ID: 1042808480

View in Genome Browser
Species Human (GRCh38)
Location 8:72798008-72798030
Sequence TTGTATATGAAGAAGGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1033
Summary {0: 1, 1: 1, 2: 3, 3: 96, 4: 932}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042808480_1042808486 26 Left 1042808480 8:72798008-72798030 CCATTTCCCTTCTTCATATACAA 0: 1
1: 1
2: 3
3: 96
4: 932
Right 1042808486 8:72798057-72798079 TTCATCAGGATGGTTTATGATGG No data
1042808480_1042808483 12 Left 1042808480 8:72798008-72798030 CCATTTCCCTTCTTCATATACAA 0: 1
1: 1
2: 3
3: 96
4: 932
Right 1042808483 8:72798043-72798065 TCCTTCAAAGTATTTTCATCAGG No data
1042808480_1042808487 27 Left 1042808480 8:72798008-72798030 CCATTTCCCTTCTTCATATACAA 0: 1
1: 1
2: 3
3: 96
4: 932
Right 1042808487 8:72798058-72798080 TCATCAGGATGGTTTATGATGGG No data
1042808480_1042808485 16 Left 1042808480 8:72798008-72798030 CCATTTCCCTTCTTCATATACAA 0: 1
1: 1
2: 3
3: 96
4: 932
Right 1042808485 8:72798047-72798069 TCAAAGTATTTTCATCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042808480 Original CRISPR TTGTATATGAAGAAGGGAAA TGG (reversed) Intronic
902085552 1:13857943-13857965 TTGTATATGGTGTAAGGAAAGGG + Intergenic
902433687 1:16383036-16383058 TTGTATTTTTAGAAGGGACAGGG + Intronic
902788655 1:18750003-18750025 TTGTACATGAAGAATTGATAAGG + Intergenic
903039741 1:20520206-20520228 TAGGCTATGAAGATGGGAAAAGG + Intergenic
903120721 1:21215442-21215464 TTGTTAACAAAGAAGGGAAAAGG + Intergenic
904109060 1:28110954-28110976 CTGTTAATGAAGAAGGGGAAGGG + Intergenic
904958564 1:34310836-34310858 TTGTATATGGTGAAAGGAAGGGG - Intergenic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905227283 1:36487552-36487574 TTGTATATTTAGTAGAGAAAGGG + Intergenic
906287603 1:44597908-44597930 TTGTATGTGAAGGAGGTAGACGG - Intronic
906449809 1:45935564-45935586 TTGTATATGGTGAAAGGAAGGGG + Intronic
906874096 1:49516996-49517018 TTGTATAGGAATAATGTAAACGG - Intronic
906883579 1:49619939-49619961 TTGTATAAGATGTAGGGAAGGGG - Intronic
907017409 1:51030534-51030556 TTGTATATGGTGAAAGGTAAGGG + Intergenic
907090371 1:51718779-51718801 TCATTTATGAAGAAGGGAACAGG - Intronic
907237820 1:53063448-53063470 TTCTATATAAAGGAGGGATAGGG - Intronic
908026464 1:59957245-59957267 TAGGATCTGCAGAAGGGAAATGG + Intergenic
908170491 1:61499879-61499901 TTTTCTACAAAGAAGGGAAATGG - Intergenic
908204408 1:61830849-61830871 TTGTATATGGTGAAAGGAAGGGG - Intronic
908812236 1:67994599-67994621 TTGTATATGGTGAAAGGCAAGGG - Intergenic
909659456 1:78065863-78065885 TTGTATATGGTGTAAGGAAAAGG - Intronic
909878559 1:80843292-80843314 TTCTAAATGAAGAAAGAAAATGG - Intergenic
910254374 1:85232723-85232745 TTGTATATGGTGAAAGGTAAGGG + Intergenic
910393322 1:86766705-86766727 TTGTATATGGTGAAAGGAAAGGG + Intergenic
910773761 1:90854480-90854502 TTCTACATGAAGGAGGAAAAAGG - Intergenic
911185723 1:94902707-94902729 GTGTGTATGAGGAAGGAAAATGG - Intronic
911252708 1:95596130-95596152 TTGTATATGATGTAAGGAAGGGG - Intergenic
911374806 1:97039103-97039125 TTGTATATGATGAAAGGGAGGGG + Intergenic
911519370 1:98910131-98910153 TTTTGTATGGAGAAGGCAAAGGG - Intronic
911545096 1:99206895-99206917 TTGTATATGGTGAAAGGTAAGGG - Intergenic
911578630 1:99608619-99608641 TTGTATATGGTGAAAGGTAAGGG + Intergenic
911797880 1:102097200-102097222 TGGACTATGAAGATGGGAAAAGG - Intergenic
912284070 1:108349439-108349461 TTGTATAAGATGTAAGGAAAGGG + Intergenic
912461809 1:109839035-109839057 TAGGCTATGAAGATGGGAAAAGG - Intergenic
912613220 1:111069982-111070004 TTGTATATGATGTAAGGAAAGGG + Intergenic
912614299 1:111082132-111082154 TTGTATATGGAGAAAGGTAGGGG + Intergenic
912677957 1:111703360-111703382 TTGTATATGAAGAACGGCCAAGG + Exonic
913145562 1:115986467-115986489 TTGGAAATTAAGAAGGGAGACGG + Intronic
913212227 1:116591093-116591115 CTGCATTTGAAGAAGGGAGAAGG - Intronic
913313219 1:117524870-117524892 CTGTAACTGTAGAAGGGAAAAGG + Exonic
913386693 1:118265445-118265467 TTGTATATGGTGAAAGGAAGGGG - Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
913448487 1:118975047-118975069 TTGTGAATGGAGAAGGGAATGGG + Intronic
913573828 1:120149064-120149086 TTGTATATGGCAAAGGGAAGGGG + Intergenic
914450769 1:147789478-147789500 ATGTTGATGAAGAAGGGGAATGG + Intergenic
914930109 1:151923327-151923349 TGGGCTATGAAGATGGGAAAGGG + Intergenic
914968744 1:152287277-152287299 TTGTATATGGTGTAAGGAAAGGG - Intergenic
915000884 1:152589535-152589557 TTGTATATGATGAATGGTAGGGG - Intronic
915075249 1:153302847-153302869 GCGTATAAGCAGAAGGGAAAGGG + Intronic
915908304 1:159895852-159895874 TTGTATGTAATTAAGGGAAAAGG + Intronic
915915371 1:159937475-159937497 TTATATTTGAAGAACTGAAAAGG + Intronic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
916327958 1:163584254-163584276 TTGTTTGTGATGACGGGAAAAGG + Intergenic
916404009 1:164479169-164479191 TTGTATATAAATAAGGTAAATGG + Intergenic
916845343 1:168644659-168644681 TTGTATATGAGAAATTGAAAAGG - Intergenic
916906452 1:169290483-169290505 TTGTATAAGATGAAAGGAAGGGG - Intronic
916940562 1:169672609-169672631 TTGTATATGATGTAAGGAAGGGG - Intronic
916985476 1:170186704-170186726 TTGTATATGATGTAAGGAAGGGG + Intergenic
917063324 1:171064832-171064854 TGGAACTTGAAGAAGGGAAAGGG + Intergenic
917134286 1:171774080-171774102 TTGTATATGGTGTAGGGTAAGGG + Intergenic
917363505 1:174203177-174203199 TTGTTTATGATGTAAGGAAATGG + Intronic
917363518 1:174203283-174203305 TTGTATATGATGTAAGGAAATGG + Intronic
918134240 1:181657266-181657288 CTGAATATGAGGAGGGGAAAGGG + Intronic
918395051 1:184105300-184105322 TTGTATATGATGTAAGGAAGAGG + Intergenic
918467689 1:184838133-184838155 TTTTATATGAAAAAGGTATAAGG - Intronic
918508665 1:185285706-185285728 TTGTATATGATGTAAGGTAAGGG + Intronic
918974372 1:191462947-191462969 TTGTATATGGTGTAGGGAAAGGG - Intergenic
919231105 1:194775563-194775585 TTATATATCAATAAAGGAAATGG - Intergenic
919326215 1:196110219-196110241 TTGTATAAGATGTAAGGAAAGGG - Intergenic
921506747 1:215980578-215980600 TTATCTGTGAGGAAGGGAAAGGG - Intronic
921540956 1:216415218-216415240 TTGTTTATGAAGAATTCAAAAGG + Intronic
921681717 1:218041092-218041114 TTGTATTTCAACAAGGTAAAGGG + Intergenic
921759440 1:218896020-218896042 GTGAATATGATGTAGGGAAAAGG + Intergenic
921792189 1:219302732-219302754 TTGGAGGTGAAAAAGGGAAAGGG - Intergenic
922391596 1:225149125-225149147 TTGTATATGGTGAAAGGAAGGGG + Intronic
923708817 1:236368610-236368632 TTGTATTTTTAGTAGGGAAAGGG + Intronic
924273283 1:242357657-242357679 TTGTATTTGTAGTAGGGACAGGG + Intronic
924412832 1:243824227-243824249 TTGTATATGATGTAAGGAAGGGG - Intronic
1062923410 10:1297002-1297024 TTGTATAGGAGGAAAAGAAAAGG - Intronic
1063586115 10:7353911-7353933 TTGTATATTTAGTAGAGAAAGGG - Intronic
1063704558 10:8418368-8418390 TTGTATTTTTAGTAGGGAAAGGG + Intergenic
1063846060 10:10128050-10128072 TTGTATATTTAGTAGGGACATGG - Intergenic
1064313357 10:14232102-14232124 TTGTATATGGAGAAAGGAAGGGG + Intronic
1064482642 10:15754725-15754747 TTGTATTTTTAGTAGGGAAAGGG - Intergenic
1064652284 10:17521677-17521699 TTGGATATGAATGAGGGAGAAGG - Intergenic
1064654508 10:17543828-17543850 TGGTATATGCTGAAGGGAGAGGG - Intergenic
1064777907 10:18800019-18800041 TTGTATATGATGAAAGGAAGGGG - Intergenic
1064878474 10:20022355-20022377 TTAAATATGAAGAAAGAAAATGG + Intronic
1064884315 10:20092775-20092797 CTTTATAAGAGGAAGGGAAAGGG + Intronic
1064912903 10:20422612-20422634 TTGTATATGGTGAAAGGAAGAGG + Intergenic
1065011500 10:21425111-21425133 TTGTATTTTTAGTAGGGAAAGGG + Intergenic
1065560240 10:26956798-26956820 TTCTATTTGCATAAGGGAAATGG - Intergenic
1065688349 10:28308087-28308109 TTGCAGGGGAAGAAGGGAAATGG + Intronic
1065927546 10:30448731-30448753 TTGTTTAATAAGAAGGGATAAGG - Intronic
1066091806 10:32029921-32029943 TTGTAGATTAAAAAGAGAAAAGG + Intronic
1067396017 10:45919036-45919058 TTATAAATGGAGAAGGGTAAAGG - Intergenic
1067864336 10:49888155-49888177 TTATAAATGGAGAAGGGTAAAGG - Intronic
1068084606 10:52359585-52359607 TTATACATGAAGAAAGGAAGTGG + Intergenic
1068262368 10:54599475-54599497 TTGTATATGATGTAAGGAAAGGG - Intronic
1068386582 10:56336261-56336283 TTGTATATGATGCAAGGTAAAGG + Intergenic
1068436308 10:56995434-56995456 ATGTACATGAAGAAGAGTAAAGG + Intergenic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069254201 10:66311755-66311777 TTGTATATGGAAAAGGAATATGG + Intronic
1069268309 10:66491670-66491692 TTGTATCTGAAGGAGGCAAAAGG + Intronic
1069328201 10:67258066-67258088 TTGCATATGTAGAAGGAACAAGG - Intronic
1069805477 10:71120430-71120452 TTGTATATGGTGCAGGGAAGGGG + Intergenic
1070013827 10:72504445-72504467 TTGTATATGATGCAAGGTAAGGG - Intronic
1070451966 10:76568177-76568199 TTGTATAAAAAGAAGGGATATGG - Intergenic
1070524454 10:77283207-77283229 GTGTATGTGAAGAAAGAAAATGG - Intronic
1071079063 10:81788350-81788372 TTGTTTCTGTAGAAGGGATATGG + Intergenic
1071790123 10:88944554-88944576 GTGTACATGAAGAAGAGAACAGG + Intronic
1072182577 10:93001188-93001210 TGGAATATGAAGAAGAGGAAAGG + Intronic
1072231848 10:93420485-93420507 TTTTATATGAAGATGACAAAAGG - Intronic
1072794279 10:98342511-98342533 CTGTATATTAAAAAGAGAAATGG - Intergenic
1072864800 10:99047290-99047312 TTGTATATGGTGAAAGGTAAGGG - Intronic
1072874664 10:99159626-99159648 TTGTATATGATGTAAGGTAAGGG - Intronic
1072959733 10:99918484-99918506 CTGGATATGAAAAGGGGAAAGGG - Intronic
1074072955 10:110091604-110091626 TTGTATATGGTGAAAGGAAAAGG - Intronic
