ID: 1042811522

View in Genome Browser
Species Human (GRCh38)
Location 8:72830672-72830694
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042811520_1042811522 -6 Left 1042811520 8:72830655-72830677 CCATCTGTGTACTTGATCATGCT 0: 1
1: 0
2: 1
3: 12
4: 186
Right 1042811522 8:72830672-72830694 CATGCTTCTGGCTCATCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr