ID: 1042811502

View in Genome Browser
Species Human (GRCh38)
Location 8:72830483-72830505
Sequence AAGCAGTTCTTACATGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042811502 Original CRISPR AAGCAGTTCTTACATGAATA AGG (reversed) Intronic
900893106 1:5463856-5463878 AAGCACTTCTTACATGACATCGG + Intergenic
903159871 1:21479293-21479315 AAGCAGTTCTTCCTTGCACACGG - Intronic
903796466 1:25932563-25932585 AGGAAGTGCTTATATGAATAAGG - Intergenic
904571892 1:31472524-31472546 AAGCACTTCTTACATGGCGACGG + Intergenic
904922305 1:34018105-34018127 AAGTAGGTCTTATATGAACAGGG - Intronic
910679683 1:89849717-89849739 AAGAAGTTCTTGCAAGAAAAAGG - Intronic
910736842 1:90467976-90467998 AAACAATTCTAAAATGAATATGG + Intergenic
910824050 1:91386954-91386976 AAGTAGTTCTTACATTGAAATGG - Intronic
911191149 1:94949657-94949679 AAAGTGTTCTTAAATGAATAAGG - Intergenic
914211079 1:145579681-145579703 AAGCAGTTCTTCCTTGCACACGG + Intergenic
914224252 1:145707304-145707326 GAGCAGTTCTTACCTGGAGATGG + Exonic
916657656 1:166891368-166891390 AAGCAGTTCTCAACTGAAGATGG + Intergenic
917218625 1:172703965-172703987 GAGCAGATGTTTCATGAATAGGG + Intergenic
918213545 1:182373338-182373360 AAGCAGTTCATAAATGGAAAGGG + Intergenic
918827477 1:189343993-189344015 ATGTAGTTCTTAAATTAATATGG + Intergenic
918849851 1:189673123-189673145 CATCAGTTATTACATGAAAAAGG - Intergenic
919240607 1:194911447-194911469 AAGGAGTTGTTAAAGGAATATGG - Intergenic
920316334 1:205077968-205077990 AGGCAGTTCTTAAATAAAGATGG + Exonic
921632050 1:217446440-217446462 AACCATTTCTTACTTGAATTTGG + Intronic
922062878 1:222108420-222108442 AAGCAGTTCTTACAGGAACTGGG - Intergenic
1063585814 10:7351254-7351276 CAGCAGTTGTTAAATGAATAAGG - Intronic
1067945125 10:50684397-50684419 AAGCAATTCTTCCAGGAATTGGG - Intergenic
1069069743 10:63981042-63981064 AGGCACTTCTTACATGACGATGG - Intergenic
1070017184 10:72544883-72544905 AAGCAGTTTTAAAATGAATAGGG - Intronic
1070866630 10:79711269-79711291 AAGCAATTCTTCCAGGAATTGGG - Exonic
1070880419 10:79849390-79849412 AAGCAATTCTTCCAGGAATTGGG - Exonic
1071633542 10:87233492-87233514 AAGCAATTCTTCCAGGAATTGGG - Exonic
1071646989 10:87365708-87365730 AAGCAATTCTTCCAGGAATTGGG - Exonic
1072269674 10:93763977-93763999 AAGCAGTACTTAAATCAAAAAGG - Intronic
1073591352 10:104760371-104760393 AAGCAATTCTTAGATAAATGAGG - Intronic
1073847277 10:107571418-107571440 AAGAAGTCATTACATGAAAAAGG + Intergenic
1076270274 10:129146723-129146745 AAGCAGGTCTGATATGAAAATGG - Intergenic
1081221225 11:40464958-40464980 AAACAGTTCTAAAATTAATATGG + Intronic
1083318757 11:61832452-61832474 AAGCAGTTCTGAGATGAAAGTGG + Intronic
1086045658 11:82528276-82528298 ACGCAGTTCTCACATAGATAAGG + Intergenic
1086843887 11:91723557-91723579 AACCAAGTCTCACATGAATATGG + Intergenic
