ID: 1042801727

View in Genome Browser
Species Human (GRCh38)
Location 8:72725712-72725734
Sequence CAGTCTGGGCAGAAGGACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042801727_1042801731 -10 Left 1042801727 8:72725712-72725734 CCCCGGTCCTTCTGCCCAGACTG 0: 1
1: 0
2: 1
3: 12
4: 201
Right 1042801731 8:72725725-72725747 GCCCAGACTGTGAACTCCATAGG No data
1042801727_1042801734 -3 Left 1042801727 8:72725712-72725734 CCCCGGTCCTTCTGCCCAGACTG 0: 1
1: 0
2: 1
3: 12
4: 201
Right 1042801734 8:72725732-72725754 CTGTGAACTCCATAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042801727 Original CRISPR CAGTCTGGGCAGAAGGACCG GGG (reversed) Intronic
900088652 1:909926-909948 CAGGCCGGGAGGAAGGACCGAGG + Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
903275637 1:22219573-22219595 CGGCCAGGGCAGAAGGACCTTGG - Intergenic
903968847 1:27106217-27106239 CACTCTGGGCTGAGGGACCCAGG - Intronic
904811921 1:33168974-33168996 CAGTCAGGGAATAAGGACAGCGG + Intronic
905457839 1:38100679-38100701 CAGTCTGGGAAGAGGGGCCTTGG + Intergenic
906130475 1:43452569-43452591 CAGGTTGCGGAGAAGGACCGAGG - Exonic
906693875 1:47811143-47811165 GAGTCTGGGCAGAAGAACGTGGG + Intronic
912386144 1:109272205-109272227 CAGGCTGGGAAGAAGGAGGGTGG - Intronic
913563431 1:120046670-120046692 CAGTCTGTCCAGAAGTACTGGGG - Intronic
913634692 1:120746907-120746929 CAGTCTGTCCAGAAGTACTGGGG + Intergenic
914284025 1:146206034-146206056 CAGTCTGTCCAGAAGTACTGGGG - Intronic
914545056 1:148656773-148656795 CAGTCTGTCCAGAAGTACTGGGG - Intronic
914621511 1:149413915-149413937 CAGTCTGTCCAGAAGTACTGGGG + Intergenic
914783149 1:150804058-150804080 CAATATGTGCAGAAGAACCGGGG - Exonic
916023582 1:160815020-160815042 CACTCAGTGCAGAAGGACCGGGG - Intronic
920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG + Intergenic
921023645 1:211259034-211259056 CTCTCTGGGCGGAAGGAACGCGG - Intronic
923511421 1:234656986-234657008 CCGTATGGGCGGAAGGACCCGGG - Intergenic
924209297 1:241748281-241748303 CACTCAGGGCAGGAGGACTGGGG + Intronic
1062971630 10:1653262-1653284 CAGTCATGGCAGAAGGACTTGGG + Intronic
1064167551 10:13000141-13000163 CAGTCTGGGAAGTAGCACTGAGG - Intronic
1064717065 10:18187193-18187215 GAGTCTGGGCAGCAGGAGTGGGG + Intronic
1065055268 10:21837394-21837416 CAGACTGGGCAGCCGGACAGAGG - Intronic
1069725358 10:70574119-70574141 CAGTCTAGGGTGAAGGATCGGGG - Intergenic
1071257607 10:83886264-83886286 CAGTGAAGGTAGAAGGACCGCGG - Intergenic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1073609371 10:104928175-104928197 GACTCAGGGCAGAAGGACCTGGG + Intronic
1074027341 10:109650220-109650242 TAGTCTGGGGAGAAGGACACAGG - Intergenic
1074757218 10:116632974-116632996 CAGTGTGGGCACAGGGAACGTGG + Intronic
1074857459 10:117483850-117483872 CAGTCAGGGCAGCAGGAGCGTGG - Intergenic
1076203033 10:128573120-128573142 CAGGCAGGGCAGCAGCACCGGGG + Intergenic
1077037994 11:504464-504486 CCGCCTGGGCGGAAGGAACGCGG - Intronic
1078196163 11:9138645-9138667 CACTGCGGGCAGAAGGACCCAGG + Intergenic
1079230424 11:18644661-18644683 CAGCCTGGGGAGAAGGAGAGAGG - Intergenic