1074993681 10:118736158-118736180 TTGTAGATAAAGAAGAGGAATGG + Intronic
1075029726 10:119014446-119014468 TTGTATATGTAGTAGAGACAGGG + Intergenic
1075181958 10:120219502-120219524 TCCTACAGGAAGAAGGGAAAGGG + Intergenic
1075246796 10:120829786-120829808 TTGGATGTGAACAAGGGAATAGG - Intergenic
1075510225 10:123066561-123066583 TTGAATAGGGAGAAGAGAAAAGG - Intergenic
1075812737 10:125237495-125237517 TGGTATATGAAAAATGGAGAAGG - Intergenic
1076021781 10:127079756-127079778 TTGTATTTTTAGAAGAGAAAGGG - Intronic
1077345596 11:2049547-2049569 TGGAGTATGAAGAATGGAAAAGG - Intergenic
1077792640 11:5458140-5458162 TTGTGTATGATGAAAGGAAGAGG + Intronic
1077954722 11:7003696-7003718 GTGTTAATGAAGAAGGGCAAAGG + Intronic
1077965002 11:7120394-7120416 TTGTTTATAAATAAAGGAAATGG + Intergenic
1078036331 11:7809181-7809203 TTGTATATGGTGAAAAGAAAGGG - Intergenic
1078449716 11:11431492-11431514 GTGGACATGAAGAAAGGAAAAGG - Intronic
1078452228 11:11448999-11449021 CTGTTTGTGAGGAAGGGAAAGGG - Intronic
1078877999 11:15417444-15417466 TTGCCTCTGAAGAGGGGAAAAGG - Intergenic
1079192149 11:18287971-18287993 GTGTATATGGAGATGGAAAAAGG - Exonic
1079709588 11:23665315-23665337 TTGTATATGGTGAAAGGTAATGG + Intergenic
1079879447 11:25906527-25906549 TTGTATATGATGTATGGAAGGGG - Intergenic
1080221863 11:29914996-29915018 TTGTAGATGAAGGAGGGTAGGGG - Intergenic
1080574561 11:33586345-33586367 TTGTCTCTGAAGAAGGGTAAGGG - Intronic
1080651696 11:34227905-34227927 TTGTATTTTAAGTAGGGACAGGG + Intronic
1080651745 11:34228230-34228252 TTGTATTTTAAGTAGGGACAGGG + Intronic
1081107165 11:39084759-39084781 TTGTATATGGTGAAAGGTAAGGG + Intergenic
1081267170 11:41039101-41039123 TTGTATATGGTGAAAGGCAAGGG + Intronic
1082754632 11:57062422-57062444 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1082886052 11:58083631-58083653 TTGTATATGCTGAAAGGTAAGGG + Intronic
1083435325 11:62639127-62639149 TTGGATCTGGAGAAAGGAAATGG + Intronic
1083495157 11:63045517-63045539 TTGTATATGATGAAAGGTAGGGG - Intergenic
1083504404 11:63142285-63142307 TAGGCTATGAAGACGGGAAAAGG - Intronic
1083514974 11:63248695-63248717 TTGTATATGGTGTAAGGAAAGGG - Intronic
1083527137 11:63379335-63379357 TTGTATATGGTGAAAGGAAGGGG - Intronic
1084331538 11:68433330-68433352 TTTTCAATGCAGAAGGGAAAGGG - Intronic
1084362857 11:68680290-68680312 TTGTATATGTAGTAGAGAGAGGG + Intergenic
1084883078 11:72185943-72185965 TTGTATATTTAGAAGGGACAGGG - Intergenic
1084926363 11:72515757-72515779 TTGTATATCATGAAAGGAAGGGG - Intergenic
1084985075 11:72862254-72862276 TTTTATAGTAAGAAGGAAAAAGG + Intronic
1085439011 11:76540139-76540161 TTTTTTATTAAGAAGTGAAATGG - Intronic
1085888514 11:80549536-80549558 TTGTATATGATGAAAGGAAAAGG - Intergenic
1086076129 11:82854990-82855012 TTGTATATGGTGAAAGGAAGGGG - Intronic
1086196738 11:84149389-84149411 TTGTATATGATAAAAGGTAAGGG + Intronic
1086261514 11:84946257-84946279 TTCTGTTTGAAGAAAGGAAAGGG - Intronic
1086293011 11:85332628-85332650 TTGTATATGGTGAAAGGAAGGGG + Intronic
1086526483 11:87733263-87733285 TTGTATATGATGTAAGGAAAGGG + Intergenic
1086554699 11:88095244-88095266 TTGGAAATGAAGCAGAGAAATGG - Intergenic
1086559705 11:88153909-88153931 CTTTATATCAAGAAGGAAAATGG + Intronic
1086568731 11:88258357-88258379 TTGTATATGATGTAAGGAAGGGG + Intergenic
1086741537 11:90375630-90375652 TTGTATATGATGTAAGGAAGGGG + Intergenic
1087080415 11:94165736-94165758 TTGTATGTGTAGAAGGGACAGGG - Intronic
1087513136 11:99123719-99123741 TTGTATATGACGTAAGGAAGGGG + Intronic
1087532064 11:99395715-99395737 TTGTATATGATGTAAGGAAGGGG + Intronic
1087560221 11:99780921-99780943 TTGTAGATCAGGAAGGGAAAGGG + Intronic
1088007974 11:104965425-104965447 TAGGCTATGAAGATGGGAAAAGG - Intronic
1088017328 11:105076897-105076919 TAGGCTATGAAGATGGGAAAAGG - Intronic
1088508190 11:110547282-110547304 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1088508196 11:110547314-110547336 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1088517384 11:110653039-110653061 TTGTATAAGATGTAAGGAAAGGG - Intronic
1089037129 11:115406644-115406666 TTGTATGTTAAGAAGTGATATGG + Intronic
1089699767 11:120237583-120237605 TTGCACATGAAAAAGGGCAACGG + Intronic
1089888232 11:121851576-121851598 TTCTACAAGAAGAAAGGAAAGGG - Intergenic
1089951146 11:122527962-122527984 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1090128288 11:124113213-124113235 TTTTATTTCAGGAAGGGAAATGG + Intergenic
1090305198 11:125685389-125685411 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1090886452 11:130881056-130881078 CTGTCTATGAACAAGGAAAAGGG + Intronic
1090936511 11:131347705-131347727 TTGTGTAGGAAGAAGAGAGAAGG + Intergenic
1091069369 11:132548819-132548841 TTGAAGATGGAGAAAGGAAAAGG - Intronic
1091148614 11:133304330-133304352 TTGTATTTTAAGAAGGAAACGGG - Intronic
1091811485 12:3402294-3402316 TTGTATATGACGTAAGGAAGGGG - Intronic
1092334136 12:7613897-7613919 TTGTATATGATGTAAGGAAGGGG - Intergenic
1092483220 12:8879317-8879339 TTGTATATTTAGTAGGGACAGGG - Intronic
1092512807 12:9175280-9175302 TTGTATATGGTGAAAGGAAGGGG - Intronic
1092636807 12:10460109-10460131 TTGTATATAGTGTAGGGAAAGGG + Intergenic
1092674843 12:10904496-10904518 TTGTATATGGTGAAAGGTAAAGG - Intronic
1092751182 12:11720547-11720569 TTGTATATGGTGAAAGGTAAGGG - Intronic
1092774049 12:11926530-11926552 TTGCATATGATGAAAGGTAAGGG - Intergenic
1093085047 12:14857540-14857562 TTGTATATGATGTAAGGAAGGGG + Intronic
1093481725 12:19611079-19611101 TTGTATATGGTGAAAGGAAGGGG + Intronic
1093879252 12:24384477-24384499 TTGGATATGCAAAAGAGAAAGGG + Intergenic
1094076865 12:26486259-26486281 TTGTGTATACAGAAGAGAAATGG - Exonic
1094145674 12:27226149-27226171 GCGTATAGGAAGAAGGGAGAAGG + Intergenic
1094431024 12:30369212-30369234 TAGGCTATGAAGATGGGAAAAGG + Intergenic
1094623429 12:32101386-32101408 ATGTAAATAAAGAAGAGAAAGGG - Intergenic
1094858170 12:34428517-34428539 TTGTAAATGAAGGAGCAAAATGG + Intergenic
1095259034 12:40077324-40077346 TTGTATATGAAGAAAGGAAAGGG + Intronic
1095298287 12:40552112-40552134 TTGTATCTGATGTAAGGAAAGGG + Intronic
1095598136 12:43982303-43982325 GTGAATCTGAATAAGGGAAATGG + Intronic
1095617180 12:44204870-44204892 TTGTATATGGTGAAAGGAAGGGG - Intronic
1095698849 12:45170552-45170574 TTCTCTCTGAAGAAGAGAAAGGG - Intergenic
1095831863 12:46596459-46596481 TTGTATAAGAAGTAAGGAAGGGG + Intergenic
1096900040 12:54867650-54867672 TTGTATATGGTGAAAGGAAAGGG + Intergenic
1096963532 12:55604685-55604707 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1097670089 12:62525739-62525761 TTTTATTTTAAAAAGGGAAATGG + Intronic
1097732691 12:63147764-63147786 TTGTTTATCAATCAGGGAAATGG + Intronic
1097932628 12:65206145-65206167 TTTTATGTGAAGAAAGCAAAGGG - Intronic
1098111098 12:67122791-67122813 TTATTTATGAAGGATGGAAAAGG + Intergenic
1098371418 12:69764311-69764333 TTGTATATGGTGAAGGGGGATGG + Intronic
1098850990 12:75595636-75595658 TTGTATATGATGTAAGGAAGGGG + Intergenic
1098936500 12:76485397-76485419 TTGTATTTGTAGTAGGGACAGGG - Intronic
1099059006 12:77882399-77882421 TTGTATATGGTGAAAGGTAAAGG - Intronic
1099088201 12:78273534-78273556 TTGTATATGTTGAAAGGAAGGGG + Intergenic
1099579057 12:84418653-84418675 TTGTATATGATGTAAGGAAGAGG + Intergenic
1099617090 12:84949770-84949792 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1099863775 12:88252940-88252962 TTGTATTTTTAGAAGAGAAAAGG - Intergenic
1099991452 12:89726479-89726501 TTGTATATGATGTAAGGAAGGGG - Intergenic
1100094450 12:91015025-91015047 TTGTATATGATGAAAGAAAGGGG - Intergenic
1100402280 12:94242701-94242723 TTTTATATGGAGAATGGAATTGG - Intronic
1100671013 12:96812971-96812993 TTGGAAAAGAAGAAAGGAAAGGG - Intronic
1100909538 12:99342602-99342624 TTGTATATTTAGAAAAGAAAAGG + Intronic
1100944266 12:99762499-99762521 TTGTGTATGATGAAAGGTAAGGG - Intronic
1101687997 12:107044918-107044940 TTTCAGAAGAAGAAGGGAAAAGG + Intronic
1101781339 12:107840682-107840704 TTGTATATGAAGGAAGTAAAGGG - Intergenic
1101861682 12:108487365-108487387 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1101861710 12:108487704-108487726 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1101980344 12:109400797-109400819 TTGTATATGCAGAGGGGTAGTGG - Intronic
1102057968 12:109910961-109910983 ATGTCTATGTAGAAAGGAAAGGG + Intronic
1102950814 12:117029974-117029996 TGGTCTATGAGGAAGAGAAAAGG + Intronic
1103179372 12:118895948-118895970 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1103626240 12:122222426-122222448 TTGTATTTGTAGTAGGGACAGGG - Intronic
1104203288 12:126613177-126613199 TTCTAAATAAGGAAGGGAAATGG + Intergenic
1104781070 12:131420825-131420847 TTGTGGTTGAAGGAGGGAAATGG + Intergenic
1104793206 12:131497176-131497198 AAGTATATTTAGAAGGGAAAAGG + Intergenic
1105215474 13:18281716-18281738 CTGCATTTGAAGAAGGGAGAAGG - Intergenic
1105331368 13:19419556-19419578 TTGTATATGATGAAAGGTATGGG - Intergenic
1105648021 13:22342266-22342288 TTGCATATGATGTAGGGAAAGGG - Intergenic
1105672238 13:22632221-22632243 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1106002103 13:25733783-25733805 TTGTATTTGAGGAAAGGAGATGG - Intronic
1106388190 13:29308374-29308396 TTGTATATGGTGAAAGGAAGGGG - Intronic
1106636927 13:31539124-31539146 CTGAATATGAATAATGGAAATGG + Intergenic
1106930509 13:34658964-34658986 CTGTATGTGTAGAAGGGCAATGG - Intergenic
1106978341 13:35248758-35248780 TGGTATATGGAGAAAGGTAAGGG - Intronic