1086847283 11:91767074-91767096 AATCTGTTCTTACATGCAAATGG + Intergenic
1088967060 11:114734168-114734190 TAGCATTTCTTCCATAAATATGG + Intergenic
1089203799 11:116741801-116741823 AAGCAGTTCTTCCAGGACTGGGG + Intergenic
1095382158 12:41608139-41608161 AAGAAATTCTTAAATGAGTACGG - Intergenic
1097947629 12:65389426-65389448 AAGGAGTTCTTACATGAGAAAGG - Intronic
1098028846 12:66234034-66234056 AAGGTGTTCTTACATGAAGAAGG - Intronic
1098224302 12:68305892-68305914 AAGCAGTTCTAAAATTCATAAGG + Intronic
1099455661 12:82859638-82859660 AAGCAGCTGTTACATGAATAAGG - Intronic
1099463759 12:82956877-82956899 AAGTACTTGTTTCATGAATATGG - Intronic
1099779959 12:87182152-87182174 AAGCACTTCTTACATGGTGATGG - Intergenic
1100696511 12:97099590-97099612 AGGCAGTTATGACATGACTAAGG - Intergenic
1103862098 12:124023768-124023790 ATGCAGTTCCTACATGCAGACGG - Intronic
1105704248 13:22959860-22959882 ATGCAGTTCCTCCATGAATCAGG + Intergenic
1105857199 13:24384912-24384934 ATGCAGTTCCTCCATGAATCAGG + Intergenic
1106703850 13:32259382-32259404 AAGCTGTTCTTGGAGGAATAAGG - Intronic
1108618183 13:52156392-52156414 AAACAATTCTTACATGAAAGTGG - Intronic
1109952067 13:69511880-69511902 AAGCACTTCTTACATGATGGCGG - Intergenic
1109959957 13:69616838-69616860 AAGCAGTGCTTACATTTACAGGG + Intergenic
1110331801 13:74281471-74281493 AACCAGTTCTTAGAGAAATAGGG + Intergenic
1110444291 13:75560463-75560485 AAGCAGATTTTCTATGAATAGGG - Intronic
1110662296 13:78071472-78071494 AAGCAGTTTTTAAAAGAATAAGG + Intergenic
1110976644 13:81844598-81844620 ATGGTGTTTTTACATGAATAAGG - Intergenic
1111043497 13:82783546-82783568 ATGCAGTTTTTATATGGATACGG - Intergenic
1111497549 13:89071703-89071725 AAGCAATTCTGACATGAAACAGG + Intergenic
1111539202 13:89649587-89649609 AGGCAGTTCTTACATGGTAATGG + Intergenic
1111902342 13:94214666-94214688 AAACAGTTCTTCCATCAATACGG - Intronic
1113090317 13:106611223-106611245 AAGCAGTACATACATGAAAAAGG + Intergenic
1114419826 14:22572169-22572191 TAGCTGATCTTACATGAATTTGG - Intronic
1114465858 14:22922163-22922185 AAGCAGTTCCTACCTTAATAGGG + Exonic
1114714670 14:24812636-24812658 CAGCAGTTTTTACAAGAATTCGG - Exonic
1115103280 14:29728977-29728999 AAGCATTTCTAAAATGTATATGG - Intronic
1118659491 14:67992320-67992342 AACCAATTGTTACATGAAGATGG + Intronic
1119357037 14:74016274-74016296 AAGCTGTTGTGACATGAATATGG - Intronic
1122451033 14:101807717-101807739 AAGAACTACTTACATGCATAGGG + Intronic
1125367744 15:38937056-38937078 TACCAGTCCTTACAAGAATACGG + Intergenic
1127817719 15:62626443-62626465 AAGCACTACTGACTTGAATATGG + Intronic
1128171186 15:65514923-65514945 AACCAGTGCTTGCAAGAATAGGG + Intronic
1128856926 15:71025861-71025883 AAGAAGTTGTTTCATGAATCTGG - Intronic
