ID: 1042796182

View in Genome Browser
Species Human (GRCh38)
Location 8:72665596-72665618
Sequence CAGGCCCACCTTAGGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042796182_1042796188 24 Left 1042796182 8:72665596-72665618 CCTCAGAACCTAAGGTGGGCCTG 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1042796188 8:72665643-72665665 ATGCAGTTACTGAGTTCAATCGG No data
1042796182_1042796186 -1 Left 1042796182 8:72665596-72665618 CCTCAGAACCTAAGGTGGGCCTG 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1042796186 8:72665618-72665640 GGCACAGAGCAAGTACTTCATGG No data
1042796182_1042796187 0 Left 1042796182 8:72665596-72665618 CCTCAGAACCTAAGGTGGGCCTG 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1042796187 8:72665619-72665641 GCACAGAGCAAGTACTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042796182 Original CRISPR CAGGCCCACCTTAGGTTCTG AGG (reversed) Intronic
900185131 1:1329342-1329364 CACCCCCACCTCAGGGTCTGTGG + Intergenic
901231227 1:7642600-7642622 CTGGCCCAGCTGAGGCTCTGCGG - Intronic
903184487 1:21621709-21621731 CATGCCCAGCTGAGGTTGTGTGG - Intronic
903184882 1:21623165-21623187 CAGCCCCTCCCTAGGTGCTGTGG - Intronic
903624174 1:24719422-24719444 CAGGCCCAGGTCAGGTGCTGGGG - Intergenic
903992582 1:27284145-27284167 CAGGCCCACATTTAATTCTGTGG - Intronic
905885608 1:41490252-41490274 CAGGCCCATGCTAGGCTCTGAGG - Intergenic
907241037 1:53081236-53081258 CAGGCCCTCCCTGGCTTCTGGGG + Intronic
916834124 1:168524671-168524693 CAGGCCCACCTTTGGCATTGGGG + Intergenic
917712720 1:177703352-177703374 CAGGCCTCCCTTGGCTTCTGTGG - Intergenic
917959124 1:180128543-180128565 CAGACCCACCCCAGGATCTGTGG + Intergenic
918123556 1:181560904-181560926 CAGGCCTACCTTCGTTTCTAAGG - Intronic
919657993 1:200215817-200215839 AAGGCCCACCTTTGGAACTGGGG - Intergenic
919887302 1:201944205-201944227 CAGGTCCACACTTGGTTCTGCGG - Intronic
922175277 1:223192689-223192711 CAGGGCCACCTAAGGTTTTAGGG + Intergenic
1062932096 10:1360249-1360271 CAGGCCCACCTCTGGGGCTGGGG - Intronic
1063356720 10:5407451-5407473 GTGGCCACCCTTAGGTTCTGAGG + Intergenic
1067588948 10:47493698-47493720 CAGGCCCACCATGGCCTCTGGGG + Intergenic
1067877415 10:50018536-50018558 CAGGCCCACCACAGCCTCTGGGG - Intergenic
1070132633 10:73665796-73665818 CAGGCCCACCACAGCCTCTGGGG + Intergenic
1070972387 10:80578336-80578358 CAGCCTCCCCTTAGGTTCTCAGG - Intronic
1074120782 10:110493243-110493265 CTGGCCCACCTTATGGGCTGAGG + Intergenic
1075022002 10:118959027-118959049 CAGGGCCACTTTAGGTTCATGGG + Intergenic
1075565379 10:123499785-123499807 CAGGCCCACCTTCTATTCTGTGG - Intergenic
1075654126 10:124150309-124150331 CAGTCCCACAGTAGGTACTGAGG + Intergenic
1076108814 10:127845755-127845777 AAGCCCCACTTCAGGTTCTGGGG - Intergenic
1076705320 10:132298220-132298242 CAGGCCCAGCTCAGATTCAGGGG - Intronic
1077147717 11:1053420-1053442 CCGGCCCAGATAAGGTTCTGGGG - Intergenic
1080992603 11:37557429-37557451 CTGGCCCACAGTAGGTGCTGTGG - Intergenic
1082982266 11:59134603-59134625 GAGGCCCATCTTTGGTTCAGAGG - Intergenic
1084171470 11:67403115-67403137 CAGGCCCACTTCCAGTTCTGAGG - Intronic
1084174659 11:67417047-67417069 CAGGCACGCTTTAGGTGCTGGGG + Intronic
1084445551 11:69201658-69201680 CAGACCCACCTTGGGGTCTGAGG - Intergenic