1106988114 13:35380270-35380292 TTGTATTTGTAGTAGGGATAGGG - Intronic
1107200389 13:37708833-37708855 ATGTATACGGAGAAGGAAAAAGG - Intronic
1107333583 13:39328960-39328982 TGATGTAGGAAGAAGGGAAAAGG + Intergenic
1107451336 13:40512784-40512806 ATGAAACTGAAGAAGGGAAAGGG - Intergenic
1107485078 13:40818691-40818713 TTGTATATGATGAAAGGTATGGG - Intergenic
1108013280 13:46045239-46045261 TTTTATAAAAAGAAGTGAAAAGG - Intronic
1108195210 13:47986719-47986741 TTGTATATGGTGTAGGGAAGGGG + Intronic
1108433784 13:50381267-50381289 TATTTTAGGAAGAAGGGAAATGG + Intronic
1108787150 13:53918564-53918586 TTGTATATGGAGAAGAGGAAGGG + Intergenic
1109573337 13:64221335-64221357 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1109700253 13:66015546-66015568 TGGTATATGATGATGGGAAGTGG - Intergenic
1109707007 13:66108653-66108675 ATGTGAATGAAGAAGGGAAGAGG - Intergenic
1110012223 13:70351222-70351244 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1110063453 13:71070004-71070026 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1110079784 13:71295677-71295699 TGGTAAATGAAGAAAGAAAATGG - Intergenic
1110449792 13:75628804-75628826 TTGTAAAGGAAGAAGGGATGGGG - Intronic
1110477621 13:75935714-75935736 ATGTATTTGAGGAAGGCAAATGG - Intergenic
1110484699 13:76024529-76024551 TTATATATAAAGAAAGAAAATGG + Intergenic
1110875626 13:80506222-80506244 TTGTATATGATGATAGGTAAGGG + Intergenic
1110931635 13:81225689-81225711 TAGAATAGGAAAAAGGGAAATGG + Intergenic
1111642151 13:90982061-90982083 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1111857525 13:93657419-93657441 TTGTATATGGTGAAAGGAAGGGG - Intronic
1111918973 13:94390784-94390806 GTGTGTCTGAAGAAGGGAAGTGG - Intronic
1112377420 13:98856017-98856039 TTGTATATGGAGAAGCTAAATGG + Exonic
1113265798 13:108616812-108616834 TTGAATATGAAAAGAGGAAAAGG + Intronic
1113390144 13:109888489-109888511 TTGTATATGATGTAAGGAAGGGG - Intergenic
1113712056 13:112472324-112472346 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1114991051 14:28290450-28290472 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1114997199 14:28369441-28369463 GTGTTTGTGAAGAGGGGAAAAGG - Intergenic
1115182452 14:30645004-30645026 TTGTATATGGTGAAAGGAAGGGG + Intronic
1115391930 14:32863600-32863622 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1115629461 14:35229466-35229488 TTGTATATGGTGAAAGGTAAAGG + Intronic
1115773426 14:36689489-36689511 ATGTTTATGAAGTAAGGAAAGGG + Intronic
1115788984 14:36857689-36857711 TTGTATATGAAGCAGTTTAAGGG + Intronic
1115858943 14:37662580-37662602 TTGTATATGGTGAAAGGAAGGGG + Intronic
1116026267 14:39519193-39519215 TTGTATATGGTGAAAGGTAAAGG - Intergenic
1116298450 14:43143068-43143090 TTGTATATAAAAAAGGGAAGAGG + Intergenic
1116459549 14:45156617-45156639 TGGTATAAGAAAAAGGGAATTGG + Intronic
1116482621 14:45410024-45410046 TTGTATATGATGAAAGGTAAGGG + Intergenic
1116879798 14:50154102-50154124 TGGAAGAGGAAGAAGGGAAAAGG + Intronic
1117173094 14:53120766-53120788 TTGTATAAGATGTAAGGAAAGGG - Intronic
1117244303 14:53868589-53868611 TTATATATGATGAAAGGAAGGGG - Intergenic
1117363547 14:55002229-55002251 TTGAATTTGAAGAAGGAAAAAGG + Intronic
1117459085 14:55927023-55927045 TTTCTTATGAAGAAGGGCAAAGG - Intergenic
1117506482 14:56408598-56408620 TTGTATATGATGTAAGGAAGGGG - Intergenic
1119277554 14:73372582-73372604 TTATATATGGAAAAGAGAAAAGG - Intronic
1119417519 14:74483175-74483197 TTGTATATGAAGAATGGCCAAGG + Intronic
1120089999 14:80320516-80320538 TTTTTTATGTAGAAGGAAAATGG + Intronic
1120540888 14:85748969-85748991 TTGAAAATGAAGAAGGTGAAGGG + Intergenic
1120571470 14:86122534-86122556 TTATATATGAAAAAAGAAAATGG + Intergenic
1120639563 14:86993997-86994019 TTGTTTATGGAGTAAGGAAAGGG - Intergenic
1121003374 14:90468859-90468881 TTGTATAAGATGAAAGGAAGGGG + Intergenic
1121059448 14:90891957-90891979 TTCTATATTAAGATTGGAAAAGG + Intronic
1121246196 14:92462568-92462590 TTGTATTTGTAGTAGGGACAAGG + Intronic
1121683308 14:95812592-95812614 TGGGATATGATGATGGGAAAAGG - Intergenic
1202840985 14_GL000009v2_random:121115-121137 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1202910370 14_GL000194v1_random:111343-111365 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1202882208 14_KI270722v1_random:71153-71175 TTGTAAATGAAGCAGTCAAATGG + Intergenic
1123478269 15:20608153-20608175 TGGGCTATGAAGATGGGAAAAGG - Intergenic
1123639746 15:22392232-22392254 TGGGCTATGAAGATGGGAAAAGG + Intergenic
1123842678 15:24264856-24264878 TTGTATATGATGTAAGGAAGGGG + Intergenic
1123908099 15:24940377-24940399 TTGTATATGATGTAAGGAAAGGG + Intronic
1124412740 15:29450401-29450423 TTGTATATGGTGAAGGGAACGGG + Intronic
1124710144 15:32002917-32002939 TTGTATATTAAAAAAAGAAAAGG + Intergenic
1124790921 15:32725809-32725831 TTGTATAAGGTGTAGGGAAAGGG + Intronic
1125400085 15:39292941-39292963 TTGTATATGGTGTAGGGAAGGGG + Intergenic
1125408608 15:39381223-39381245 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1125572436 15:40731056-40731078 TTGTATCTGAGGAAAGGAAGAGG + Exonic
1126227213 15:46285037-46285059 TTATATATGGTGAAAGGAAAGGG + Intergenic
1126253320 15:46594503-46594525 TTGTATATGGAGTAAGGAAAGGG + Intergenic
1126278032 15:46907694-46907716 TTGTATAAGATGTAAGGAAAGGG + Intergenic
1126500705 15:49340936-49340958 TTGTATATGATGAAAGGAAAGGG + Intronic
1126970056 15:54100503-54100525 GTGTAAATGGAGAAGAGAAAGGG - Intronic
1127163760 15:56220850-56220872 TTGTATATGATATAAGGAAATGG + Intronic
1127781081 15:62316702-62316724 TTGTACATGGTGAAGAGAAAAGG + Intergenic
1127783387 15:62335436-62335458 TTCTATATACAGAAAGGAAAGGG - Intergenic
1128446294 15:67764259-67764281 TTGTATAAGGAGAAGGGAACAGG + Intronic
1128574829 15:68766190-68766212 TTGTATTTTTAGAAGGGACAGGG + Intergenic
1128663355 15:69519669-69519691 TTGTATATGATGTAAGGCAAGGG - Intergenic
1128848405 15:70923791-70923813 TGATATATGGAGAAGGAAAAAGG - Intronic
1128901486 15:71426422-71426444 GTATATATAAAGGAGGGAAATGG - Intronic
1129368931 15:75075519-75075541 TTGTATAAGAAAAAGTAAAATGG + Intronic
1129378500 15:75150675-75150697 TGGGCTATGAAGATGGGAAAAGG - Intergenic
1130012930 15:80166073-80166095 TTGTCTCTGGAGAAGGGAACTGG - Intronic
1130226330 15:82060981-82061003 CTGTGTATGAGGAAGTGAAAGGG - Intergenic
1130837803 15:87668825-87668847 TAGGCTATGAAGATGGGAAAAGG - Intergenic
1130999620 15:88929384-88929406 TAGGCTATGAAGATGGGAAAAGG - Intergenic
1131809220 15:96154993-96155015 GTGTATATGCAGGAGGGGAAGGG + Intergenic
1131887407 15:96931765-96931787 TTTTATATGAAAAAGGAACATGG + Intergenic
1131968885 15:97872904-97872926 TTGTATAAGATGTAAGGAAAGGG - Intergenic
1133019098 16:2958795-2958817 TTGTATATTTAGTAGGGACAGGG - Intergenic
1133506745 16:6419687-6419709 TAGTCTATGAAGAACGGGAATGG - Intronic
1134832628 16:17336050-17336072 TTGTAAAGGAAGAAGAGGAAAGG + Intronic
1135017352 16:18935012-18935034 TTGTATTTTTAGAAGAGAAAGGG + Intergenic
1135705322 16:24670120-24670142 TTGTATTTTAAGAAGGGACGGGG + Intergenic
1137012517 16:35336879-35336901 TTGAATTTGAACATGGGAAAAGG - Intergenic
1137070088 16:35897491-35897513 TTGTAAATGAAGGAGCCAAATGG + Intergenic
1137070755 16:35902493-35902515 TTGTAAATGAAGAAGCCAAATGG + Intergenic
1137460302 16:48655346-48655368 TAGGCTATGAAGATGGGAAAAGG + Intergenic
1137961557 16:52886714-52886736 ATGTGGAGGAAGAAGGGAAAAGG - Intergenic
1138806115 16:60090712-60090734 TAATTTATGAAAAAGGGAAAAGG - Intergenic
1138920658 16:61524452-61524474 TTATATAGGATGAAGGGACAGGG + Intergenic
1140579501 16:76212709-76212731 TTGTATATGATAAATGGTAAGGG - Intergenic
1140636684 16:76923224-76923246 TTGTATATGGTGTAAGGAAAAGG + Intergenic
1141022600 16:80511467-80511489 ATGTACATGAACAGGGGAAAGGG + Intergenic
1141059784 16:80855380-80855402 TTGTAAATGAAAAAGAGAGATGG + Intergenic
1141075195 16:80999868-80999890 TTGTATATGATGAAAGGTAGGGG - Intronic
1141312068 16:82924124-82924146 TTTTCTATGAAACAGGGAAAAGG - Intronic
1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG + Intergenic
1143636925 17:8170198-8170220 TTGTATTTGTAGAAGAGACAGGG - Intergenic
1143725927 17:8846133-8846155 TTGTATATGGGGAAGGGTAGTGG + Intronic
1144336339 17:14272639-14272661 TTGTATATGATGTAGGGTAAGGG + Intergenic
1144336816 17:14278878-14278900 GTGTATATGAAGAAAAGAAGAGG + Intergenic
1146238926 17:31196710-31196732 TTGTATATGATGTAAGAAAAGGG + Intronic
1146277018 17:31522601-31522623 TAGGATTTGAAGAAGGGACAAGG - Intronic
1146437448 17:32863489-32863511 TTGTAAATTAAGAGGGGAAAGGG + Intronic
1148703324 17:49605515-49605537 TTGTATATGTAGTAGAGACAGGG - Intronic
1148717871 17:49728670-49728692 TTGCACAGCAAGAAGGGAAAGGG + Intronic
1149058922 17:52398339-52398361 TTGTATATGATGTAAGGTAAGGG + Intergenic
1149106058 17:52966813-52966835 TTGTATATGGGGTAAGGAAAGGG + Intergenic
1149112629 17:53051251-53051273 TTGTATATGATGAAAGGTAATGG - Intergenic
1149142033 17:53442806-53442828 TTGTATATGATGTAAGGAAGGGG - Intergenic
1149176698 17:53880480-53880502 TTATATATGATGTAAGGAAAAGG - Intergenic
1150252129 17:63712088-63712110 TTGTAAATGAAGGAGGGGAGGGG + Intronic
1150927731 17:69551310-69551332 TTGTAGGTGGAGAAGGGTAATGG + Intergenic
1151122973 17:71813466-71813488 CTGTATATGGTGAAAGGAAAAGG - Intergenic
1153147196 18:2046868-2046890 TGGTTTATGAAAAAGGCAAAAGG + Intergenic
1153302598 18:3604345-3604367 TATTAAAAGAAGAAGGGAAATGG - Intronic
1153371200 18:4318018-4318040 TTGTATTTTAAGAAGAGACAGGG + Intronic
1154413729 18:14160758-14160780 TTGTATATGATGTAAGGGAAGGG - Intergenic
1154484738 18:14864819-14864841 TGGTAGATGGAGAAGGGAAAGGG - Intergenic
1154971715 18:21416516-21416538 TTGTATATTTAGGAGGGACAGGG - Intronic
1155899273 18:31367969-31367991 TTGTATATGATGAAAGGTAGGGG - Intergenic
1156027402 18:32670338-32670360 TAATAAATAAAGAAGGGAAAGGG + Intergenic
1156067991 18:33168256-33168278 TTGTATATGATGTAAGGAAGGGG + Intronic
1156549494 18:38000501-38000523 TTTTATTTGCTGAAGGGAAAAGG - Intergenic
1156705357 18:39875057-39875079 TTTAATATGAAGAAAGAAAAGGG - Intergenic
1157079386 18:44506361-44506383 GTGTGTCAGAAGAAGGGAAAAGG - Intergenic
1157502121 18:48198642-48198664 TTATACATGAAAGAGGGAAATGG - Intronic
1157577657 18:48754471-48754493 TTGTGCAGGAAGAAGGAAAAGGG + Intronic
1159320694 18:66844049-66844071 TCGTATATGGTGAAGGGTAAAGG - Intergenic
1159400157 18:67920940-67920962 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1159477678 18:68944172-68944194 TTGTAAATCAAGAAGCCAAATGG + Intronic
1159692927 18:71513412-71513434 TTTTATATGAAAAATAGAAAAGG + Intergenic
1159881202 18:73859987-73860009 TTGAATATGAAAAAAGGAGATGG + Intergenic
1159958498 18:74537307-74537329 TTGTATATGATGTAAGGAAGGGG + Intronic
1161944152 19:7424196-7424218 TTGTATATTTAGTAGAGAAAGGG + Intronic
1162878618 19:13639863-13639885 TGATAAAGGAAGAAGGGAAAGGG - Intergenic
1163897012 19:20068103-20068125 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1164124053 19:22294141-22294163 TTGTATATGATGTAAGGAAGGGG + Intronic
1164176008 19:22775376-22775398 TTGTATATGATGTAAGGAAGGGG - Intronic
1165292601 19:34899929-34899951 TTGTATATGGAGCAAGGCAATGG - Intergenic
1165375002 19:35435609-35435631 TTGTCTCTAAAGAAGGAAAAAGG - Intergenic
1165620964 19:37247358-37247380 TTGTATATGAGAAATTGAAATGG + Exonic
1165683521 19:37797998-37798020 TTGTATATGGTGAAAGGTAAGGG + Intronic
1167309704 19:48729885-48729907 TTGTATTTTTAGTAGGGAAAGGG + Intronic
1167719017 19:51165602-51165624 TTATATATTAAGAATGCAAATGG + Intergenic
1167887408 19:52513192-52513214 TTGTATTTTTAGTAGGGAAAGGG + Intergenic
1167931354 19:52868332-52868354 TTGTATTTGAAGTAGAGACAGGG - Intronic
1168552916 19:57313302-57313324 TTGTATATGATGAAAGGAAGGGG + Intergenic
1202657819 1_KI270708v1_random:40251-40273 TTGTAAATGAAGGAGTCAAATGG + Intergenic
925017288 2:540399-540421 TTGTATATGGTGAAAGGAAGAGG - Intergenic
925855382 2:8124237-8124259 TGTTTTATAAAGAAGGGAAATGG - Intergenic
926455927 2:13068848-13068870 TCGTAAATAAAGAAGGAAAACGG + Intergenic
926723929 2:15983085-15983107 TTGGAAAGGAAGAAGAGAAAAGG - Intergenic
927043451 2:19253444-19253466 CTGGATGTGAAGAAAGGAAAAGG - Intergenic
927158697 2:20238045-20238067 TTGTATATGATGTAAGGTAAGGG + Intergenic
927234985 2:20864731-20864753 TTGTATATGGTGTAGGGAAGGGG - Intergenic
927824942 2:26301805-26301827 TTGTATGTGAATAAACGAAAGGG + Intergenic
928046430 2:27937978-27938000 TTGTATATGATGAAAGGTAAGGG + Intronic
928257396 2:29735069-29735091 TTGCATATGAAGAAATTAAAAGG + Intronic
928791946 2:34967973-34967995 TTATATATGAATAAAGAAAATGG - Intergenic
928805856 2:35153903-35153925 TTGTATATGGTGAAAGGAAAGGG - Intergenic
929240796 2:39651106-39651128 GTGTGTTTGAAGAAGGGACATGG + Intergenic
929314725 2:40463745-40463767 TAGCATATCAAGAAGGGATATGG - Intronic
929409377 2:41679919-41679941 TAATATATGAAGGAGGGAAATGG - Intergenic
930282783 2:49390754-49390776 TTGTATATGATGTAAGGAAGAGG - Intergenic
930339297 2:50092208-50092230 TTGCATATGAAGAAGTGAAGAGG - Intronic
931036881 2:58253730-58253752 TTGTTTAAGAAAAAGGAAAAAGG + Intergenic
931576825 2:63726220-63726242 TTGTATATGGTGAAAGGAAGTGG + Intronic
931624148 2:64241235-64241257 TTGTATATGATGTAAGGAAGGGG + Intergenic
931798485 2:65735278-65735300 TTGTATATGGTGTAGGGAAGAGG + Intergenic
931844438 2:66188454-66188476 TTGTATATGATGAAAGGTAGGGG + Intergenic
932057049 2:68456367-68456389 TTGTATATGAAAAACTGAAGAGG + Intergenic
932687149 2:73881267-73881289 TTGTATATGGTGTAAGGAAAGGG + Intergenic
932935938 2:76101121-76101143 TTGTATATGATGAAATGTAAGGG - Intergenic
932937183 2:76117704-76117726 TTGTATATGGTGTAAGGAAAGGG - Intergenic
933067109 2:77811286-77811308 TTGTATAAGATGTAAGGAAAGGG - Intergenic
933283926 2:80363860-80363882 TGGTATTGGGAGAAGGGAAATGG - Intronic
933455233 2:82511495-82511517 TTGTATATGGTGAAAGGAAGGGG + Intergenic
933578412 2:84096794-84096816 TTGTATATGATGTAAGGTAATGG - Intergenic
933619513 2:84521645-84521667 TTGTATATGGTGTAAGGAAAGGG + Intronic
934149571 2:89132907-89132929 TTGTATATGGTGAAAGGAAGGGG - Intergenic
934181240 2:89622771-89622793 TTGTATTTTTAGAAGAGAAAGGG - Intergenic
934217726 2:90049121-90049143 TTGTATATGGTGAAAGGAAGGGG + Intergenic
934298856 2:91765011-91765033 CTGCATTTGAAGAAGGGAGAAGG + Intergenic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
934756709 2:96829256-96829278 ATATATATAAAGAAGGGAAAAGG - Intronic
934988869 2:98907117-98907139 TTGTATTTTTAGTAGGGAAAGGG - Intronic
935227445 2:101065462-101065484 TTACAAATGAAGGAGGGAAAGGG + Intronic
935319691 2:101873926-101873948 ATGTATATGGAAAAAGGAAATGG - Intronic
935932470 2:108142713-108142735 TTGTATATGGTGAAAGGAAAGGG - Intergenic
936782014 2:116044823-116044845 TTGTATATGGTGGAAGGAAAGGG - Intergenic
937195797 2:120155592-120155614 TTCTATAAGGAGAAGAGAAAGGG - Intronic
937331002 2:121029909-121029931 TTGCATATTAGTAAGGGAAATGG + Intergenic
937728225 2:125192892-125192914 TTGTATATGGCGAAAGGAAGGGG - Intergenic
937861536 2:126715170-126715192 GTGTCCTTGAAGAAGGGAAATGG - Intergenic
938216726 2:129523796-129523818 TTGTATATGATGTAAGGAACAGG + Intergenic
939390206 2:141558458-141558480 TTTTATGTGAAGAAGAGAGAAGG - Intronic
939658474 2:144856955-144856977 TTTTATATGAACAAGAAAAATGG - Intergenic
940371880 2:152911796-152911818 TTGTATATGATGTAAGGAAGGGG - Intergenic
940579412 2:155558592-155558614 TTGTATATGATGTACGGAAGGGG - Intergenic
940930402 2:159422562-159422584 TTGTATATGGTGAAAGGAAGAGG - Intronic
941047742 2:160695537-160695559 TTGAAAATGAAGATGGGAGAAGG + Intergenic
941092131 2:161189807-161189829 TTGTATATGGAGAAAGGCAAGGG - Intronic
941158362 2:162005948-162005970 GTGGTTATGAAGAAGGAAAAGGG + Intronic
941257499 2:163251638-163251660 TACTTTATGAAGAAGGGTAAAGG - Intergenic
941487618 2:166101697-166101719 TTGTATATGGTGAAAGGAAGGGG - Intronic
941850682 2:170177101-170177123 TTTTGAATGAAGAAGTGAAAAGG - Intergenic
942566534 2:177269688-177269710 TTTTATAAGAAGAAGAAAAAAGG + Intronic
942605208 2:177683414-177683436 TTGGTCATGAAGAAGGGAATGGG - Intronic
942828365 2:180208306-180208328 TTGTATATGGTGTAAGGAAAGGG + Intergenic
942994766 2:182248081-182248103 TTGTATCTGTAGTAGAGAAAAGG - Intronic
943489543 2:188533448-188533470 TTGTATATGGTGAAAGGTAAGGG - Intronic
943640481 2:190352612-190352634 TTGTTTGTGCAGAAGGGACAGGG - Intronic
943995394 2:194758391-194758413 TTGTTAATGAAGCATGGAAAAGG - Intergenic
944126698 2:196302056-196302078 TTGTATATAATGTAAGGAAAGGG + Intronic
944158551 2:196634860-196634882 TTGTATTTTTAGAAGAGAAAGGG - Intergenic
944756509 2:202767516-202767538 TAGTATATGAAGATATGAAAAGG - Exonic
944955959 2:204809448-204809470 TTGTATATGATATAAGGAAATGG + Intronic
945216093 2:207435769-207435791 ATGTATATAGAGAAGGGATATGG - Intergenic
945263705 2:207869382-207869404 TGGTATATGGAGAAAGGGAAAGG - Intronic
945343769 2:208688288-208688310 TTGTGTATGATGTAAGGAAAGGG + Intronic
945358939 2:208872168-208872190 TTATATAAGACTAAGGGAAAGGG + Intergenic
945430657 2:209759959-209759981 TTGTATATGGTGAAAGGAAGTGG - Intergenic
945758468 2:213880648-213880670 TTATATATGATGAAAGGTAAGGG + Intronic
945850364 2:214998931-214998953 TTGTAGATTAAAAAAGGAAATGG - Intronic
947730409 2:232426012-232426034 TTGAAACTGAAAAAGGGAAAAGG + Intergenic
948357337 2:237389682-237389704 TTGTATATTAGGAAGGGAAGAGG - Intronic
1168907827 20:1420734-1420756 TTGTATATGGTGAAAGGTAATGG + Intergenic
1169233778 20:3912127-3912149 ATGTACTTGGAGAAGGGAAAGGG + Intronic
1169380325 20:5101050-5101072 TTGTATACCACCAAGGGAAAAGG + Intronic
1169530389 20:6478788-6478810 ATTTAGATGATGAAGGGAAATGG - Intergenic
1170266845 20:14476527-14476549 TTGTATTTTTAGTAGGGAAAGGG + Intronic
1170282193 20:14662306-14662328 TTGTATATGGTGAAAGGAAGGGG - Intronic
1170888414 20:20359490-20359512 TTGTATATTTAGTAGGGACAGGG - Intronic
1171149657 20:22815932-22815954 TTTTATTTGAAGAAAGGAAGTGG + Intergenic
1172076085 20:32298683-32298705 CTGTCTCTGAAGAAGGGAAGGGG - Intronic
1173369473 20:42422022-42422044 TTGTATATGGTGTAAGGAAAAGG - Intronic
1173447473 20:43132908-43132930 TTATATATGAGTAAAGGAAAAGG + Intronic
1174623199 20:51892743-51892765 TTATTTATGAAGAAGAGAATTGG - Intergenic
1174984357 20:55433236-55433258 AGGTATATGAAGAAATGAAAAGG + Intergenic
1176597711 21:8762593-8762615 TTGTAAATGAAGGAGCCAAATGG + Intergenic
1176629726 21:9126044-9126066 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1176695683 21:9974637-9974659 TTGTCTCTGAAGAAGAGACAGGG + Intergenic
1176723491 21:10412172-10412194 GGGTAGATGGAGAAGGGAAAGGG - Intergenic
1176741625 21:10609036-10609058 TTGTATATGATGAAAGGTATGGG + Intergenic
1176796586 21:13374656-13374678 TGGTAGATGGAGAAGGGAAAGGG + Intergenic
1176859295 21:13997497-13997519 TTGTATATGATGTAAGGGAAGGG + Intergenic
1176980592 21:15376681-15376703 TTCTAGATGAAGAAAGAAAAGGG + Intergenic
1177383901 21:20383213-20383235 TTGAAGGTGAAGAAGGGAGAAGG + Intergenic