1080624507 11:34016330-34016352 GATTCTGGGCAGAAGAACTGGGG + Intergenic
1082780905 11:57286880-57286902 AAGTCTGGGCAGAAGGGCAGAGG - Intergenic
1083413111 11:62507056-62507078 AATTCCAGGCAGAAGGACCGGGG - Intronic
1083491873 11:63019651-63019673 CAGTCTGGGGAGCAGGACAGGGG - Intergenic
1083962107 11:66020386-66020408 CAGGCTGGGGAGAGGGACAGGGG + Exonic
1085267607 11:75246531-75246553 CAGCCTGGACAGAAGGAACCCGG - Intergenic
1085892864 11:80601838-80601860 CTGTCTGTGCAGAAGTACTGTGG - Intergenic
1086871010 11:92036573-92036595 CACTCTGGGCTGAAGGACAATGG - Intergenic
1096690148 12:53315518-53315540 CTTACTGGGCAGAAGGACCTGGG - Intronic
1097633120 12:62088439-62088461 CTGTCTGAGCAGAAGGACCGGGG - Intronic
1098018358 12:66130258-66130280 CAGTCTGGGGAGAGGGTCGGGGG - Intronic
1101440515 12:104701227-104701249 CATTCTGGGCAGAAAGACATGGG - Intronic
1101758178 12:107637905-107637927 CAGTCTGGGAAGCAGGAATGGGG + Intronic
1101838760 12:108312974-108312996 CAGCCTAGGCAGGAGGACCCTGG - Intronic
1102576904 12:113861357-113861379 CAGTGTGGGCAGAAGGAACTGGG - Intronic
1103800196 12:123533129-123533151 CCGTCCGGGCAGTGGGACCGCGG - Intronic
1105653178 13:22402963-22402985 GACACTGCGCAGAAGGACCGAGG + Intergenic
1106173776 13:27310730-27310752 CAGTCTGGCCAGAAGCTCAGAGG - Intergenic
1107613347 13:42139302-42139324 CAGAGTTGGCAGAAGAACCGAGG - Intronic
1112005023 13:95246313-95246335 CCCTCTGGGAAGAAGGTCCGAGG - Intronic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1117283115 14:54259853-54259875 GAGTCTGGGGAGAAGGATGGTGG - Intergenic
1118170889 14:63387420-63387442 CTGTGTGTGCAGAAGGACAGTGG - Intronic
1119191300 14:72683919-72683941 CAGTGTGGTCAGAAGCACCTGGG - Intronic
1119365213 14:74085233-74085255 CATTCTGGGTAAAAGGACAGGGG + Intronic
1119588260 14:75859078-75859100 GAGGCTGGGAAGATGGACCGTGG + Intronic
1122092776 14:99350969-99350991 CTGTCTGGACAGAGGGCCCGTGG + Intergenic
1122126084 14:99579494-99579516 GGATCTGGGCAGAAGGACCAGGG - Intronic
1125517807 15:40332515-40332537 AAGGCTGGGCAGAAGGGCTGTGG - Intronic
1125727813 15:41877018-41877040 CAGGCTGGGCAGGAGGCCCCTGG - Intronic
1128333945 15:66774145-66774167 CAGTCTGGCCAAAAGGAAAGCGG + Intronic
1129413448 15:75362084-75362106 CAGTCAGGCCTGAAGGACAGGGG - Intronic
1130971762 15:88739354-88739376 CTGTCTGCCCAGATGGACCGAGG - Intergenic
1132156134 15:99496368-99496390 CAGGGAGGGCAGAAGGACAGAGG + Intergenic
1132293001 15:100716123-100716145 CAGCCTGAGCAGAAGGCCAGCGG - Intergenic
1132675278 16:1118813-1118835 CAGGCTGGGCAGAGGGGCCTGGG - Intergenic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1135694597 16:24575275-24575297 CAGACTGGGCAGCTGGACAGAGG + Intergenic
1139572847 16:67824157-67824179 CAGTCTGTGCAGAATGGCTGAGG - Intronic
1139964656 16:70738662-70738684 CATTCTGGGCAGCAGTGCCGGGG + Intronic
1140658181 16:77162066-77162088 AACTCTGGGCAGCAGGACCTGGG - Intergenic
1140805308 16:78527132-78527154 CAGCCTGGGCAAAAAGAGCGGGG + Intronic
1141461346 16:84180252-84180274 CAGTCGGGCCAGCAGGAGCGGGG + Exonic