1084456269 11:69269860-69269882 CAGGCCCACCAGAGGTTGGGAGG - Intergenic
1084706942 11:70821069-70821091 GAGGCTCAACTTAGGTTGTGGGG - Intronic
1089565135 11:119367239-119367261 CAGGCCAAGCCCAGGTTCTGAGG - Intronic
1089764607 11:120753653-120753675 CAGCCCAATCTTAGGTGCTGTGG + Intronic
1092080855 12:5714933-5714955 AAGGCATACCCTAGGTTCTGTGG + Intronic
1093764069 12:22942565-22942587 CAGGTCCACAGTAGGGTCTGTGG + Intergenic
1100176153 12:92033173-92033195 CAGGCCCCCCTTATCTTCTTCGG - Intronic
1100959062 12:99942958-99942980 TAGGACCAACTTAGGTTGTGTGG - Intronic
1101541595 12:105670504-105670526 AAAGCCCACCTTAGCTTCTAGGG - Intergenic
1104017167 12:124968998-124969020 CAGACCCACCTGCGGTCCTGGGG - Intronic
1104039728 12:125121974-125121996 GAGGCCAACCTCAGGCTCTGAGG + Intronic
1107694467 13:42986779-42986801 CAGCCCCATCTCAGTTTCTGGGG + Intronic
1113353502 13:109553613-109553635 CAGGCACACCTTCCTTTCTGGGG - Intergenic
1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG + Intergenic
1117679969 14:58193883-58193905 CAAGCCCAGCTTAGGTTCTAGGG - Intronic
1119263695 14:73252400-73252422 CAGGCCCAGCTCCGGTCCTGAGG - Intronic
1119649138 14:76371440-76371462 CAGGCCCACCTTAGTCACTGTGG + Intronic
1120862882 14:89270594-89270616 CTGGCCAACCTTAGGTTCAAAGG - Intronic
1121688322 14:95856265-95856287 CAGGCTCACCTCTGGTTCTAGGG - Intergenic
1122395451 14:101425547-101425569 GAGGCTAACCTCAGGTTCTGGGG + Intergenic
1130397078 15:83512066-83512088 AAGGCCCCCCTTACCTTCTGAGG - Intronic
1131258665 15:90877327-90877349 CTGGCCCACCTGGGGCTCTGAGG + Intronic
1131735223 15:95324985-95325007 CAGGCCCACCTGAGCCACTGAGG - Intergenic
1132426860 15:101724676-101724698 CAGGCCCACCTTAGGGTCACGGG + Intergenic
1132859607 16:2063556-2063578 GAGGCGCAGCTTAGGCTCTGAGG + Intronic
1134686397 16:16161740-16161762 TAAGCCCACTTTAGGGTCTGGGG + Intronic
1140061432 16:71573530-71573552 AAGGCTCACCTTAGCTTCTAGGG + Exonic
1141367272 16:83455378-83455400 CTGGCCCACCTGAGGCTCTGGGG + Intronic
1141884616 16:86882964-86882986 CAGGTCCCACTTAGGTGCTGGGG - Intergenic
1142530518 17:576608-576630 TGGGACCACATTAGGTTCTGTGG - Intronic
1142531684 17:583631-583653 CGGGAACACATTAGGTTCTGAGG - Intronic
1144623768 17:16834033-16834055 CAGGCCCAGCGTGGGATCTGTGG - Intergenic
1144882662 17:18438683-18438705 CAGGCCCAGCGTGGGATCTGTGG + Intergenic
1145149572 17:20505703-20505725 CAGGCCCAGCGTGGGATCTGTGG - Intergenic
1147346886 17:39804110-39804132 GAGGCCCTTGTTAGGTTCTGGGG - Intronic
1147386726 17:40086924-40086946 CAGGCTCATCTGAGGTTCTCTGG + Intronic
1147661513 17:42119478-42119500 CAGGCCCAGCCTGGGTTCAGTGG - Intronic
1149998501 17:61417290-61417312 CAGCTGCACCTTTGGTTCTGGGG + Intergenic
1151785989 17:76275365-76275387 CAGGCCCAACTTAGCTCCTGCGG + Intronic
1152133889 17:78492828-78492850 CAGGCCCACCCATGGTCCTGAGG - Intronic
1152632871 17:81418373-81418395 AAGGGCCACTTTAGGGTCTGGGG + Intronic
1152925934 17:83087772-83087794 CAGGCTCACCTCAGGCTCGGCGG - Intronic
1152994245 18:391445-391467 CAGGTCCACCTATGGTACTGAGG + Intronic
1153437545 18:5083880-5083902 GAGGCCCAGCTTAAGTTTTGTGG - Intergenic
1155097407 18:22571112-22571134 CAGACCTTCCCTAGGTTCTGTGG + Intergenic