1177394802 21:20519750-20519772 CTGTATTTGAAGGATGGAAACGG + Intergenic
1177425373 21:20916040-20916062 TTGTATATGATGAAAGGTAGGGG + Intergenic
1177453420 21:21302288-21302310 TTGTATCTGATGAAAGGTAAGGG + Intronic
1177697495 21:24592276-24592298 TTTTATCAGATGAAGGGAAAGGG + Intergenic
1177706117 21:24707448-24707470 TTGTAGATGAACTAAGGAAATGG - Intergenic
1177830308 21:26131286-26131308 TTGTCAATGAAGTAGTGAAAAGG + Intronic
1177960083 21:27653385-27653407 TTGTATATGATGCCAGGAAATGG + Intergenic
1178026261 21:28471704-28471726 TTGTATATGGTGAATGGTAAGGG - Intergenic
1178041632 21:28646334-28646356 TTATGTATGAAGCAGGGATAGGG - Intergenic
1178212190 21:30548449-30548471 TTGTATATGGTGTAAGGAAAGGG + Intronic
1178273148 21:31212175-31212197 TTGTGTATGAAGGAAAGAAAAGG + Intronic
1179378019 21:40869038-40869060 TTGTATATGGTGAAAGGTAAGGG - Intergenic
1179430992 21:41321087-41321109 TTGTATTTGGAGAAGGAAACTGG - Intronic
1180193017 21:46177082-46177104 TTGTATATGGTGTAAGGAAAGGG - Intronic
1180304648 22:11064944-11064966 GGGTAGATGGAGAAGGGAAAGGG - Intergenic
1180376842 22:12101489-12101511 TTGTAAATGAAGGAGCCAAATGG + Intergenic
1180420729 22:12812203-12812225 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1180563502 22:16642307-16642329 TTGTATATGATGAAAGGTATGGG + Intergenic
1181916787 22:26287841-26287863 TTGTGTATGATTAAGGAAAAGGG + Intronic
1182035232 22:27193007-27193029 GTGTATTTGGAGGAGGGAAATGG + Intergenic
1183025121 22:35059001-35059023 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1183277635 22:36910160-36910182 TTGTATATGGTGAAAGGTAAGGG + Intergenic
1183285282 22:36958851-36958873 CTGTATGGGAAGAAGGGACAGGG - Intergenic
1203245841 22_KI270733v1_random:68381-68403 TTGTATGTGCACAAGTGAAAGGG - Intergenic
949304344 3:2622687-2622709 ATGTATATGAAGAACTCAAAAGG - Intronic
949328353 3:2892508-2892530 TTATCTTTGAAGAAAGGAAAGGG + Intronic
949367186 3:3295321-3295343 TTGTATATGGTGAAAGGTAATGG - Intergenic
949669521 3:6382441-6382463 TAGTCTCTGAAGAAAGGAAATGG + Intergenic
950220791 3:11194481-11194503 TGGTATATGAAGGAGGCAAAAGG - Intronic
951269824 3:20610135-20610157 TTGTATATGGTGAATGGTAAAGG - Intergenic
951305222 3:21052144-21052166 TTGTATATTATGTAAGGAAAGGG - Intergenic
951370172 3:21836379-21836401 TTGAATATGCAGAAGTGTAAAGG - Intronic
951732449 3:25825195-25825217 TTGTATATGGTGAAAGGGAAGGG - Intergenic
951973523 3:28476251-28476273 TTTTAATTGAAGAAGGGATAAGG - Intronic
952122268 3:30259761-30259783 TTGTATATGAAGATGAGTAGTGG - Intergenic
952570235 3:34707034-34707056 TTGTATATGGTGTAAGGAAAGGG - Intergenic
952652376 3:35741605-35741627 AGGGATTTGAAGAAGGGAAATGG + Intronic
952673230 3:35995821-35995843 TTGTATATGATGTAAGGAAATGG + Intergenic
953261561 3:41344296-41344318 TTGTATATGGTGTAAGGAAAAGG - Intronic
953485362 3:43289401-43289423 TTGAAAAGGAAGGAGGGAAATGG + Intronic
953491654 3:43357762-43357784 TTGTATATGATGTAAGGAAGGGG - Intronic
953524411 3:43676557-43676579 TTGTATGTGCAGGAGGGAAGTGG + Intronic
954287938 3:49632144-49632166 TTGTATATGATGTAAGGAAAAGG - Intronic
954650756 3:52161247-52161269 TTGTATTTTTAGAAGAGAAATGG + Intergenic
955883919 3:63577410-63577432 CTATATATGAAGAAAGGACAAGG + Intronic
955955438 3:64284587-64284609 TTATTTAAGAAGAAGGAAAATGG - Intronic
957457037 3:80465100-80465122 TTGTATATGACGAAAAGAAGGGG + Intergenic
957592647 3:82220446-82220468 TTGTATATGGTGAAAGGTAAGGG + Intergenic
958460700 3:94391010-94391032 TTGTATATGGTGAAAGGAAGGGG - Intergenic
958754295 3:98232211-98232233 TTGTATATGTTGAAAGGTAAGGG - Intergenic
958872254 3:99574270-99574292 TTGTATATGCTGAAAGGAAGGGG - Intergenic
959481507 3:106878310-106878332 TTGTATATGGTGAAAGAAAAGGG + Intergenic
959629482 3:108491904-108491926 TGGGATATGAAGAATGGGAAGGG - Intronic
959712117 3:109395771-109395793 TTGGAAATGAAGATTGGAAACGG - Intergenic
959801433 3:110500000-110500022 TTGTATAAGATGTAAGGAAAGGG - Intergenic
959838963 3:110951898-110951920 TTGTATATTAAAATGTGAAAAGG + Intergenic
959974348 3:112441527-112441549 TTGTATATGGTGAAAGGTAAGGG - Intergenic
960074235 3:113465963-113465985 TTCTATTTAAAGAAGGGAAGAGG - Intronic
960683914 3:120278144-120278166 TTGTATATGGTGAAAGGTAAGGG - Intronic
960736499 3:120786574-120786596 TTGTATATGATGAAAGGAGGGGG + Intergenic
960775638 3:121248817-121248839 TTGTATATGGTGAAAGGTAAGGG + Intronic
960913909 3:122678624-122678646 ATTTAGATGAAGTAGGGAAAGGG + Intergenic
961140990 3:124556034-124556056 TTAGGTATGAAGAAGGGAAGGGG + Intronic
961838432 3:129685071-129685093 ATGTATTAAAAGAAGGGAAAGGG + Intronic
961843061 3:129734743-129734765 TTGTCTCTGAAGAAGCGGAATGG + Intronic
962034217 3:131633845-131633867 TTCTAAATAAAGAAGGGAAAGGG - Intronic
962100588 3:132338172-132338194 TTGTATATGCATAAGGAAATTGG - Intronic
962392324 3:134983545-134983567 TTTTAGAGCAAGAAGGGAAATGG + Intronic
962512174 3:136113448-136113470 TTGTATATGGTGAAAGGAAGGGG - Intronic
962657163 3:137558981-137559003 TTGTATATGGTGAAAGGTAAGGG - Intergenic
963124539 3:141802935-141802957 TAGAATATGCAGAAGGGAAAAGG - Intronic
963145193 3:141987078-141987100 TTGTAAATGAAGAAATAAAATGG - Intronic
963703462 3:148655800-148655822 TTGTATATGGTGAAAGGAAGGGG + Intergenic
963852037 3:150218887-150218909 TTGTATTTGAAGAAGAGACAGGG + Intergenic
964458464 3:156894861-156894883 TTGTATATGGTGAAAGCAAAGGG - Intronic
964874840 3:161355225-161355247 TGTTATATAAAGAAGGAAAAGGG + Intronic
965825810 3:172728333-172728355 TTCTAAATGAAGAAAAGAAAAGG - Intergenic
965945482 3:174235254-174235276 GTGTATATGAAGGAGGGGTAAGG - Intronic
966099595 3:176250521-176250543 GAGTAAATGAAAAAGGGAAAAGG - Intergenic
966612952 3:181886404-181886426 TTGGATAGGAAGAAGGGAACTGG + Intergenic
966644495 3:182228885-182228907 TTGAATGTGGAGAAAGGAAAAGG - Intergenic
966716030 3:183013662-183013684 TTGTATATGTAGTAGAGACAGGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967580407 3:191146524-191146546 TTGTATATGATGTAAGGAAGGGG + Intergenic
967750067 3:193103365-193103387 TTGTATATGATGTAAGGAAGGGG + Intergenic
968012689 3:195295581-195295603 TAGAATATGTAGAAGGGAACAGG + Intronic
968785438 4:2618765-2618787 TTGTATTTTTAGAAGGGACAAGG + Intronic
970062242 4:12047919-12047941 TTGTCTATTAAGCAGAGAAAAGG + Intergenic
970170623 4:13285969-13285991 TTGTATATGGTGAAAGGAAGGGG + Intergenic
970211841 4:13717984-13718006 CTGTATATGAGAAAGGGACAAGG - Intergenic
970427837 4:15962409-15962431 CTGTATATGAGTAAAGGAAAGGG + Intronic
970653844 4:18208810-18208832 TTGTATATGATGTAAGGAAGGGG + Intergenic
970759550 4:19468379-19468401 TTGTGTAGGAAGAAGGGTTAGGG + Intergenic
970954051 4:21789963-21789985 ATGTATATGAAGATGGAAAATGG - Intronic
971067969 4:23056449-23056471 TTGTATTTTTAGAAGAGAAAGGG + Intergenic
971164757 4:24171420-24171442 TTGTAGATGAAGATGGGCACGGG - Intergenic
971370227 4:26013086-26013108 TTTTTTATGAAGCAGGGAGAGGG - Intergenic
971656498 4:29353099-29353121 TTGTATGTGTTGAAGGGAAGGGG - Intergenic
971696602 4:29912350-29912372 TTGTATATGGTGAAAGGAGAGGG - Intergenic
971706460 4:30049412-30049434 TTGTATATGGTGAAAGGAAGGGG - Intergenic
971818813 4:31525638-31525660 TTGTATATGGTGAAAGGAAGGGG + Intergenic
972097619 4:35368014-35368036 TTGTATATGGAGTAAGGAAGGGG + Intergenic
972693533 4:41422599-41422621 CTATATCTGAAGAAGGAAAAAGG - Intronic
972970193 4:44565384-44565406 TTGTATATGGTGTAAGGAAAAGG - Intergenic
973361013 4:49164847-49164869 TTGTAAATGAAGGAGCCAAATGG + Intergenic
973538210 4:51906055-51906077 TTTTATTTCAAGAAGTGAAAAGG - Intronic
974222418 4:58992927-58992949 TTGTATATGATGTAAGGAAGGGG - Intergenic
974233337 4:59146751-59146773 TTGTATATGGTGTAAGGAAACGG + Intergenic
974414468 4:61588377-61588399 TTGAATATGAAGAAGACAAAAGG - Intronic
974590816 4:63945709-63945731 TTGTATATGATGTAAGGAAGAGG + Intergenic
974906536 4:68065424-68065446 TTGTATATCAAGGAGGGATATGG - Intronic
974912653 4:68141860-68141882 TTTTAGATGAAGAATAGAAATGG - Intergenic
974953907 4:68615507-68615529 TTGAATTTGCAGGAGGGAAAAGG + Intronic
975508486 4:75166127-75166149 TTGTATAAGGTGAAAGGAAAGGG + Intergenic
975822020 4:78280528-78280550 ATGTATATGAATTAGGGATAAGG + Intronic
976011814 4:80498063-80498085 TTGTATATGGTGAAGGGAAGGGG - Intronic
976603534 4:86961268-86961290 TTACAGATGAAAAAGGGAAAAGG + Intronic
976627863 4:87206432-87206454 TTTTACATAAAGTAGGGAAAGGG + Intronic
976948022 4:90794335-90794357 TTGTATATGATGTAAGGAAGAGG + Intronic
976962793 4:90999958-90999980 TTGTGTATGGTGAAAGGAAAGGG + Intronic
977409110 4:96638734-96638756 TCTTATATGAACAAGAGAAAAGG - Intergenic
977999613 4:103541219-103541241 TTGTATATGATGTAAGGAAGGGG + Intergenic
978147736 4:105396264-105396286 TTGCTTATGAAGAAGTGTAATGG - Exonic
978685923 4:111443347-111443369 TTGTATATGGTGAAAGGTAAGGG + Intergenic
978910210 4:114053635-114053657 TTGTATGTGATGTAGGGAAGGGG - Intergenic
979174511 4:117646554-117646576 TTGTATATGAGGAAAGGTAGGGG + Intergenic
979548685 4:121965522-121965544 GTGAATATAAAGAAGGGAGAGGG - Intergenic
979591343 4:122483790-122483812 TGGTCTATGAAGATGGGAAAAGG + Intergenic
979950998 4:126893521-126893543 TTTTATATGATGAAAGGTAAGGG + Intergenic
979962862 4:127041856-127041878 TTGTATATGATGAAAGATAAGGG - Intergenic
980368305 4:131834870-131834892 TTGTCTCTGAAGAAGAGACAGGG + Intergenic
980540108 4:134182419-134182441 TTGTATATGACGTAAGGAAAGGG - Intergenic
980703970 4:136468275-136468297 TTGTATATGATGAAAGGTAGGGG + Intergenic
981203136 4:142006931-142006953 TTGTATATGATGAAAGGTAGGGG + Intergenic