1141618761 16:85225356-85225378 CAGTCAGTGCAGAGGGCCCGAGG + Intergenic
1142263147 16:89051787-89051809 CAGGCTGGGCAGAAAGAGCTGGG - Intergenic
1143670533 17:8393033-8393055 CAGGCTGGGCAGCAGGTCCAGGG + Exonic
1144726807 17:17506353-17506375 CAGCCTGGGCAGGTGGGCCGTGG - Intronic
1146163834 17:30573412-30573434 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1146307297 17:31740262-31740284 CAGCCTGGGCAAAAAGAGCGGGG + Intergenic
1147580844 17:41626266-41626288 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1147845737 17:43402790-43402812 CAGTCAGGCCAGAGGGACTGGGG - Intergenic
1148553463 17:48564290-48564312 CAGCCTGGGCCGAGGGTCCGGGG - Intronic
1150621812 17:66813340-66813362 GATTCTGGGCTGAAGGACAGAGG - Intergenic
1151651783 17:75474846-75474868 CACTGTGGGCTGGAGGACCGGGG - Intronic
1151696728 17:75721709-75721731 CAGCGTGGACAGAGGGACCGGGG - Intronic
1151820234 17:76493082-76493104 CAGTCAGGACAGAAGGAGGGCGG + Intronic
1152072513 17:78140942-78140964 CATCCGGGGCAGAAGGACTGCGG - Exonic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152970663 18:158465-158487 GAGACTGGGCGGCAGGACCGGGG - Intronic
1154270163 18:12911846-12911868 CCGTCTGAGCTGGAGGACCGCGG + Intronic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1157220919 18:45828114-45828136 CGGCCTGGGCAGGAGGCCCGAGG + Intronic
1157280763 18:46345044-46345066 CAGCTTGGCCAGAAGGAGCGAGG - Intronic
1157684452 18:49631182-49631204 CAGTCTGAGCAGAAGATCCAAGG - Intergenic
1157693428 18:49701766-49701788 CAGTCTAGGCAGAAAGCCCAGGG + Intergenic
1158718720 18:59904406-59904428 CAGTGTGGTCAGAAGGTCAGAGG - Intergenic
1160534459 18:79584787-79584809 CAGCCTGGGCAGAAGGGGCCGGG + Intergenic
1160741311 19:687325-687347 CTGTGTTGGCAGAAGGAACGGGG - Intronic
1161314570 19:3611819-3611841 CTGTCTGGGCTGCAGGGCCGCGG - Exonic
1161818723 19:6516276-6516298 GAGTCTAGGGAGAATGACCGTGG + Intergenic
1163425353 19:17237748-17237770 CAGTCTGGGCTGAAGAGCTGGGG - Intronic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1166333235 19:42090694-42090716 CAGCCTGGGCAGATGGGCTGGGG - Exonic
1166546859 19:43639412-43639434 GAGACTGGACAGAAGGACAGCGG + Intronic
1167638603 19:50668425-50668447 CAGCCAGGGCAGCAGCACCGAGG - Exonic
1167752213 19:51387953-51387975 CAGTCTGCACAGAGGGGCCGTGG - Exonic
927114599 2:19888123-19888145 GAGTCTGGGGAGAAGGACAGTGG - Intergenic
928199873 2:29241010-29241032 CAGCCTCTGCAGAAGGGCCGTGG - Intronic
932872746 2:75419731-75419753 CAGTCTTGGCAGAGGGTCAGTGG + Intergenic
932886587 2:75554429-75554451 CAGGCTGGGGAGAAGGAAAGGGG + Intronic
934522184 2:95026461-95026483 CACACGGGGCAGAAGGACTGCGG - Intronic
937337293 2:121069824-121069846 CAGACAGGGCACAAGGACAGGGG - Intergenic
937991231 2:127663635-127663657 AAGGCTGGGCAGAAGGGCTGGGG - Intronic
940726076 2:157338022-157338044 AAGTCTGTGCAGAAGGAGCATGG - Intergenic
946022440 2:216650376-216650398 CAGTGTGGGAGGAAGGACTGAGG - Intronic
948370577 2:237487048-237487070 CAGTTTGGGGAGAAAGACGGCGG - Intronic
948903481 2:240967326-240967348 CATCCTGGGCAGAAGGACTGAGG - Intronic
1170370926 20:15647310-15647332 CAGCCTGGGCAAAAGCACAGGGG + Intronic