1155402902 18:25458310-25458332 CAGGGTCTCCTTGGGTTCTGAGG - Intergenic
1157971076 18:52269838-52269860 CAGGCCCACACAAGGATCTGTGG + Intergenic
1162567862 19:11454097-11454119 CAGGCCCCACCTAGGTGCTGGGG + Exonic
1166321550 19:42022144-42022166 CCGGCCCATCTGAGGTCCTGGGG + Intronic
925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG + Intergenic
925414850 2:3662230-3662252 CAGGCCCGTCTTAGGGTCTGTGG + Intronic
926235984 2:11044355-11044377 CAGGCCCACCTCAGACACTGGGG - Intergenic
928318200 2:30262382-30262404 CAGCCCCTCCATAGGTGCTGTGG + Intronic
930349490 2:50232259-50232281 CAGGCCTATGTTAGGCTCTGTGG - Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
936379586 2:111972585-111972607 CTTGCCCACCTTGGATTCTGTGG + Intronic
937024126 2:118683265-118683287 CAGGCCCCCCTTAGAACCTGGGG - Intergenic
937138812 2:119580015-119580037 CAAGGCCTGCTTAGGTTCTGAGG + Intronic
937628403 2:124069388-124069410 CTGGCCCTGCTTAGGGTCTGGGG + Intronic
939122955 2:138140390-138140412 CAGGCACACCTAAAGTGCTGAGG + Intergenic
941989171 2:171538323-171538345 CAGGGCTGCCTTAGGCTCTGGGG + Intronic
946434948 2:219645119-219645141 CAGGCCCACTTCAGGCCCTGAGG + Intergenic
1168763906 20:368888-368910 CAGGTTCAGCTTTGGTTCTGTGG - Intronic
1169010688 20:2247596-2247618 CAGGACCACCTCAGGTTCAGTGG + Intergenic
1169241437 20:3984448-3984470 GAGGGCCAGCTTAGGTGCTGAGG - Intronic
1171458159 20:25283356-25283378 CAGGCCCAGCACAGGTCCTGGGG + Intronic
1173581298 20:44148672-44148694 GATGCCCACCTTAGATTGTGGGG - Intronic
1177479292 21:21665733-21665755 CAGGCCCAACTTAGAGTCCGAGG - Intergenic
1178492537 21:33062022-33062044 CAGGCCCTCCTCAGCGTCTGGGG + Intergenic
1178754046 21:35330956-35330978 TAGGCCCTCCTGAGGTCCTGAGG + Intronic
1179984221 21:44912190-44912212 CAGGGCCACCCAAGGTTCAGTGG + Intronic
1181403902 22:22668394-22668416 CAGGCTCAACTTGGGGTCTGTGG - Intergenic
1181406239 22:22686861-22686883 CAGGCTCAACTTGGGATCTGTGG - Intergenic
1181539888 22:23567411-23567433 GAGGCCCACCGTGGGTCCTGGGG - Intergenic
1181627992 22:24134296-24134318 CGGGCCCACTGGAGGTTCTGGGG - Exonic
1182644714 22:31798886-31798908 CACGTCCACCTTAGGTACAGTGG + Intronic
1184405920 22:44300788-44300810 CTGGCCCATCTGGGGTTCTGGGG - Intronic
1185190624 22:49433731-49433753 CAGGCCTTCCTCAGTTTCTGTGG + Intronic
949525502 3:4899405-4899427 CAGGACCACCTTAGGGTATGTGG - Intergenic
951275770 3:20684045-20684067 CAGGCCAACCACAGGTCCTGAGG - Intergenic
951794762 3:26525960-26525982 CAGCCCCAGCTTAGGTTGTTGGG + Intergenic
952543656 3:34395711-34395733 CAGGCAGTTCTTAGGTTCTGGGG + Intergenic
953039718 3:39244996-39245018 CAGGACCACCTTAAGTTATTAGG + Intergenic
953207836 3:40847834-40847856 CAGGCCCACAGCAGGTGCTGAGG + Intergenic
954431148 3:50471466-50471488 CCAGCCCCTCTTAGGTTCTGAGG + Intronic
956777209 3:72575253-72575275 CAGGCCCTCGCTAGGTGCTGGGG + Intergenic
961302983 3:125934006-125934028 GGGGCCCACCTTAGGGTGTGTGG + Intronic
961623015 3:128239539-128239561 GAAGCCCACCTCAAGTTCTGAGG - Intronic
961915400 3:130368953-130368975 CACTCCCACCTGAGGATCTGAGG - Intronic
966313406 3:178619107-178619129 CAGACACAGTTTAGGTTCTGAGG + Intronic
966574775 3:181488040-181488062 TCTGCCCACCTCAGGTTCTGTGG + Intergenic