981402289 4:144327434-144327456 TTGTATATGATGAAAGGATAGGG - Intergenic
981942127 4:150293257-150293279 TGGTAAATCAAGAAAGGAAATGG + Intronic
982097455 4:151935791-151935813 TTGTAGATGGAGAAGGGAAAGGG + Intergenic
982646572 4:158031334-158031356 TTGTATATGGTGAAAGGAATGGG - Intergenic
982746913 4:159113566-159113588 TTGTATATGTAGTAGAGAAGGGG - Intronic
982879363 4:160691917-160691939 TTGTATATAATGAAAGGAAGGGG - Intergenic
983165002 4:164464713-164464735 TTCCATAAGAAGATGGGAAATGG - Intergenic
983174662 4:164574197-164574219 TTGTATATGGTGAAAGGTAAGGG - Intergenic
983301842 4:165935618-165935640 TTACATTTGAAGAATGGAAAAGG - Intronic
983407648 4:167350203-167350225 TTGTATATGGTGAAAGGGAAGGG + Intergenic
983522762 4:168727881-168727903 TTGTATATGGTGAAAGGTAAGGG + Intronic
983534253 4:168840423-168840445 TTGTGTATAAAGAAGGGCCAAGG - Intronic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984132673 4:175897448-175897470 TTGTATATTGAGAAGGGGAGAGG + Intronic
984202207 4:176738520-176738542 TTGCATATGATGTAAGGAAAGGG - Intronic
984294745 4:177840084-177840106 TTTTATATTAAAAATGGAAACGG + Intronic
984449148 4:179876884-179876906 TTGTATATGATGTAAGGAAAGGG + Intergenic
984604404 4:181767997-181768019 ATGTAAATGCAGAAGGCAAATGG + Intergenic
984718174 4:182944794-182944816 TTGAAAGTGAAGATGGGAAAAGG - Intergenic
984900098 4:184578685-184578707 ATATATATGGAAAAGGGAAAGGG + Intergenic
985324949 4:188756239-188756261 TTGTATATGTAGTAGAGACAGGG + Intergenic
1202758441 4_GL000008v2_random:86922-86944 TTGTAAATGAAGGAGCCAAATGG + Intergenic
985504780 5:272426-272448 TTGTCTGTGAAAAAGGGAAACGG + Intronic
985839130 5:2292490-2292512 TTGTATATGCTGAAAGGAAGGGG - Intergenic
986620816 5:9672109-9672131 TTGTATATGATGTAAGGAAGGGG - Intronic
986906809 5:12504345-12504367 TTGTATATGGTGTAAGGAAAAGG + Intergenic
987579145 5:19766049-19766071 TTGTATATTTAGTAGGGACAGGG + Intronic
987605669 5:20132783-20132805 TTGCATATCAAGAAGTGAAATGG - Intronic
988426598 5:31072511-31072533 TTGGATATGAAGATGGTTAAAGG - Intergenic
988651474 5:33156718-33156740 TTGTATATGGTGAAAGGGAAGGG + Intergenic
989459329 5:41679069-41679091 TTGTATATGGTGAAAGGTAAGGG + Intergenic
989624697 5:43418075-43418097 TTGTATTTGAAGGAGAGACAGGG + Intergenic
990080643 5:51909707-51909729 TCGTTGATGAAGAAGAGAAATGG + Intergenic
990153675 5:52849464-52849486 ATGAAAATGAAGAAGGAAAATGG + Exonic
990302518 5:54462895-54462917 CTGGATATGAGGAAGGAAAATGG + Intergenic
990649606 5:57883338-57883360 TGGGATATGAAGAAGGAAACAGG + Intergenic
990738436 5:58888721-58888743 TGGTTTTTGAAGGAGGGAAAAGG - Intergenic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991388156 5:66113190-66113212 TTGTATATGGTGTAAGGAAATGG - Intergenic
991997640 5:72403856-72403878 TTGTATATCAAGAAAGGGATTGG + Intergenic
992153895 5:73935322-73935344 TGGCATATGAAGAATAGAAAAGG + Intronic
992713382 5:79484145-79484167 TTATATATGAAGTAGTAAAATGG + Intronic
992723159 5:79580387-79580409 GTGTCTAGGAAGATGGGAAAAGG - Intergenic
992780847 5:80125583-80125605 AAGTATATGAAGAAGGCAATGGG + Intronic
992878700 5:81083427-81083449 TTGTATGTGTAGAAGAGAGAAGG + Intronic
993393331 5:87350261-87350283 CTGTATATGAGGTAGGCAAAAGG - Intronic
993422012 5:87714425-87714447 TAGGCTATGAAGATGGGAAAAGG + Intergenic
993734806 5:91463942-91463964 TTGTATATGGTGTAAGGAAAGGG - Intergenic
993751747 5:91677767-91677789 TTGTATATGATGTAAGGAAGGGG + Intergenic
994111497 5:96009965-96009987 TTGTATATGGTGAAAGGTAAGGG + Intergenic
994157447 5:96519777-96519799 TTGTATTTGTAGAAGGGATGGGG + Intergenic
994257719 5:97619380-97619402 TTGTATACGATGAAGTGAAGTGG + Intergenic
994295966 5:98088807-98088829 TTGGACATGAAGAAGGTCAAAGG + Intergenic
994309760 5:98255393-98255415 TTGTATATGGTGTAAGGAAAAGG + Intergenic
994381931 5:99081331-99081353 TTGTATATGGTGAAAGGAAGGGG + Intergenic
994970914 5:106735534-106735556 TTGTATATGATGTAAGGAAGGGG - Intergenic
995055123 5:107750761-107750783 TTGTAGAAGAAGAAAGGAAGGGG - Intergenic
995071925 5:107932998-107933020 TTGTATAGGAAGATGGGTGAAGG + Intronic
995633160 5:114156053-114156075 TTGTATATGATGTAAGGAAGGGG + Intergenic
996228947 5:121037401-121037423 TTCTATATAAAAAAGGCAAAAGG + Intergenic
996343318 5:122462347-122462369 ATTTAGATGAATAAGGGAAATGG - Intronic
996665117 5:126050007-126050029 TTATATATGAGCAAGGGGAAAGG - Intergenic
996783559 5:127214576-127214598 TTGTATATGGGGAAAGGTAAGGG + Intergenic
997006741 5:129826109-129826131 TTGTATATGATGATGGGTAGGGG - Intergenic
997048113 5:130344689-130344711 TTGTATATGGTGTAAGGAAAGGG + Intergenic
997650918 5:135519675-135519697 TGGTAAAAGAAGAGGGGAAAAGG - Intergenic
997719765 5:136068661-136068683 TTGTATATGAAATAAGGAAAGGG + Intergenic
998258060 5:140604742-140604764 TTGTATATGGAGAGAGGTAATGG + Intergenic
998294570 5:140954946-140954968 TTGTATAAGATGTAAGGAAAGGG + Intronic
998304800 5:141063150-141063172 ATGTGTATGAAGAAGAGACATGG - Intergenic
998403344 5:141859647-141859669 TTGGATATGAGGTAGGGATAGGG - Intronic
999114069 5:149146487-149146509 TTGTATATGGTGAAAGGTAAGGG + Intronic
999649147 5:153748588-153748610 TTGTATAAGAACAAGAGAAGAGG + Intronic
1000250732 5:159492179-159492201 CTGTCTATGAACAAGGGAAATGG + Intergenic
1000493398 5:161945530-161945552 TTTTGTAAGAAGATGGGAAAAGG - Intergenic
1001092476 5:168751484-168751506 TAGATTATGCAGAAGGGAAATGG + Intronic
1002059795 5:176619624-176619646 TTGTCTAAGGGGAAGGGAAATGG - Intergenic
1002137921 5:177119668-177119690 TTGTATTTGTAGTAGGGAAGGGG - Intergenic
1002369934 5:178743496-178743518 TTGTATATGGGGAAAGGTAAGGG - Intergenic
1002496122 5:179612806-179612828 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1003169066 6:3706400-3706422 TTGTATATCATGTAAGGAAAGGG - Intergenic
1003289987 6:4772293-4772315 TTCTATATGAAAGAGAGAAATGG + Intronic
1003892270 6:10574129-10574151 CTGTAGAAGAAGAAAGGAAACGG + Intronic
1004739722 6:18447111-18447133 TTTTATATAAATAAGGGTAAGGG + Intronic
1004825829 6:19419998-19420020 TTTTATATGGGGAAGGGAAGGGG + Intergenic
1005737980 6:28766641-28766663 TTGTAAATGAAGGAGCCAAATGG + Intergenic
1005739427 6:28776423-28776445 TTGTAAATGAAGGAGCCAAAAGG + Intergenic
1005803583 6:29451170-29451192 TTGCATATGGTGAAAGGAAAGGG - Intronic
1005827893 6:29646375-29646397 TTGTATTTGAAGTAGAGACAGGG + Intergenic
1006229491 6:32571008-32571030 ATGTATAGGAAGCAAGGAAATGG - Intronic
1006783681 6:36650335-36650357 TTGTAGGGGAAGAAGGGAAAGGG - Intergenic
1006969013 6:38021062-38021084 TGTTAAATGAAGAAAGGAAAAGG - Intronic
1007075824 6:39065554-39065576 TTGTGTGTAAAGAAGGGAAAAGG + Intronic
1007105920 6:39282758-39282780 TTGGGTATGGAGGAGGGAAAGGG - Intergenic
1007361114 6:41356578-41356600 TTCTTGATGAAGAAGGGTAAGGG + Intergenic
1007868652 6:45006366-45006388 TTAAAAATGAAGAAAGGAAAAGG - Intronic
1007954684 6:45905883-45905905 TTGTATATGATGAAAGGTAGGGG + Intronic
1008205307 6:48648836-48648858 TTGTATATGATGTAAGGAAGGGG - Intergenic
1008924920 6:56881585-56881607 TTGAGTTTGAAGATGGGAAATGG - Intronic
1009024495 6:57982643-57982665 TTTTATATGAAGTAAAGAAATGG - Intergenic
1009200076 6:60734114-60734136 TTTTATATGAAGTAAAGAAATGG - Intergenic
1009274021 6:61651990-61652012 TTTTACCTGGAGAAGGGAAAGGG - Intergenic
1009340901 6:62553732-62553754 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1009547308 6:65036299-65036321 TTGTATATGGTGAAAGGTAAGGG - Intronic
1009557705 6:65195493-65195515 TTCTTTTTAAAGAAGGGAAAAGG - Intronic
1009575357 6:65450193-65450215 TTGTATCTGAAGAAATGAATAGG - Intronic
1009599267 6:65777007-65777029 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1009877436 6:69522306-69522328 TTGTATATGATAAAAGGAAAGGG - Intergenic
1009915629 6:69992073-69992095 TTATATATGGTGAAAGGAAAGGG + Intronic
1010201203 6:73283746-73283768 TTGTATTTTTAGTAGGGAAAGGG + Intronic
1010257677 6:73777585-73777607 TTGTATATGATGTAAGGAAGGGG + Intronic
1010278754 6:73999527-73999549 TTGAATATAATGAAAGGAAAGGG + Intergenic
1010531261 6:76970177-76970199 TTGTATATTTTGAAGGGGAATGG - Intergenic
1010647078 6:78402362-78402384 TTGTATATGTTAAAAGGAAAAGG + Intergenic
1010665787 6:78628920-78628942 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1010686846 6:78863392-78863414 TGGTAAATGAAGAAGCCAAAAGG - Intergenic
1010693066 6:78933440-78933462 TTGTATTTTAAGAAGAGAAGGGG - Intronic
1010751610 6:79621746-79621768 GTGTATATCAAGAAGGAGAATGG - Intergenic
1011138273 6:84123545-84123567 TTGTATATGATGAGAGGTAAGGG - Intergenic
1011181079 6:84621769-84621791 TTGTATATGATGAGGGAGAAGGG - Intergenic
1011253490 6:85397760-85397782 TTGTATATGATGTAAGGAAGGGG - Intergenic
1011320237 6:86083316-86083338 TTATATATGATGAAAGGAAGTGG + Intergenic
1011327041 6:86159915-86159937 TTGTATATGATGCAAGGAAGGGG - Intergenic
1011849549 6:91609081-91609103 TTGGCTATGCAAAAGGGAAAAGG + Intergenic
1011900454 6:92288366-92288388 TTGTATATGATGTAAGGAAGGGG + Intergenic
1012678414 6:102146950-102146972 TTGTATATGATGAAAGGAAGGGG - Intergenic
1012942320 6:105428283-105428305 ATGTATTTGCATAAGGGAAATGG - Intergenic
1013284567 6:108670068-108670090 TTCTATATGGAGATGGGAGAAGG + Intronic
1013418281 6:109944060-109944082 TTTCAAATGAAGATGGGAAAAGG - Intergenic
1013625208 6:111930168-111930190 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1014179491 6:118369394-118369416 TTTTATATGGTGAAAGGAAAGGG - Intergenic
1014381139 6:120743759-120743781 TGGTATTTGAGGAAGGGAAACGG - Intergenic