1130678181 15:85973010-85973032 AAACAGTTGTTATCTGAATAGGG + Intergenic
1131275729 15:90978929-90978951 AGGCATTTCTTGCATGAATGAGG - Intronic
1131574645 15:93574901-93574923 AAGCTGTGCTTACAGGAAAATGG - Intergenic
1133888503 16:9854827-9854849 CAGCAGTGCTTCCAGGAATAAGG + Intronic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1134597543 16:15508014-15508036 AGGTAGTTCTTACATGAATATGG + Intronic
1137255013 16:46767829-46767851 GAGCAGATCATACATAAATATGG - Intronic
1137426148 16:48382869-48382891 AAACAGATCTTACATAACTAGGG - Intronic
1137744410 16:50810233-50810255 ATGAAGTTCTCACAAGAATAAGG - Intergenic
1137973181 16:53006025-53006047 AAAAAGTTCTTACATCACTAAGG - Intergenic
1143172500 17:4938338-4938360 AAGCAGTTCTTACTGGACTCAGG - Exonic
1145762263 17:27432069-27432091 ATGCAGTAATTATATGAATAGGG + Intergenic
1146893413 17:36523655-36523677 AAGCAGTATTTACATGGTTATGG - Intronic
1152731590 17:81974475-81974497 AAAAAGTTTTTACATGTATATGG + Intergenic
1153432417 18:5032293-5032315 AAGCAGAGCTTTCGTGAATATGG + Intergenic
1153531057 18:6046243-6046265 AAGTAGTTGTTTCATGAATCTGG - Intronic
1155504741 18:26522205-26522227 AAGGAGGTCATACAAGAATAGGG + Intronic
1156203682 18:34862359-34862381 AAGCAATCCTTACAAGAGTAAGG - Intronic
1156429209 18:37052986-37053008 AAGCAGTTCTAAAATTCATATGG + Intronic
1156562721 18:38146825-38146847 AAGCAGTATTTCAATGAATAAGG - Intergenic
1157129260 18:44988835-44988857 AGACAGTTCTCATATGAATAGGG + Intronic
1159079459 18:63721187-63721209 AAGCTATTCTTACATGAGAAAGG + Intronic
1160263636 18:77319243-77319265 AAGAAGTTCTTAAATGAAAGAGG - Intergenic
1164766167 19:30773100-30773122 AAGCAGTGTGTACATGAATCTGG - Intergenic
1168012869 19:53547709-53547731 AAGCCATTCTTACATGTATGAGG + Intronic
1168363355 19:55762365-55762387 AGGCATTTCTAATATGAATAAGG + Intronic
1168364309 19:55772369-55772391 AGGCATTTCTAATATGAATAAGG + Intronic
1168553125 19:57316049-57316071 AAGAACTTGTTTCATGAATATGG + Intergenic
925951167 2:8912836-8912858 AAGCAGTTCTAAAATTCATATGG + Intronic
926975186 2:18508385-18508407 AAGTAGTTTTTAAATGTATATGG - Intergenic
928799516 2:35069985-35070007 AAGTAGTTCTTTTATGAATCTGG - Intergenic
935540649 2:104344386-104344408 AGACATTTCTTTCATGAATAGGG - Intergenic
937547008 2:123035469-123035491 AAGCACTTCTTACATGATGGTGG + Intergenic
938853579 2:135286601-135286623 TAGCCATTCTTACAGGAATAAGG + Intronic
941008789 2:160274733-160274755 AAGGTGTTCTTACATGAAGAAGG - Exonic
941024828 2:160446978-160447000 AAGCATTAGTTACATGAAGAAGG - Intronic
942330870 2:174822519-174822541 AAGCTTTTCTTTCATGAGTAAGG - Intronic
942756585 2:179348326-179348348 AAGCAATTCTTTCATGAGTGAGG + Intergenic
943359773 2:186903466-186903488 AAGGAATTCTTAGATGAATTAGG - Intergenic
943535725 2:189147592-189147614 AAGATGTTCTAACATGCATAAGG + Intronic
944888597 2:204092163-204092185 TAGCAATTCTGACATGTATAAGG + Intergenic
946356887 2:219192230-219192252 AATCAGTTCCTACATCAATGCGG - Intergenic
946741761 2:222809406-222809428 AAAAAGTTCTTATATGAGTAAGG + Intergenic
946835573 2:223769122-223769144 AAGCAGTTCCTTTATGGATATGG + Intronic
947957571 2:234206708-234206730 AAACAGTTCTTAAAAGAATATGG - Intergenic
1170304765 20:14926239-14926261 AAGCAGTTTTTAAAAAAATAGGG + Intronic
1173110091 20:40178862-40178884 AAGAAGTTCTTTAATGTATAAGG - Intergenic
1181659433 22:24332569-24332591 AAGCAAGTCTTACATAGATAAGG - Intronic
1182595070 22:31413038-31413060 TAGCAGTCCTTCCATAAATAAGG - Intronic
950694583 3:14688730-14688752 AAGTAGCTCTTATATGAAGATGG - Intronic
952523046 3:34181502-34181524 AAGAATTGCTTACATGATTATGG + Intergenic
952706804 3:36386234-36386256 TAGCAGTTTTTACATGTTTATGG + Intronic
954919617 3:54178747-54178769 AAGCAGTTTTAAAATAAATAAGG + Intronic
959661809 3:108877344-108877366 AAGCAGTTTTTCCCTGAGTATGG + Intergenic
959909357 3:111746419-111746441 ATACAAATCTTACATGAATAGGG + Intronic
961064204 3:123860819-123860841 AACCAGTTTTTACCTAAATATGG - Intronic
961136382 3:124515269-124515291 AAGGAGTCTGTACATGAATAGGG + Intronic
961945531 3:130682953-130682975 AAGAAGATATTACATTAATAGGG + Intronic
962060534 3:131922377-131922399 AACCAGTTCTGGCATGAAGAAGG - Intronic
963861711 3:150317520-150317542 AACCATTTTTTACATGAATTTGG + Intergenic
963891794 3:150644282-150644304 AAGCAGTTCTAAAATTCATAAGG + Intergenic
963960983 3:151308829-151308851 AAGCTGTGATTACAAGAATAAGG - Intronic
965254672 3:166390631-166390653 AAGAAGTTGTTATATGAAAATGG - Intergenic
966420834 3:179732751-179732773 AAGTAGTTCTTATATGAGCAAGG + Intronic
967771891 3:193343051-193343073 AAGCAGATTTTACATTAAAATGG - Intronic
973989166 4:56386847-56386869 AAGCAGATTTTACATGTAAAAGG + Intronic
977687885 4:99870294-99870316 AAGGAGTTCTTAGTTGAATATGG + Intergenic
979384032 4:120042651-120042673 AAGTAATTATTACATGACTAAGG - Intergenic
979883532 4:125993600-125993622 AAGCAGTTAGGACAAGAATATGG - Intergenic
980505050 4:133708036-133708058 AACCAATTCTTACATTTATATGG - Intergenic
981082603 4:140650042-140650064 AAACAGTTGTCACATAAATATGG + Intronic
982206741 4:153002152-153002174 AAGAAGTTCTTAAATGTTTAAGG + Intergenic
985202868 4:187502445-187502467 AAGCAGATCTTAGAAGAAGATGG + Intergenic
987164386 5:15179485-15179507 AAGCTGTCCTTACATGCATGTGG - Intergenic
988023031 5:25648504-25648526 AAACAGTTATTCCATAAATAAGG + Intergenic
988228457 5:28445154-28445176 AAGCAGTTCTTTCAATCATATGG - Intergenic
988636037 5:32986019-32986041 AAGAAGTCATTACATGAAAAAGG + Intergenic
989593773 5:43136389-43136411 AAGCAGTTCTAAAATTCATATGG + Intronic
990534431 5:56705998-56706020 AAGTAATGCTTACATTAATAAGG + Intergenic