1170592139 20:17779059-17779081 CAGACTGGGCAGCAGGGCAGAGG - Intergenic
1173738052 20:45375572-45375594 CAGTCAGCACAGCAGGACCGAGG + Intronic
1174311472 20:49658727-49658749 CAGTCTGGGTAGTGGGACCTAGG - Intronic
1179880270 21:44290699-44290721 CAGGCAGGGCACAAGGACGGTGG + Intronic
1180180497 21:46116715-46116737 TGCTCAGGGCAGAAGGACCGGGG + Intronic
1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG + Intronic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183679468 22:39319239-39319261 TTGTCTGGGTAGAAGGACCTTGG - Intronic
1184301447 22:43563129-43563151 CTGCCAGGGCAGAAGGAACGCGG + Intronic
954224598 3:49173810-49173832 CAGTCTGGGGAGGAGGACTGGGG - Intronic
954443421 3:50534096-50534118 CAGGCTGGGGAGAGAGACCGGGG - Intergenic
954681253 3:52347250-52347272 CAGCATGGGCAGAGGCACCGAGG + Intronic
956274111 3:67479507-67479529 CTGTCTGGGGAAAAGGACAGTGG - Intronic
956937246 3:74117085-74117107 CATTCTAGGCAGAAGGAGCAGGG - Intergenic
957789219 3:84918596-84918618 CAGACTGGGCAGACGGGCAGAGG - Intergenic
960640175 3:119816065-119816087 CAGTCTGGGCAGTAGGTCACAGG - Intronic
960944530 3:122957067-122957089 GAGTCTGGAAAGCAGGACCGAGG + Intronic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
969466167 4:7357805-7357827 CAGGATGGGGAGAAGGCCCGAGG - Intronic
969510013 4:7612404-7612426 CATCGTGGCCAGAAGGACCGAGG - Intronic
969689781 4:8698131-8698153 CAGTGTGGACAGATGGACCCGGG - Intergenic
972292553 4:37703421-37703443 CATTCTGGGCAGGAGGGGCGGGG + Intergenic
984843727 4:184092415-184092437 CACTCTGGGCAGAGGCACAGTGG - Intronic
991673937 5:69074510-69074532 CTGGCTGGGCAGAAGGATCCCGG - Intergenic
996178484 5:120389300-120389322 CAGCCTGGGCAACAGGAGCGAGG + Intergenic
997282772 5:132659127-132659149 TAGTCAGGGCAGGAGGACAGGGG - Intronic
997512056 5:134460760-134460782 CACTCTGGGCAGAAGGGGCCTGG - Intergenic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1002565984 5:180113192-180113214 CAGGATGGACAGAGGGACCGGGG + Intronic
1002710959 5:181194860-181194882 CAGTCAGGGCAGAAGCCCCCTGG + Exonic
1004318075 6:14609187-14609209 CAGCCTGGGCAAAAAGACCTGGG + Intergenic
1005984659 6:30863693-30863715 CAATCTGGGCAGAAGGGCAAGGG - Intergenic
1008651976 6:53573321-53573343 CAGCCTGGGGAGAAGAACCATGG - Intronic
1013154535 6:107480928-107480950 GAGCCTGGGCAGAAGGTCCTGGG - Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1014632366 6:123803325-123803347 GAGTCTGGGCGGCATGACCGCGG - Intergenic
1017467621 6:154708987-154709009 CAGTCTGGGTAGAAGCAAAGAGG + Intergenic
1018025875 6:159805245-159805267 CATTGTGGGTAGACGGACCGGGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018798257 6:167203625-167203647 CAGTCTCGGGGGAAGGAGCGTGG + Intergenic
1019131879 6:169882955-169882977 CATTCTGGGCAGAAGCAGTGAGG + Intergenic
1019279626 7:193276-193298 CAGCCTGGGCAGCAGGTCCAGGG - Exonic
1019650455 7:2154907-2154929 CAGCCTGTGGAGAAGGACGGAGG + Intronic
1020994941 7:15251644-15251666 CAGTCTACGCAGAAGGATCTAGG + Intronic
1023216502 7:37868646-37868668 CAGTCTGGCCACAAGGGCTGGGG + Intronic