1014418581 6:121214104-121214126 TTGTATATGATATAAGGAAAAGG - Intronic
1014513199 6:122349971-122349993 TTATAAATGAAAAAGTGAAAGGG - Intergenic
1014872756 6:126615859-126615881 TTGTATATGATGAAAGGTAAGGG - Intergenic
1015045476 6:128770555-128770577 TTGGATATGGTGAAAGGAAAGGG - Intergenic
1015147134 6:129999888-129999910 TTGTATCTTCAGAAGGAAAAGGG + Intergenic
1015277460 6:131398986-131399008 TTGTATTTGAAGTAGAGATAGGG - Intergenic
1015537241 6:134278949-134278971 GTGTAAATGGAGAAGGAAAAAGG + Intronic
1015697234 6:135994169-135994191 ATGTATATTAAGAAGGGAGGTGG + Intronic
1016108850 6:140195906-140195928 TTGTATATGATAAAAGGAAGGGG - Intergenic
1016473555 6:144401408-144401430 TTTGATATGAAGATGGTAAAGGG + Intronic
1016519462 6:144930299-144930321 TTCAATAGGAAGAAGAGAAATGG - Intergenic
1016913392 6:149221681-149221703 TAGTCTAGGAAGAAGGGCAAGGG + Intronic
1017065144 6:150521912-150521934 ATGTATATACAGAGGGGAAAAGG - Intergenic
1017276937 6:152580683-152580705 TTGTATATGGTGAAAGGAAGGGG + Intronic
1017371428 6:153713568-153713590 TTTTATATAAAGAATGTAAATGG + Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1018295665 6:162340747-162340769 TTGTATAAGATGTAAGGAAAGGG - Intronic
1018570168 6:165201599-165201621 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1018730297 6:166645248-166645270 TTCAATATGAAGAATGGCAAAGG + Intronic
1018934040 6:168261568-168261590 TTGTATGTCCAGAAGGGACACGG - Intergenic
1019090023 6:169521303-169521325 TCGAATATGAAGAAGAGACAAGG + Intronic
1020123810 7:5521205-5521227 TTGTATTTGTAGTAGGGACAGGG + Intergenic
1020219925 7:6228287-6228309 ATGTATATAAAAAATGGAAAAGG - Intronic
1020462691 7:8442561-8442583 TTGTAGAAGACGAAGGAAAATGG - Intronic
1020651078 7:10877167-10877189 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1020663981 7:11016358-11016380 TTGTATATAAAGAATAAAAAAGG + Intronic
1020786161 7:12575307-12575329 TTGAATATGAAGAAATAAAAAGG - Intronic
1021066161 7:16175764-16175786 TTACAAATGAAGCAGGGAAAAGG + Intronic
1021068969 7:16213574-16213596 TTGTATATGTAGTAGAGACAGGG - Intronic
1021345951 7:19528792-19528814 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1021368260 7:19808661-19808683 TTGAGAATGAAAAAGGGAAATGG + Intergenic
1022333887 7:29404943-29404965 TTGCCTTTGAAGAAGGGAAGTGG + Intronic
1023229593 7:38012652-38012674 TTTTAAATGAAGAAGTAAAAAGG - Intronic
1023240933 7:38146608-38146630 TTCTGTTTGAAGAAAGGAAAGGG + Intergenic
1023785353 7:43702266-43702288 TTGTATATGATGAAAGGCAGGGG + Intronic
1023800714 7:43832100-43832122 TAGGCTATGAAGATGGGAAAAGG - Intergenic
1024631690 7:51254158-51254180 TTGTCAATGAAGAGGGGACATGG - Intronic
1024743353 7:52378999-52379021 TTGTATATGATGTAAGGTAAGGG - Intergenic
1026058167 7:67003286-67003308 TTGTATAAAAAGAAGTCAAAAGG - Intronic
1026667738 7:72358380-72358402 TAGTAAATGGAGAAAGGAAAAGG + Intronic
1026719922 7:72821726-72821748 TTGTATAAAAAGAAGTCAAAAGG + Intronic
1026860886 7:73787777-73787799 TTGTATTTTTAGAAGAGAAAGGG - Intergenic
1026953868 7:74364603-74364625 TTGCCTAAGAAGAAGGGACAGGG - Intronic
1027058777 7:75068770-75068792 TTGTCTGTGAACAAGGGAACAGG + Intronic
1027357509 7:77372654-77372676 TTGTATAAGTAAAAGGTAAACGG + Intronic
1027596304 7:80178204-80178226 TTGTAGATGAACAAAGAAAATGG + Intronic
1027719058 7:81715233-81715255 TGGTGTAGGAAGAAGGAAAAAGG - Intronic
1028028920 7:85883997-85884019 TTTTGCATCAAGAAGGGAAAGGG + Intergenic
1028981601 7:96973246-96973268 TTCTGTTTTAAGAAGGGAAAGGG + Intergenic
1030398867 7:109022931-109022953 TTCTATAGGAAAAAGTGAAAAGG + Intergenic
1030404031 7:109088127-109088149 TTGTATATGATGTAAGGAAGGGG - Intergenic
1030451139 7:109713604-109713626 TTGTATATGATGTAAGGAAGGGG - Intergenic
1030531185 7:110713081-110713103 TTGTATATGGTGAAAGGTAAGGG + Intronic
1030959538 7:115899565-115899587 TTGTATATGGTGAAAGGTAAGGG - Intergenic
1031167627 7:118248550-118248572 TTGTATATGATGTAAGGAAGGGG + Intergenic
1031253679 7:119420436-119420458 TAAACTATGAAGAAGGGAAAAGG + Intergenic
1031775809 7:125907771-125907793 TTGTATACGATGTAAGGAAAGGG - Intergenic
1031810912 7:126367670-126367692 TTTTATATGAAGAAGAGAAGGGG + Intergenic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1032153834 7:129452413-129452435 TAATAAATGAAGAGGGGAAAGGG + Intronic
1032249792 7:130245836-130245858 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1032276992 7:130466496-130466518 TTTAATATGTAGAAGGAAAACGG - Intergenic
1032745913 7:134785827-134785849 TTTTATATGAACATGGGAGAAGG + Intronic
1032778361 7:135139744-135139766 TTGTATATGGTGAAAGGAAGGGG + Intronic
1032968913 7:137136025-137136047 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1033261780 7:139850267-139850289 TTTTATAGGAAAAAAGGAAATGG - Intronic
1033300521 7:140180461-140180483 TTGTATTTTTAGAAGGGACAGGG - Intergenic
1033491812 7:141851759-141851781 TTGTATATGGTGAAGGGAAGGGG - Intergenic
1035673549 8:1438281-1438303 ATGGATATGAGGAAGGGTAAGGG + Intergenic
1035750535 8:1993117-1993139 TTGTATTTTTAGTAGGGAAAGGG + Intronic
1036539992 8:9697269-9697291 TTGTATATGAGGAAAGGTAAGGG - Intronic
1036749675 8:11435905-11435927 CTGTGTATGAAGACGGGATATGG - Intronic
1037066496 8:14584726-14584748 TTACACATAAAGAAGGGAAAAGG + Intronic
1037216046 8:16452417-16452439 TAGAATATGAAGAATAGAAAAGG - Intronic
1037225581 8:16585538-16585560 TTGTATATGGTGCAAGGAAAAGG + Intergenic
1037242170 8:16789955-16789977 TTGTATATTTTGAAGTGAAAAGG - Intergenic
1037288600 8:17326926-17326948 TTGTAAATAAAGAGGGAAAAAGG + Intronic
1038239105 8:25791623-25791645 GTATATATGCAGAAGGGAGATGG + Intergenic
1038859478 8:31371334-31371356 TTGTATATGGTGTAGGGAAAGGG + Intergenic
1039102256 8:33953139-33953161 TTGTATATGATGTAAGGAAAGGG + Intergenic
1039289697 8:36080829-36080851 TTGTATATGATGTAAGGAAGGGG - Intergenic
1039954217 8:42195022-42195044 TTGTGGATGAAGGAGGGAACAGG - Intronic
1040013482 8:42681609-42681631 TTCTATATTCAGAAGGGGAACGG - Intergenic
1040080859 8:43283514-43283536 TTGTATATGATGAAAGGCAGGGG + Intergenic
1040791800 8:51239026-51239048 TTGAATATTATGAAGGAAAATGG + Intergenic
1040961716 8:53041061-53041083 TTGTATATGGTGTAAGGAAAAGG + Intergenic
1040983863 8:53272105-53272127 TTTAATATAAAGCAGGGAAAAGG - Intergenic
1041382349 8:57263293-57263315 TTGTATATGATGTAAGGAAGGGG + Intergenic
1041470739 8:58205789-58205811 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1041521501 8:58761856-58761878 TTGTATATGGCGTAAGGAAAGGG + Intergenic
1041523244 8:58777389-58777411 TTGTATATGATGTAAGAAAAGGG - Intergenic
1041881589 8:62757664-62757686 TTGGATGGGAAGAAGGGAAAAGG + Intronic
1042062641 8:64837543-64837565 TTGTATATAGAGATAGGAAAAGG + Intergenic
1042078786 8:65026343-65026365 TTGTAGATGAAGAAGACAACTGG + Intergenic
1042098152 8:65241960-65241982 TTGTATATGTTGAACAGAAAGGG - Intergenic
1042678621 8:71352969-71352991 TTGTATATGAAGAAATGAGTAGG - Intronic
1042730905 8:71933942-71933964 TGGTATAAGAAGAAGGGGAAGGG - Intronic
1042808480 8:72798008-72798030 TTGTATATGAAGAAGGGAAATGG - Intronic
1042976278 8:74473468-74473490 TTGTATATGGTGTATGGAAAGGG + Intronic
1043214094 8:77563558-77563580 TTGTATATGGTGTAGAGAAAGGG - Intergenic
1043732258 8:83697150-83697172 TTGAATATGGAGAAAGGAAGGGG + Intergenic
1043768782 8:84170388-84170410 TTGTATATGGTGAAAGTAAAGGG + Intergenic
1043806114 8:84673550-84673572 TTGTATATGATGTAAGGAAGGGG + Intronic
1044196275 8:89380118-89380140 TGCTATTGGAAGAAGGGAAAGGG - Intergenic
1044473396 8:92598604-92598626 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1044932923 8:97267099-97267121 TTGGAAATCAAGTAGGGAAATGG - Intergenic
1045235291 8:100347355-100347377 ATGTGAATGCAGAAGGGAAATGG - Intronic
1045316716 8:101049653-101049675 TTGTATTTTCAGAAGGGATAGGG + Intergenic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1045975455 8:108126354-108126376 TTGTATAAGATGTAGGGAAGGGG - Intergenic
1046140260 8:110082504-110082526 TTGTATATGGTGAAAGGAAGTGG + Intergenic
1046236772 8:111434427-111434449 TTGTATATGGTGAAAGGAAAGGG + Intergenic
1046338476 8:112821822-112821844 TTGTATAGGGAGTAAGGAAAGGG + Intronic
1046397047 8:113654359-113654381 TTGTATGTGATGTGGGGAAAGGG + Intergenic
1046671416 8:117060632-117060654 TTGTCTCTGGAGTAGGGAAATGG - Intronic
1046684720 8:117212276-117212298 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1046836582 8:118808491-118808513 TTTTGTAGGAAGAAGGCAAAAGG + Intergenic
1047271048 8:123359097-123359119 TTGTATAATGAAAAGGGAAAAGG + Intronic
1047320822 8:123780942-123780964 AGGTAAAGGAAGAAGGGAAAAGG - Intronic
1047607462 8:126489194-126489216 GGGTATTTGAAGAATGGAAAAGG + Intergenic
1047640903 8:126820878-126820900 TTGGAGAGGAAGAAGGGAGATGG + Intergenic
1047834713 8:128675953-128675975 TTGTATATGGTGAAAGGTAAAGG + Intergenic
1047855978 8:128913983-128914005 TTGTATATGTTGTTGGGAAAGGG - Intergenic
1048127910 8:131657594-131657616 TTCTATATGAAGAGAGCAAATGG - Intergenic
1048164355 8:132049083-132049105 TTGTTAATGAAGAGGGGAAAGGG + Intronic
1048260803 8:132943603-132943625 TTGGATTTTAAGAAGGGAGAAGG - Intronic
1049921057 9:364662-364684 TTTAATGTGTAGAAGGGAAAAGG + Intronic
1049943036 9:567015-567037 TTGTATATGATGTAAGGAAGGGG + Intronic
1050270775 9:3942379-3942401 TTGTATGTGGAGATGGGAACTGG - Intronic
1050403016 9:5276434-5276456 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1051011696 9:12423385-12423407 TTGTATAATAAGAAGAGATAGGG - Intergenic
