenic
992673879 5:79085912-79085934 CAAAGTAAGAAGAAAGAGGATGG + Intronic
992965284 5:81993175-81993197 CAGATAAAGAAAATAGAGTTTGG - Intronic
993304551 5:86259209-86259231 CTGAATAAGTAGTTAGAATAAGG + Intergenic
993414306 5:87607471-87607493 GACAATAAGAACATAGGGTATGG - Intergenic
994858138 5:105152322-105152344 CAGAAGGAGAAGAAAGAGAAAGG - Intergenic
995053067 5:107728688-107728710 CAGAGTCAGAAGAGAGAGTGAGG - Intergenic
995532695 5:113106949-113106971 TAGGATAAGAAGATAGGGAATGG - Intronic
995733521 5:115272342-115272364 CAGAAGAAGAATTAAGAGTAGGG + Intronic
996075053 5:119182912-119182934 CAGAATAAAAAGCAAAAGTATGG - Intronic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
997710145 5:135997120-135997142 CAGAAAAAGAACAGAGAGGATGG - Intergenic
999499177 5:152129686-152129708 AAGAATGAGAAATTAGAGTAAGG - Intergenic
999970764 5:156859919-156859941 CAGAATAGGAAGAAAGATTCTGG - Intergenic
1000516306 5:162239500-162239522 AAGAATAAGAAGATAAAACAAGG - Intergenic
1000759421 5:165204015-165204037 CAGAGAAAAAAGATATAGTAAGG + Intergenic
1001264210 5:170260801-170260823 GAGAAAAAGAGGATAAAGTAAGG - Intronic
1001561532 5:172672546-172672568 CTGAATAAGGAAATAGAGTGGGG - Intronic
1002572428 5:180149970-180149992 CAGAAAAAGAAGGGAGAGAAAGG - Intronic
1002715917 5:181227171-181227193 CAGATCAAGAAAAGAGAGTATGG - Intronic
1003013012 6:2444054-2444076 CATAATAAATAGAGAGAGTAGGG + Intergenic
1003672507 6:8172514-8172536 AAGAATAAGAACATACAGAAAGG - Intergenic
1003758991 6:9153488-9153510 CAGAATAAGAGAAGAGAGGAGGG + Intergenic
1003759073 6:9154377-9154399 CACAAAAATAACATAGAGTAAGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1005440117 6:25858290-25858312 AAGAATAAGAAGAAAGAGAATGG - Intronic
1005972304 6:30770934-30770956 CAGAATAAGAGGAGAGGGGAGGG - Intergenic
1006298888 6:33182849-33182871 CAAAATAAGAACATGGAGAATGG + Intronic
1007055914 6:38884694-38884716 CACAATAAGAGGTTAGAGCAAGG - Intronic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1008078352 6:47169398-47169420 TAGAACAAAAAGATGGAGTAAGG - Intergenic
1010025514 6:71211752-71211774 CAGAATAAAAAAATAGAAGAAGG + Intergenic
1010355911 6:74932921-74932943 CAGAATAAGAAAACAAAGTAGGG - Intergenic
1010696802 6:78985372-78985394 CCGAAGAAGAAGAGAGAGCATGG - Exonic
1011072542 6:83401514-83401536 CAGGAAAAGAATATAAAGTAAGG + Intronic
1011196549 6:84785838-84785860 CAGAATAGGAGGATAGAGGGTGG - Intergenic
1012471597 6:99578624-99578646 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1012507104 6:99959922-99959944 CAGAAAAAGAAGAGAAAGAAAGG + Intronic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1014695504 6:124616132-124616154 CAGAAGAAGAGGATAGAGTTTGG - Intronic
1015081449 6:129230390-129230412 GAGAATAAGAAGAAAGAATATGG + Intronic
1015230309 6:130907658-130907680 CAGAATAAAAAAAGAGAGTAGGG + Intronic
1015423065 6:133033677-133033699 AAGATTAAGAAGAGAAAGTAAGG + Intergenic
1016077773 6:139817864-139817886 GAGAACAAAAAAATAGAGTAGGG + Intergenic
1016294283 6:142557927-142557949 CAGAACAAAAAGGCAGAGTATGG + Intergenic
1016676216 6:146771576-146771598 GAGAAAAAGAAGACAGAGAATGG - Intronic
1017092271 6:150770635-150770657 AAGAAAAAGAAAATAGAGAAAGG + Intronic
1017692645 6:156982530-156982552 CAGAATAAGAAAGCAGATTAAGG - Intronic
1017789396 6:157782896-157782918 CAAAAAAAGAAGGTAGAGAAGGG + Intronic
1018220343 6:161571858-161571880 CAGAACAAGAAGGCAGAGAACGG + Intronic