966952461 3:184834233-184834255 CATGCCCACCTTAGGGAATGCGG - Intronic
968596565 4:1489086-1489108 CAGCCCCACCCCAGGTGCTGAGG - Intergenic
970408333 4:15784733-15784755 CAGTCCTACCTTTTGTTCTGGGG + Intronic
973221305 4:47730537-47730559 CAGCCCCACCGCAGGGTCTGGGG - Intronic
975699001 4:77043677-77043699 CAGGCCTACATTAGGTACTGGGG + Intergenic
977053754 4:92163222-92163244 CAGTCTCTCCTTAGTTTCTGGGG - Intergenic
991565810 5:68003171-68003193 CAGGCCCACCTAGGGTTTGGTGG + Intergenic
997177880 5:131797418-131797440 CAGCCCCTCCCTAGCTTCTGCGG + Intergenic
998892406 5:146760630-146760652 CAGGTGCACCTTAACTTCTGAGG - Intronic
1001590415 5:172860873-172860895 CAGTCCCAGCCTAGGTTCTCAGG - Intronic
1003389689 6:5702967-5702989 CAGGCCCTGCTTTGGTTTTGTGG + Intronic
1005437357 6:25829105-25829127 AAGGCCCAACTTATGTTTTGAGG - Intronic
1005801208 6:29427130-29427152 GTGGCCCAGCTGAGGTTCTGTGG - Exonic
1013753330 6:113432598-113432620 CAGGACCAGCATAAGTTCTGGGG + Intergenic
1014252538 6:119129258-119129280 CAGGACCTCCTGAGGATCTGTGG + Intronic
1018884409 6:167921052-167921074 CAGGCCCATGTGAGGTGCTGAGG - Intronic
1019347476 7:538074-538096 CAGGCCCTGCTTAGGTTCTGGGG + Intergenic
1019386283 7:757947-757969 CAGCCCCACCTCTCGTTCTGAGG - Intronic
1019392329 7:795263-795285 CAGGTCCAGGTTAGATTCTGCGG - Intergenic
1022105620 7:27194599-27194621 CATGCCCACTTTAGGTTATCTGG + Intronic
1022887685 7:34663250-34663272 CAGGCCCACATTGCTTTCTGGGG + Intronic
1023458707 7:40369745-40369767 CAGGCCCACTTTATTCTCTGTGG - Intronic
1023770353 7:43551217-43551239 CAGGCACAACTGAGGTCCTGTGG - Intronic
1036751327 8:11445271-11445293 CAGACCCACCTTAGCCTGTGTGG - Intronic
1037929018 8:22866250-22866272 CAGGCCAATCTTGGGTCCTGTGG + Intronic
1039798160 8:40932909-40932931 CAGGCCCACAGGAGGTGCTGCGG - Intergenic
1039916129 8:41861675-41861697 CAGGCCCACGCTAGGCACTGCGG + Intronic
1042796182 8:72665596-72665618 CAGGCCCACCTTAGGTTCTGAGG - Intronic
1047688571 8:127327082-127327104 CAGGCCCACTGTAGAGTCTGAGG - Intergenic
1048968821 8:139632702-139632724 CCATCCCACCTTAGGTTCTGAGG - Intronic
1049635121 8:143684138-143684160 TAGGCCGACTTTAGGTTATGAGG + Intergenic
1050242244 9:3649200-3649222 CAGCCCCTCCTTTGTTTCTGTGG + Intergenic
1052821026 9:33137986-33138008 CCACCCCACCTTTGGTTCTGAGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054791457 9:69260352-69260374 GGGGCCCACCATAGGGTCTGTGG + Intergenic
1055515901 9:77032600-77032622 CAGGTGCCCCTGAGGTTCTGAGG + Intergenic
1058011222 9:99979656-99979678 AAGGCCCCCTTTTGGTTCTGGGG + Exonic
1060803797 9:126562465-126562487 CACGCCCACCAGGGGTTCTGGGG - Intergenic
1061048615 9:128180916-128180938 CAGGCCCACCAGAGGTCCTCAGG - Intronic
1061276074 9:129569959-129569981 GAGGCCCACCATGGGTCCTGGGG - Intergenic
1188261857 X:28032809-28032831 TTGGCCCATCTTAGCTTCTGTGG - Intergenic
1188818079 X:34739721-34739743 CAGGCCTAAGTGAGGTTCTGGGG - Intergenic
1188999906 X:36933028-36933050 CGGGCCCAAGTGAGGTTCTGGGG + Intergenic
1189415499 X:40809272-40809294 CAGTCCCATCTTGGGGTCTGAGG + Intergenic
1192561037 X:72128260-72128282 CAGGCGGACCTTAGGATCTTGGG - Exonic
1200059866 X:153479436-153479458 CAGGCCCACTTTGGGTACTCAGG + Intronic
1201916053 Y:19182282-19182304 CAGGATCACCTTAGATTATGTGG + Intergenic