1052005673 9:23345584-23345606 TTGTGTATGGTGAAGGGTAAGGG - Intergenic
1052263450 9:26544712-26544734 TTGTATTTGGTGAAAGGAAAGGG - Intergenic
1052281626 9:26739883-26739905 TTGTATATGGTGAAGGGAAGGGG - Intergenic
1052377760 9:27736921-27736943 TTGTATATGATGTAAGGAAGGGG + Intergenic
1052539239 9:29786710-29786732 TTGTATATGATGAAAGACAAGGG - Intergenic
1052586589 9:30436969-30436991 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1053632668 9:39960594-39960616 TTGTCTCTGAAGAAGAGACAGGG + Intergenic
1053773091 9:41502939-41502961 TTGTCTCTGAAGAAGAGACAGGG - Intergenic
1053885642 9:42643675-42643697 GGGTAGATGGAGAAGGGAAAGGG - Intergenic
1054211220 9:62290103-62290125 TTGTCTCTGAAGAAGAGACAGGG - Intergenic
1054224661 9:62451124-62451146 GGGTAGATGGAGAAGGGAAAGGG - Intergenic
1054313759 9:63558742-63558764 TTGTCTCTGAAGAAGAGACAGGG + Intergenic
1054840920 9:69738595-69738617 TGGGATATGAAAAAGGGACATGG - Intronic
1055076758 9:72223071-72223093 TTGTATATGATGTAAGGAAGAGG + Intronic
1055190289 9:73512042-73512064 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1055319631 9:75069750-75069772 TTCCATATGAAGAATGTAAAAGG - Exonic
1055396505 9:75880903-75880925 TTGAATTTGTAGAAAGGAAAAGG + Intergenic
1055763323 9:79633501-79633523 ATGTATCTGAGGAAGGGATATGG + Intronic
1056194146 9:84213066-84213088 TTGTATATTAGAAAGGGAAAGGG - Intergenic
1056678094 9:88693576-88693598 TTGTATATGATGTAAGGTAAAGG + Intergenic
1056887931 9:90461711-90461733 TTGTATAAGAAGTAAGGAAGGGG - Intergenic
1056975745 9:91251593-91251615 CTGTAAAAGAAAAAGGGAAAGGG + Intronic
1057061624 9:92009087-92009109 TTCTTTTTGAAGAAGAGAAAAGG + Intergenic
1057082679 9:92184913-92184935 TGAAATATGAAGAATGGAAAGGG + Intergenic
1057553113 9:96066660-96066682 TTGGAAATGGAGAAGAGAAATGG - Intergenic
1058000378 9:99858997-99859019 TTGTATATATAGATTGGAAAGGG - Intronic
1058095912 9:100860289-100860311 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1058215681 9:102230666-102230688 TTGAACATGATGAAGGGTAATGG - Intergenic
1058410210 9:104723609-104723631 AAGTAGATGAAGAAGGGAAGAGG - Intergenic
1059114295 9:111586985-111587007 TTGTATATTTAGTAGGGACAGGG + Intronic
1059221129 9:112619795-112619817 TTGCCTATAAAGAAGGTAAAAGG + Intronic
1059680972 9:116585636-116585658 TTGTATATGGTGAAAGGTAAGGG - Intronic
1059690830 9:116684747-116684769 TAGGGTATGAAGATGGGAAAAGG - Intronic
1059888736 9:118776834-118776856 TTTTATCTGGAGGAGGGAAAGGG + Intergenic
1060119171 9:120972175-120972197 ATTTACATGTAGAAGGGAAAGGG - Intronic
1060124987 9:121035084-121035106 TGGAAAAAGAAGAAGGGAAATGG - Intronic
1060328076 9:122637210-122637232 GTTGATTTGAAGAAGGGAAACGG + Intergenic
1060905655 9:127302662-127302684 TTGTTTCTGGAGAATGGAAATGG + Intronic
1061456705 9:130703677-130703699 TTTGATCTGAAAAAGGGAAAAGG - Exonic
1061520099 9:131112721-131112743 TTTTACATGAAGAAGAGAGAAGG + Intronic
1203752560 Un_GL000218v1:93725-93747 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1203462178 Un_GL000220v1:51452-51474 TTGTATGTGCACAAGTGAAAGGG - Intergenic
1203539227 Un_KI270743v1:71794-71816 TTGTAAATGAAGGAGCCAAATGG + Intergenic
1203555581 Un_KI270743v1:204726-204748 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1186365045 X:8883451-8883473 TTGTAAATGTAAAAGGAAAATGG - Intergenic
1186659284 X:11652298-11652320 TTGTATATGGTGAAAGGAAAGGG + Intronic
1186667060 X:11728022-11728044 TTGTATATGGAGAAAGGTATGGG + Intergenic
1187099434 X:16177813-16177835 TTATATATGAAAAGAGGAAACGG + Intergenic
1187303349 X:18073037-18073059 TTGTAGAGGAAAAAGGGAAAGGG + Intergenic
1187325604 X:18284234-18284256 TTGTATATGGTGAAAGGTAAGGG - Intronic
1187420693 X:19131128-19131150 GAGGATTTGAAGAAGGGAAAGGG - Intergenic
1187761704 X:22594326-22594348 GTCCATGTGAAGAAGGGAAAGGG - Intergenic
1187795886 X:23003901-23003923 TTGTATTTGTAGTAGGGACAGGG - Intergenic
1187804076 X:23099020-23099042 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1188091786 X:25973624-25973646 TTGTATATGGTGAAAGGTAATGG - Intergenic
1188270207 X:28129733-28129755 TTGTATATGGTGTAGGGAAGGGG - Intergenic
1188715468 X:33455106-33455128 TTGTATATGATGCAAGGAAGGGG - Intergenic
1188969304 X:36593767-36593789 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1189188841 X:39078279-39078301 TTGTATATGATGTAAGGAAGGGG + Intergenic
1190027853 X:46942383-46942405 TTGTATATGGTGAAAGGTAAGGG + Intronic
1190138728 X:47821140-47821162 TTTTAAATGAAGAAAAGAAATGG + Intergenic
1190241086 X:48658760-48658782 TTTTATTTGCAGAAGGTAAAAGG - Intergenic
1190783608 X:53622342-53622364 TTGTATGGGTAGAAGGGAACAGG - Intronic
1191072297 X:56413491-56413513 TTGTATATGATGACAGGAAGGGG + Intergenic
1191598277 X:62972599-62972621 TTGTATATGGTGTAAGGAAAAGG - Intergenic
1191822026 X:65320866-65320888 TTGTATATGATGTAAGGAAGGGG - Intergenic
1192355599 X:70400534-70400556 ATGAATATGCAGATGGGAAAAGG - Intronic
1192428158 X:71095554-71095576 TCCTAAATGAAGGAGGGAAAGGG + Intergenic
1192837607 X:74818441-74818463 TTGTATATGGTGAAAGGAAGAGG - Intronic
1192942194 X:75924504-75924526 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1192970505 X:76223538-76223560 TTGTATGTTTAGAAGAGAAAGGG - Intergenic
1193440090 X:81529936-81529958 TTGTATATGATGAAATGTAAGGG + Intergenic
1193455029 X:81721098-81721120 ATTTATATCAAGAAGGCAAAAGG + Intergenic
1193463748 X:81821659-81821681 TTGTATATGATGTAAGGAAAAGG - Intergenic
1193483090 X:82051729-82051751 TTGTGTATGATGTAAGGAAAGGG - Intergenic
1193880322 X:86913071-86913093 TTGTGTATGATGAAAGGAAAAGG + Intergenic
1194012475 X:88579810-88579832 TTGTATATGGAGAAAGGTAGGGG - Intergenic
1194077452 X:89414484-89414506 TTGCATATGGTGAATGGAAAGGG - Intergenic
1194199748 X:90940098-90940120 TTGTATATGCAGTAAGGAAGGGG + Intergenic
1194238365 X:91412782-91412804 TTGTATATGATGTAAGGAAAGGG - Intergenic
1194484125 X:94466054-94466076 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1194619026 X:96145659-96145681 TTGAATATGATGAAAGGAAGGGG - Intergenic
1194642922 X:96425008-96425030 TTGTATATTAACAAGGTTAAGGG - Intergenic
1194851181 X:98871168-98871190 TTATATATGATGTAGGGAAAGGG + Intergenic
1195048414 X:101075909-101075931 TAGGCTATGAAGATGGGAAAAGG - Intergenic
1195213675 X:102675318-102675340 TTGTATATGATGTAAGGAAGGGG + Intergenic
1195276839 X:103289449-103289471 TTGTATATGGTGAAAGGCAATGG + Intergenic
1195473026 X:105254726-105254748 TTGTATATGATGTAAGGAAGGGG + Intronic
1195534534 X:105996425-105996447 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1195544023 X:106094957-106094979 TTGTATATGGTGAAAGGAAAGGG + Intergenic
1195548837 X:106143564-106143586 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1196052194 X:111317394-111317416 TTGTATATGGTGTAAGGAAAGGG - Intronic
1196541458 X:116913909-116913931 TTATATATTAAAAAGGAAAATGG - Intergenic
1196985872 X:121270108-121270130 TTGTATAAGATGTAAGGAAAAGG - Intergenic
1197107182 X:122730721-122730743 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1197166695 X:123385171-123385193 TTGTATATGGTGAAAGGAAGGGG + Intronic
1197309760 X:124890160-124890182 TTGTTTATCAAGAAGCTAAATGG - Intronic
1197392731 X:125887576-125887598 TTGTATATGGTGAAAGGTAAGGG + Intergenic
1197536462 X:127694590-127694612 TTTTATAAAAAGAAGGGTAAGGG - Intergenic
1197635192 X:128906656-128906678 TTGTATTTGAGGGAGGCAAAGGG - Intergenic
1197688921 X:129476376-129476398 CTGAATATGAGGGAGGGAAAGGG + Intronic
1198068522 X:133124374-133124396 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1198109544 X:133490839-133490861 TTGTATATGATGAAAGATAAGGG + Intergenic
1198440626 X:136659798-136659820 GTGAAGATGCAGAAGGGAAATGG + Exonic
1198509956 X:137340586-137340608 TTGTCTGTGAAGAGGGGAAGAGG + Intergenic
1198510098 X:137341767-137341789 TTGTCTGTGAAGAGGGGAAGAGG - Intergenic
1198580057 X:138053626-138053648 TTGTATATGTTGAAAGGAAAGGG - Intergenic
1198642017 X:138766839-138766861 TTGTATATGGTGAAGGGTAGTGG + Intronic
1198796441 X:140401480-140401502 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1198885287 X:141328652-141328674 TTGTATATGGCGTAAGGAAAGGG - Intergenic
1199015696 X:142812276-142812298 TTGTATATGGTGAATGGTAAGGG - Intergenic
1199367483 X:147003936-147003958 TTGTATATGATGAAAGGTAAGGG + Intergenic
1199554860 X:149095810-149095832 TTGCATATGATGAAAGGTAAAGG + Intergenic
1199834586 X:151576038-151576060 TTGTATTTTTAGAAGGGATAGGG + Intronic
1199857266 X:151770051-151770073 TTGTATATGATGTAAGGAAGGGG - Intergenic
1200430102 Y:3070023-3070045 TTGCATATGGTGAATGGAAAGGG - Intergenic
1200545739 Y:4516514-4516536 TTGTATATGCAGTAAGGAAGGGG + Intergenic
1200825153 Y:7630104-7630126 TTGTAAATGAAGGAGCCAAATGG + Intergenic
1201166209 Y:11211337-11211359 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1201416020 Y:13750430-13750452 GTGTATAAGAATAGGGGAAAGGG + Intergenic
1202074133 Y:21021551-21021573 TTGTAAATGAAGGAGCCAAATGG + Intergenic
1202078833 Y:21063406-21063428 TTGTAAATGAAGGAGCCAAATGG + Intergenic
1202234902 Y:22700982-22701004 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1202308257 Y:23495186-23495208 TTGTAAATGAAGGAGCCAAATGG + Intergenic
1202338326 Y:23833079-23833101 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1202532440 Y:25836992-25837014 TTGTAAATGAAGGAGCCAAATGG + Intergenic
1202562544 Y:26175400-26175422 TTGTAAATGAAGGAGCCAAATGG - Intergenic
1202599953 Y:26583259-26583281 TTGTATATGATGAAAGGTATGGG + Intergenic