1018248320 6:161843183-161843205 CAGGATAATAATATAGAGTTTGG - Intronic
1019202656 6:170331003-170331025 CAGAAAGAGAAGATAAAGGAGGG + Intronic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1020425203 7:8057717-8057739 CAGATTAAGAAGAAAAAGGAAGG - Intronic
1020622666 7:10536549-10536571 CAGAATAAAAAGAGAAAGAAGGG + Intergenic
1020728196 7:11843601-11843623 TAGAATAAGAAAATAGCATAAGG - Intergenic
1021177711 7:17469335-17469357 CAGAATAAGAGGTAAGACTAAGG - Intergenic
1021940294 7:25672444-25672466 CAGAAAAAAAAGATAAAGAAAGG - Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1024473967 7:49791359-49791381 CAGATTAAGAAGTTAGTGAAAGG - Intronic
1026627432 7:72008483-72008505 CAGAACAAGAAGCAAGAGAAGGG + Intronic
1028183748 7:87755904-87755926 CTAAATAGGAAGATAGGGTATGG + Intronic
1029019995 7:97354909-97354931 AAGAATAAGAGGAGAGAGAAAGG - Intergenic
1029909482 7:104130246-104130268 TAGAATTTGGAGATAGAGTATGG - Intronic
1030031853 7:105376964-105376986 GTGAATAGGAAGATAGAGCAGGG - Intronic
1030849376 7:114463851-114463873 CAGAGTAAGAAGAAAGAACAAGG + Intronic
1030987203 7:116255657-116255679 GAGAAAAAGAAGATAGATCATGG + Intronic
1031198687 7:118649677-118649699 AAGAATAAGAAGATGGCTTAAGG + Intergenic
1031267039 7:119594103-119594125 CAGAATAAGAAGAAGAAGTTGGG + Intergenic
1032412613 7:131708816-131708838 CAGAAAAAGAAGAGATAGAAGGG - Intergenic
1032956322 7:136975806-136975828 CCAAACAAGAAAATAGAGTAGGG + Intronic
1033144196 7:138856942-138856964 CAGAAGAAAAAGACAGAGGAAGG + Intronic
1034601638 7:152262762-152262784 CAGACTAGGAAGACAGAGTTTGG + Intronic
1037135655 8:15456467-15456489 AAGAATAAGAAAAGAGAGGAGGG + Intronic
1037143189 8:15541567-15541589 CAGACTAAGAATAAAGAGAAAGG - Intronic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1038118636 8:24586576-24586598 TAGAACAATAAGATAGAGGAAGG + Intergenic
1038306051 8:26403348-26403370 CTGAATAAGAAGAAAGTTTAGGG + Intronic
1038687840 8:29734523-29734545 CAGTATAAGAACAGAGAGAATGG - Intergenic
1038722148 8:30046758-30046780 GAGAATAAGAAGAAATAATAAGG - Intergenic
1038787127 8:30628546-30628568 CAGAGTAAGAAGATTGAGAAAGG + Intronic
1039605229 8:38875106-38875128 CATAATTAGAAGATAAACTAGGG - Intergenic
1039722271 8:40176878-40176900 CATAAGAAGAAGAGGGAGTAGGG + Intergenic
1039839543 8:41284156-41284178 AAGAATAATAAGAAAGAGTCTGG + Intronic
1042463312 8:69096547-69096569 AAGCATAAAAAGATAGAGAAAGG + Intergenic
1042788724 8:72579813-72579835 CAGAATAAGAAGATAGAGTAAGG - Intronic
1042938009 8:74079981-74080003 CAGAATAAAAGGAAAAAGTAAGG + Intergenic
1043282424 8:78484785-78484807 CAGACTAAGATGATGGTGTAGGG - Intergenic
1043430755 8:80192283-80192305 CAGAAGAAGAAAATAGATGATGG - Intronic
1043922021 8:85994216-85994238 CAGAATACAAAGAGAGAATAGGG + Intronic
1043986480 8:86698663-86698685 CAGATTTAGATGATAGAGTGAGG + Intronic
1045176580 8:99731602-99731624 CAGAATAAGAAGACCTGGTAAGG + Intronic
1045784716 8:105907503-105907525 CAACATTAGAAGAAAGAGTACGG - Intergenic
1046034928 8:108829406-108829428 CAGAATTAGACGATTAAGTATGG - Intergenic
1046595417 8:116255758-116255780 CAGAACAAAAAGATAGAGGCAGG + Intergenic
1047470533 8:125167307-125167329 CAGAATAAGCAGTTAGGGAAGGG + Intronic
1048921865 8:139238668-139238690 TAGAATAAGAAGGTGGAGAATGG + Intergenic
1049392338 8:142378680-142378702 CAGAGCCAGAAGATAGATTAGGG + Intronic
1049648724 8:143752909-143752931 CAGAAAGAGAAGAAAGAGAAAGG - Intergenic
