ID: 1042821769

View in Genome Browser
Species Human (GRCh38)
Location 8:72937274-72937296
Sequence CAGAAGAGCACCAAAGAGCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 220}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042821757_1042821769 26 Left 1042821757 8:72937225-72937247 CCCTCCGCCTCTCACTTGCAGAT 0: 1
1: 0
2: 0
3: 8
4: 158
Right 1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG 0: 1
1: 0
2: 0
3: 22
4: 220
1042821760_1042821769 19 Left 1042821760 8:72937232-72937254 CCTCTCACTTGCAGATGAAGTTC 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG 0: 1
1: 0
2: 0
3: 22
4: 220
1042821763_1042821769 -3 Left 1042821763 8:72937254-72937276 CCCAACCGACCTCCCAGGGACAG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG 0: 1
1: 0
2: 0
3: 22
4: 220
1042821758_1042821769 25 Left 1042821758 8:72937226-72937248 CCTCCGCCTCTCACTTGCAGATG 0: 1
1: 0
2: 1
3: 17
4: 257
Right 1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG 0: 1
1: 0
2: 0
3: 22
4: 220
1042821756_1042821769 29 Left 1042821756 8:72937222-72937244 CCGCCCTCCGCCTCTCACTTGCA 0: 1
1: 0
2: 4
3: 47
4: 506
Right 1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG 0: 1
1: 0
2: 0
3: 22
4: 220
1042821764_1042821769 -4 Left 1042821764 8:72937255-72937277 CCAACCGACCTCCCAGGGACAGA 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG 0: 1
1: 0
2: 0
3: 22
4: 220
1042821759_1042821769 22 Left 1042821759 8:72937229-72937251 CCGCCTCTCACTTGCAGATGAAG 0: 1
1: 0
2: 1
3: 20
4: 211
Right 1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG 0: 1
1: 0
2: 0
3: 22
4: 220
1042821765_1042821769 -8 Left 1042821765 8:72937259-72937281 CCGACCTCCCAGGGACAGAAGAG 0: 1
1: 0
2: 9
3: 44
4: 485
Right 1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG 0: 1
1: 0
2: 0
3: 22
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042821769 Original CRISPR CAGAAGAGCACCAAAGAGCT AGG Exonic
903217139 1:21849429-21849451 CAGAGGAGCCCCAGTGAGCTGGG + Intronic
903217378 1:21850667-21850689 CAGAGGAGCCCCAGTGAGCTGGG + Intronic
904387484 1:30153169-30153191 GAGAACAGCACCAAAGGGATGGG - Intergenic
904549425 1:31303140-31303162 CAGAAACACACCAACGAGCTTGG - Intronic
905410617 1:37765566-37765588 CAGGAGAGCTCCCCAGAGCTTGG - Intergenic
905800613 1:40839979-40840001 CAGAAGAGGAGCAAAGGGGTGGG - Exonic
907707565 1:56845866-56845888 CAGTAAGGCACCAAAGAGCATGG - Intergenic
907811375 1:57874001-57874023 CAGATGAAGACCAGAGAGCTTGG + Intronic
910165761 1:84325835-84325857 AGGAAGAGGACCAAAGAGCAGGG + Intronic
910884824 1:91953282-91953304 CAGCATAGAACTAAAGAGCTTGG - Intronic
911383923 1:97150640-97150662 CAAAAGAGGACCTCAGAGCTAGG + Intronic
913425156 1:118720536-118720558 CAGGAGTGCACCAAAAAGCCAGG - Intergenic
916881093 1:169019962-169019984 CAAAAGAGCAGCAAAGAGAAGGG + Intergenic
918934170 1:190898900-190898922 AAGAAGTGCCCCAAAGTGCTGGG - Intergenic
919814988 1:201431567-201431589 CTGATGAGCAGCAAAGAGATGGG - Intergenic
920956247 1:210622541-210622563 GAGAAGTGCAATAAAGAGCTAGG + Intronic
921512248 1:216046532-216046554 CAGGAGAGCAGCAAAGAACTGGG + Exonic
923183443 1:231546787-231546809 CAGCAGAGCCCCAGAGAGCATGG - Intronic
924298362 1:242611897-242611919 CAGGGGTGCAGCAAAGAGCTGGG - Intergenic
1064293530 10:14056777-14056799 CAAAGAAGCAGCAAAGAGCTTGG - Intronic
1067384419 10:45805615-45805637 GAAAGGATCACCAAAGAGCTGGG - Intergenic
1067892112 10:50146176-50146198 GAAAAGATCACCAAAGAGCTGGG - Intergenic
1068778895 10:60898394-60898416 CAAAACAGCACAAAACAGCTGGG + Intronic
1069349784 10:67511562-67511584 CAGCAGCGCATCAAAAAGCTTGG - Intronic
1070750313 10:78960201-78960223 CAAAAGGGCACCACAGAGCTGGG - Intergenic
1071095902 10:81974465-81974487 AAGCAGAGCAACAAAGAGATGGG + Intronic
1071860409 10:89666641-89666663 TAGAAGACCACCAAAAAGCAAGG + Intergenic
1072715448 10:97749470-97749492 CAGAAGAGCCCCATAGAACCTGG - Exonic
1073486910 10:103824943-103824965 CAGAAGTGCACCACCAAGCTTGG + Intronic
1075044197 10:119133242-119133264 CAGGAGAGGAGCAAGGAGCTGGG - Intronic