990716305 5:58641020-58641042 AAGCAGTTCATTTATGAACATGG - Intronic
991434981 5:66588550-66588572 AAGCAATGCTTGCATGAATATGG - Intergenic
994134613 5:96271244-96271266 AAACAGTTCTAAAATGTATATGG + Intergenic
994599421 5:101883450-101883472 TAGTAGTTTTTACATGTATATGG - Intergenic
995737609 5:115319001-115319023 ATGCAGTTCATACATGTAAAAGG - Intergenic
995968527 5:117939289-117939311 AACCAGTTCAGACATGATTAAGG + Intergenic
996699945 5:126440275-126440297 AAGTATTTCTTAAATGTATAAGG + Intronic
1001824062 5:174732065-174732087 ACGCAATCCTTAAATGAATATGG - Intergenic
1002249295 5:177914750-177914772 AAGTATTTCTTTCATGAATCAGG + Intergenic
1003151230 6:3550933-3550955 AAGCAGTCACTACATAAATAGGG - Intergenic
1005631270 6:27710508-27710530 AAGCATTTGTTAAATGAATAAGG + Intergenic
1007352145 6:41281797-41281819 AAGCAGTTCTGAAATGAATAGGG + Intronic
1008518113 6:52337331-52337353 AAGCATTTGTTAAATGAATGAGG - Intergenic
1010056178 6:71568009-71568031 AAACACATCTTCCATGAATAAGG + Intergenic
1010163919 6:72893153-72893175 CAGCAGTCCTTACATCAAAAAGG - Intronic
1011211780 6:84963453-84963475 AAGAAATGCTTACTTGAATAAGG + Intergenic
1012503501 6:99917086-99917108 TCTCAGTTCTTACATGAAAAAGG + Intergenic
1012851527 6:104452220-104452242 AAGCACCTTTGACATGAATATGG + Intergenic
1013153434 6:107469508-107469530 CAGCATTTATTACATGTATATGG + Intergenic
1013913169 6:115302848-115302870 AAGCAATCCTTAAATTAATATGG - Intergenic
1016582070 6:145639542-145639564 AAGCTTCTCTTACATGCATATGG - Intronic
1018289740 6:162279827-162279849 AAGAAGTTGTTTTATGAATATGG + Intronic
1022235503 7:28456717-28456739 AAGCAGGTCTTCCTTAAATATGG + Intronic
1022359955 7:29648436-29648458 AGTCAGTTCTTACATGCATTTGG - Intergenic
1022368763 7:29751104-29751126 AGTCAGTTCTTACATGCATTTGG - Intergenic
1022794358 7:33720051-33720073 CAGAAGTTCTTACATGGACAAGG - Intergenic
1024247078 7:47478867-47478889 ATGTAGTTGTTACATGTATATGG - Intronic
1024570417 7:50718382-50718404 AAGCAGTTCATAGGTGGATAAGG - Intronic
1024876858 7:54036154-54036176 ATTAAATTCTTACATGAATATGG + Intergenic
1025061756 7:55814797-55814819 AAGCAATTCTAAGATGTATATGG + Intronic
1026675013 7:72420945-72420967 AAGAAGTTATTATATGAAAAAGG - Intronic
1027219717 7:76206252-76206274 AAGCTGTTCTTGCATGGATGTGG - Intronic
1027757814 7:82237513-82237535 AAGAAGTACTTAAACGAATAAGG - Intronic
1027837331 7:83262155-83262177 AAGTATTTCTTACAAGAATAGGG - Intergenic
1028037335 7:86001575-86001597 AAGCAATTCTTACAAGTCTAGGG + Intergenic
1028490143 7:91402023-91402045 AAGAAGTCATTACATGAAAAAGG - Intergenic
1029039735 7:97560019-97560041 AAGAACTTCTTTCATGAATCTGG - Intergenic
1030617815 7:111756793-111756815 AAGCTGTGCTGAGATGAATAGGG + Intronic
1031037363 7:116802306-116802328 AAGCAATTCTGAGATGAAAATGG + Intergenic