1024540643 7:50472883-50472905 CAGTCTGGGGAGAAGATCCCTGG - Intronic
1025094001 7:56083844-56083866 CAGTCTGGGGAGAGGAGCCGGGG + Intronic
1026791499 7:73335429-73335451 CAAGCTGGGCAGCAGGACAGAGG + Intronic
1026877389 7:73887369-73887391 CAGGCAGGGCAGCAGGACTGGGG - Intergenic
1027266116 7:76496157-76496179 CAGCCTGGGCAGCAGAGCCGAGG - Intronic
1027317493 7:76994275-76994297 CAGCCTGGGCAGCAGAGCCGAGG - Intergenic
1028762564 7:94510723-94510745 CAGTCTGGGCTGTTGGACAGCGG + Intronic
1029438203 7:100574080-100574102 GGGTCTGGGTGGAAGGACCGCGG - Intronic
1030772219 7:113488331-113488353 CAGTCTGGCCAGCAGTACTGGGG + Intergenic
1031645811 7:124223456-124223478 CATTCAGGGCTGAAGAACCGAGG + Intergenic
1032087153 7:128890510-128890532 CAGCCTGGGGAGAAGGGCAGGGG + Exonic
1032504631 7:132425909-132425931 GAGCCTGGGCAGGAGGCCCGAGG - Intronic
1037218434 8:16486339-16486361 CAGTCTTGACAGAAGTACTGTGG - Intronic
1037739254 8:21592290-21592312 CAGCATGAGCAGAAGGACAGAGG + Intergenic
1039028851 8:33287672-33287694 GAGTCTGAGCAGGAGGACCTGGG - Intergenic
1039651011 8:39339644-39339666 CAGACTGGGCAGCAGGGCAGAGG + Intergenic
1039965653 8:42281682-42281704 GAGACTGGGCAGGAGGACCCAGG - Intronic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1046984198 8:120369421-120369443 CAGGCTGGCCAGAAGGACCTTGG - Exonic
1047473925 8:125206928-125206950 CAGTGAGGGGAGAAGGACCAAGG + Intronic
1048617700 8:136095887-136095909 AAGTGTGGGCAGAAGGTCCATGG + Intergenic
1049422526 8:142523280-142523302 CAGGATGGGCAGAAGAACTGGGG + Intronic
1052928617 9:34038766-34038788 CAGTCTGGGCAGCAGGGCAGAGG - Intronic
1055418843 9:76114322-76114344 CAGTCCTGGCAGAAGGCCCGTGG - Intronic
1057751434 9:97796367-97796389 CAGACTGGGCAGCCGGACAGAGG - Intergenic
1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG + Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060816645 9:126638650-126638672 CAGTCTGCTCAGAAAGACCTCGG + Intronic
1061623660 9:131827769-131827791 CAGCCTGGGGAGCAGGAGCGGGG + Intergenic
1062087491 9:134656287-134656309 CAGGCTCTGCAGAAGGACAGAGG - Intronic
1062400008 9:136368281-136368303 CAGTCTGGGCAGAAGGGGTTAGG - Intronic
1062446728 9:136598362-136598384 CAGTGTGGGCAGGAGCACCTGGG + Intergenic
1062446756 9:136598460-136598482 CAGTGTGGGCAGGAGCACCTGGG + Intergenic
1062446770 9:136598509-136598531 CAGTGTGGGCAGGAGCACCTGGG + Intergenic
1062446803 9:136598632-136598654 CAGTGTGGGCAGGAGCACCTGGG + Intergenic
1062446832 9:136598730-136598752 CAGTGTGGGCAGGAGCACCTGGG + Intergenic
1188009165 X:25039465-25039487 CAGTATGGAGAGAAGGACGGTGG + Intergenic
1189243176 X:39541337-39541359 CAGTCTGGAGAGAGGGTCCGAGG - Intergenic
1191828665 X:65392404-65392426 CAGACTGGGCAGCTGGACAGAGG - Intronic
1192607134 X:72529968-72529990 CAGTCTTGGCAGAGGGACAAAGG - Intronic
1193096432 X:77554602-77554624 CAGTTTGGGCAAAGGGACAGAGG - Intronic
1193195123 X:78622560-78622582 CAGTCTGGGTAGAAGGGATGTGG + Intergenic
1200075583 X:153549092-153549114 CAATGTGGGCAGTAGGACGGAGG + Intronic
1201540766 Y:15102675-15102697 CAGTCTGGGGAGGAGGAGAGAGG + Intergenic