ID: 1042816754

View in Genome Browser
Species Human (GRCh38)
Location 8:72886555-72886577
Sequence CTTTCTGAGCAGAGTGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5418
Summary {0: 1, 1: 0, 2: 1, 3: 78, 4: 5338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042816754_1042816757 8 Left 1042816754 8:72886555-72886577 CCATCTACACTCTGCTCAGAAAG 0: 1
1: 0
2: 1
3: 78
4: 5338
Right 1042816757 8:72886586-72886608 TCTCCAAGTCATGTTCCTTGGGG No data
1042816754_1042816755 6 Left 1042816754 8:72886555-72886577 CCATCTACACTCTGCTCAGAAAG 0: 1
1: 0
2: 1
3: 78
4: 5338
Right 1042816755 8:72886584-72886606 TTTCTCCAAGTCATGTTCCTTGG No data
1042816754_1042816756 7 Left 1042816754 8:72886555-72886577 CCATCTACACTCTGCTCAGAAAG 0: 1
1: 0
2: 1
3: 78
4: 5338
Right 1042816756 8:72886585-72886607 TTCTCCAAGTCATGTTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042816754 Original CRISPR CTTTCTGAGCAGAGTGTAGA TGG (reversed) Intronic
Too many off-targets to display for this crispr