ID: 1042808778

View in Genome Browser
Species Human (GRCh38)
Location 8:72801085-72801107
Sequence GCATTATGTTCCCTGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042808778_1042808786 10 Left 1042808778 8:72801085-72801107 CCCCACTCCAGGGAACATAATGC No data
Right 1042808786 8:72801118-72801140 CCTGTTAGACCTTGAGAGGATGG No data
1042808778_1042808782 6 Left 1042808778 8:72801085-72801107 CCCCACTCCAGGGAACATAATGC No data
Right 1042808782 8:72801114-72801136 AACCCCTGTTAGACCTTGAGAGG No data
1042808778_1042808789 13 Left 1042808778 8:72801085-72801107 CCCCACTCCAGGGAACATAATGC No data
Right 1042808789 8:72801121-72801143 GTTAGACCTTGAGAGGATGGGGG No data
1042808778_1042808787 11 Left 1042808778 8:72801085-72801107 CCCCACTCCAGGGAACATAATGC No data
Right 1042808787 8:72801119-72801141 CTGTTAGACCTTGAGAGGATGGG No data
1042808778_1042808788 12 Left 1042808778 8:72801085-72801107 CCCCACTCCAGGGAACATAATGC No data
Right 1042808788 8:72801120-72801142 TGTTAGACCTTGAGAGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042808778 Original CRISPR GCATTATGTTCCCTGGAGTG GGG (reversed) Intronic