1050042311 9:1509273-1509295 AGAAATCAGAAGATAGAGTAGGG - Intergenic
1050177297 9:2881667-2881689 AAGAATAAGATTATAAAGTAGGG + Intergenic
1050214750 9:3309954-3309976 CAGAATAAAAGGACAGAGTGGGG + Intronic
1050599653 9:7237627-7237649 CAGAGTAACAAGAGAGAGTGTGG + Intergenic
1050901553 9:10955315-10955337 CTGAATAAGTTGATACAGTAGGG + Intergenic
1052036654 9:23689208-23689230 TATAATAAGAAGAGGGAGTATGG + Intergenic
1052088524 9:24297252-24297274 CAAAATAAGAGGAAAGATTAAGG + Intergenic
1052130327 9:24838046-24838068 CAGAAATAGAATATAGAGTAAGG - Intergenic
1052168865 9:25368937-25368959 CAGTATAAGAAGATAAAAAATGG + Intergenic
1052629601 9:31020197-31020219 CAGACTGAGAAGAGAGCGTATGG + Intergenic
1053340826 9:37328002-37328024 AAGAACAGGAAGATAGGGTAGGG - Intronic
1054355474 9:64057291-64057313 CAGATTTAGATGATAGAGTGAGG + Intergenic
1056069115 9:82967576-82967598 ATGAAAAAGAAGATGGAGTAAGG - Intergenic
1056662406 9:88554127-88554149 CAGAGGGAGAAGATAGAGTGGGG + Intronic
1057946605 9:99335504-99335526 CAAAAAAAGATGAAAGAGTAAGG - Intergenic
1058306338 9:103445900-103445922 CAGACTAAAAAAATAGAGAATGG - Intergenic
1058510409 9:105711917-105711939 CAGAAAAAAAAGAGAGAGAAGGG - Intronic
1059737726 9:117118908-117118930 CAGGGTAAAAAGATAGAGTGAGG - Intronic
1059916513 9:119109090-119109112 CAGAATAAAAAGATAGTATAGGG - Intergenic
1060099828 9:120829972-120829994 CTGCATGAGAAGATAGACTAGGG + Intronic
1061977439 9:134076763-134076785 CAGAGGAAAAAGAGAGAGTAAGG + Intergenic
1203743809 Un_GL000218v1:26389-26411 CAGATTTAGATGATAGAGTGGGG + Intergenic
1203566307 Un_KI270744v1:93146-93168 CAGATTTAGATGATAGAGTGAGG - Intergenic
1186227354 X:7414144-7414166 CACATTAAGAAGATAAAGAATGG + Intergenic
1187206500 X:17186792-17186814 CAGAACAAGAAGGTACAGGAGGG - Intergenic
1187363126 X:18646079-18646101 CAGAACAACAAGGTAGAGTCTGG + Exonic
1187710948 X:22053804-22053826 CAGAACAATAAGATGAAGTAGGG + Intronic
1188162541 X:26821030-26821052 CAGAATAGGAACATAGAGACTGG - Intergenic
1188468705 X:30512443-30512465 CAGAAAGAGAAGAAAGAGTGGGG + Intergenic
1188663122 X:32785075-32785097 CAGACTAAGAATAAAAAGTAGGG + Intronic
1190052708 X:47162869-47162891 CAAAAAAAAAAAATAGAGTATGG + Intronic
1190851704 X:54250666-54250688 CAGAAAAATAAGATATAGGAAGG + Intronic
1191838991 X:65496473-65496495 CAGAAAAAGAAGAGAGAAAATGG + Intronic
1192032100 X:67524819-67524841 CAGAATAACAGGATAGAAAATGG - Intergenic
1192136013 X:68601207-68601229 CAGAAGGAGAAGAGAGAGAAAGG + Intergenic
1192743907 X:73919845-73919867 CAGAACAAGAAGGTGGAATAAGG + Intergenic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1194033039 X:88839276-88839298 CAGAAGAAGAAGAAAGAATGGGG + Intergenic
1196231182 X:113223943-113223965 AAGTAGAAGAAAATAGAGTACGG + Intergenic
1197329763 X:125139241-125139263 CAGAATATGAAGTGAGAGAATGG + Intergenic
1197622835 X:128770378-128770400 CAGAATAAAAAAATAGAGAGAGG + Intergenic
1197700016 X:129592398-129592420 CAGAATAAGAAAACAGTGAAAGG - Exonic
1197720923 X:129744148-129744170 CAGAAGATGAAGACAGAGAAAGG + Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198670500 X:139075219-139075241 CAGAATGGGAAGATAGAGTCTGG - Intronic
1199273322 X:145911733-145911755 CAGCATACGAGGTTAGAGTACGG + Intergenic
1201157131 Y:11141370-11141392 CAGATTTAGATGATAGAGTGTGG + Intergenic
1202334163 Y:23789472-23789494 CAAATTAAGGAGATAGATTAAGG + Intergenic
1202536605 Y:25880587-25880609 CAAATTAAGGAGATAGATTAAGG - Intergenic