ID: 1042816754 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:72886555-72886577 |
Sequence | CTTTCTGAGCAGAGTGTAGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 5418 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 78, 4: 5338} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1042816754_1042816757 | 8 | Left | 1042816754 | 8:72886555-72886577 | CCATCTACACTCTGCTCAGAAAG | 0: 1 1: 0 2: 1 3: 78 4: 5338 |
||
Right | 1042816757 | 8:72886586-72886608 | TCTCCAAGTCATGTTCCTTGGGG | No data | ||||
1042816754_1042816755 | 6 | Left | 1042816754 | 8:72886555-72886577 | CCATCTACACTCTGCTCAGAAAG | 0: 1 1: 0 2: 1 3: 78 4: 5338 |
||
Right | 1042816755 | 8:72886584-72886606 | TTTCTCCAAGTCATGTTCCTTGG | No data | ||||
1042816754_1042816756 | 7 | Left | 1042816754 | 8:72886555-72886577 | CCATCTACACTCTGCTCAGAAAG | 0: 1 1: 0 2: 1 3: 78 4: 5338 |
||
Right | 1042816756 | 8:72886585-72886607 | TTCTCCAAGTCATGTTCCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1042816754 | Original CRISPR | CTTTCTGAGCAGAGTGTAGA TGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |