ID: 1042804136

View in Genome Browser
Species Human (GRCh38)
Location 8:72753877-72753899
Sequence CACATTAAGCAATATGTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042804134_1042804136 1 Left 1042804134 8:72753853-72753875 CCTCTCTAGTCATCCAACAGAAC 0: 1
1: 0
2: 1
3: 2
4: 101
Right 1042804136 8:72753877-72753899 CACATTAAGCAATATGTTCTTGG No data
1042804133_1042804136 8 Left 1042804133 8:72753846-72753868 CCTTTTTCCTCTCTAGTCATCCA 0: 1
1: 0
2: 2
3: 36
4: 386
Right 1042804136 8:72753877-72753899 CACATTAAGCAATATGTTCTTGG No data
1042804132_1042804136 22 Left 1042804132 8:72753832-72753854 CCTTAGAAACTCTTCCTTTTTCC 0: 1
1: 0
2: 2
3: 44
4: 403
Right 1042804136 8:72753877-72753899 CACATTAAGCAATATGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042804136 Original CRISPR CACATTAAGCAATATGTTCT TGG Intronic
No off target data available for this crispr