1031481723 7:122285589-122285611 AAGCATTTTTCACATGTATATGG + Intergenic
1031735063 7:125348781-125348803 AAGCAGTTATTACCTGAAATAGG + Intergenic
1033861375 7:145632099-145632121 AAGAAGTTATTACATAAAAAAGG - Intergenic
1034586835 7:152101457-152101479 AACAAGTCCTTACATGAGTAAGG + Intronic
1034787732 7:153940800-153940822 ATTCAGATCTTACATGAATTGGG - Intronic
1035943460 8:3930775-3930797 AAGCATTTCTAACATGTACAAGG + Intronic
1037374768 8:18215997-18216019 ACCCAGCTCTTACATGAAAACGG - Intronic
1039322960 8:36452991-36453013 AAGCAGTTTTTTCATAAATAAGG - Intergenic
1042435827 8:68763755-68763777 AAACAGTTCTTGAATGAATGAGG - Intronic
1042811502 8:72830483-72830505 AAGCAGTTCTTACATGAATAAGG - Intronic
1043252023 8:78086898-78086920 CAGCTATTCTTACAGGAATAAGG + Intergenic
1044313500 8:90723716-90723738 AAGCAGTATTTATCTGAATAGGG - Intronic
1045534062 8:103010609-103010631 AGGCAGTTCCTCCATAAATAAGG - Intergenic
1045613515 8:103877033-103877055 AAGAAGTTCTTATACGAAAAAGG - Intronic
1048141995 8:131803759-131803781 CAGAAGTTCTTAGCTGAATATGG + Intergenic
1049870442 8:144970896-144970918 AAAAACTTCTTACATGAATTGGG + Intergenic
1051330307 9:16018499-16018521 AAGAAGTTAATAAATGAATAAGG - Intronic
1051705826 9:19878681-19878703 AAGCAGGTCTTACATGGCCAGGG - Intergenic
1051803592 9:20965105-20965127 AAGCAGTTATTTCAGGAATGAGG + Intronic
1053381675 9:37654187-37654209 AAGAAGTCATTACATAAATAAGG + Intronic
1053485158 9:38447572-38447594 AAACAATTCTAACATGTATATGG - Intergenic
1057353816 9:94319688-94319710 AAGCAATTCTTCCAGGAATCGGG + Exonic
1057653935 9:96937904-96937926 AAGCAATTCTTCCAGGAATCGGG - Exonic
1058312972 9:103529161-103529183 AATCAGGTCTTTCAGGAATACGG - Intergenic
1060071234 9:120549738-120549760 AAGCAGTTTATACGTGAGTATGG - Intronic
1186131526 X:6471225-6471247 AAGTGGTTATTCCATGAATATGG - Intergenic
1187979171 X:24736539-24736561 ATGGAATTCTGACATGAATATGG + Intronic
1188720095 X:33511771-33511793 AAACATTTCTTAAATGAAAATGG - Intergenic
1191945284 X:66527447-66527469 AAGCAATTCTAAAATTAATATGG + Intergenic
1193149729 X:78112665-78112687 AAACACTTCTTATATGACTATGG - Intronic
1193666451 X:84324912-84324934 ATGCAGATTTTAAATGAATAGGG - Intronic
1194566292 X:95493425-95493447 AAGCGCTTCTTACATGGATGCGG - Intergenic
1194851386 X:98874032-98874054 AAGAACTTGTTTCATGAATATGG + Intergenic
1194864791 X:99052961-99052983 AAGCACTTCTTACATGGAGGTGG - Intergenic
1195178325 X:102332385-102332407 AAGCAAGGCTTACATGAAAACGG + Intergenic
1195180539 X:102354706-102354728 AAGCAAGGCTTACATGAAAACGG - Intergenic
1196670340 X:118359465-118359487 AAGCTGTTCTTTTAGGAATATGG + Intronic
1198177364 X:134170198-134170220 AAGCACTTCTTACATTACCATGG - Intergenic
1198734481 X:139771260-139771282 AGGCACTTCTTACATGGCTACGG - Intronic