1076780930 10:132724067-132724089 AAGAGGAGCACGAAATAGCTGGG + Intronic
1077154936 11:1087076-1087098 CAGAGGAGAACCACAGAACTGGG - Intergenic
1078187469 11:9064727-9064749 CTAAAGAGCAGAAAAGAGCTCGG + Intronic
1079343214 11:19630020-19630042 CAGAAGTTCACCACAGAGTTGGG - Intronic
1079343223 11:19630063-19630085 CAGAAGTTCACCACAGAGTTGGG - Intronic
1079959383 11:26904244-26904266 CAGAAGGCCACAAAACAGCTGGG - Intergenic
1080626618 11:34036213-34036235 CAGAAGGGCAGCTAAGAGATGGG - Intergenic
1084276377 11:68053177-68053199 CAGGAGAGGCCCAAAGAGCTAGG + Exonic
1085728925 11:78979652-78979674 GAGAAGAGCACGATACAGCTAGG + Intronic
1086299020 11:85404291-85404313 CAGAAGAGGACCAAAGATGTAGG + Intronic
1086647662 11:89244964-89244986 AAAAAGAGCACCAAAGAACGGGG + Intronic
1088096895 11:106111630-106111652 CAGATGTGCACCACTGAGCTTGG - Intergenic
1090787474 11:130062698-130062720 CAGAAGCACCCTAAAGAGCTGGG + Intergenic
1090963816 11:131580966-131580988 CAGTAGACAACAAAAGAGCTTGG + Intronic
1091505532 12:1063798-1063820 CAGAATACCACCAAACAGCAAGG - Intronic
1096731141 12:53613661-53613683 CAGGAGTGCACCAACAAGCTCGG + Intronic
1099834269 12:87887469-87887491 CACAAGAGTAGAAAAGAGCTAGG - Intergenic
1101582883 12:106059289-106059311 CAACAGAGCAACTAAGAGCTTGG + Intergenic
1102762988 12:115405266-115405288 CAGAGGTGCACCAGAGAGTTGGG - Intergenic
1106039946 13:26080268-26080290 CAGAACAGGACCAAAGGGATGGG - Intergenic
1106813929 13:33386746-33386768 CACAAGAGAACCAGAGAACTTGG - Intergenic
1112131868 13:96533590-96533612 CAGATCAGCAACAAGGAGCTGGG + Intronic
1112891854 13:104244523-104244545 GAGGAGAGCACCAAGGAGCAAGG - Intergenic
1113510461 13:110850527-110850549 GAGAAGAGCACAAAAGACCCTGG + Intergenic
1114366416 14:22032166-22032188 CAGAGGAGCACCTTACAGCTCGG + Intergenic
1114723862 14:24912706-24912728 CAGAACAGCACCAGATAGCATGG - Intronic
1117374929 14:55111355-55111377 AAGATGAGCTCCCAAGAGCTTGG + Intergenic
1117486023 14:56198013-56198035 GAGAAGTGGACCAAAGAGGTGGG - Intronic
1119386507 14:74260776-74260798 GAGCACAGCACCAAAGTGCTGGG + Exonic
1119896871 14:78227609-78227631 CCGCAGAGAACCAAAGAGGTGGG - Intergenic
1120653008 14:87157161-87157183 CAGAAGAGCATGTAAGAGCAGGG - Intergenic
1122183369 14:99971582-99971604 CAGCACAGCAGCCAAGAGCTAGG - Intronic
1122793139 14:104192847-104192869 CAGGACAGCCCCCAAGAGCTGGG - Intergenic
1122827841 14:104379851-104379873 GGGAAGAGCACCAAGGAGCAGGG + Intergenic
1124102888 15:26712390-26712412 CAGAAGAGCAGCAAGGAGGCTGG + Intronic
1125368310 15:38942866-38942888 CAGAAGAGAACCAAATACCAAGG + Intergenic
1127212121 15:56784128-56784150 CAAAAGAACCCCAAAGACCTAGG - Intronic
1128185223 15:65639040-65639062 CAGAAGACCACAGAAGACCTGGG + Intronic
1128464544 15:67899141-67899163 CATAAGGTCACCAAAGGGCTTGG + Intergenic
1129799343 15:78401864-78401886 CAGAAGGGCCCAAAAGACCTGGG + Intergenic
1132235400 15:100216422-100216444 CTGAAGAACAGCAAAGAGCTGGG + Intronic
1134629968 16:15749513-15749535 TAGGAGAACACCAAAGAGCCAGG - Intronic
1135494312 16:22938212-22938234 CAGAAGAGCCCCAGAGGCCTGGG + Intergenic
1135930862 16:26735430-26735452 CAGATGAGTCCCAAATAGCTAGG - Intergenic
1137249643 16:46732407-46732429 CAGAGGAGGAGCAAAGGGCTGGG - Exonic
1137967973 16:52955636-52955658 GAGAAGAGCACCAAGGGGATGGG - Intergenic
1139299680 16:65934354-65934376 CAGCAGAGAACTAAAAAGCTGGG - Intergenic
1140967203 16:79978202-79978224 GAGAAGAGCACCAAAGGGACTGG - Intergenic
1141214811 16:82013188-82013210 CAGAAGAGGAAGTAAGAGCTTGG + Intergenic
1141428849 16:83960621-83960643 TAGAAGGGCATCAAAGAGCAGGG - Exonic
1144204606 17:12971246-12971268 CAGAAGATCACCAAGGAGGCTGG + Intronic
1144806342 17:17970835-17970857 CATAAGAACACCAAAGATCCTGG + Intronic
1146687482 17:34851041-34851063 CCAAAGAGCACCAAGGAGCCAGG + Intergenic
1147133140 17:38420422-38420444 CAGAACAGCCCCAAAGAACTTGG - Intergenic
1148189572 17:45669140-45669162 CAGAAGAACACCACCCAGCTGGG - Intergenic
1148649117 17:49237050-49237072 CAGAAGAGGTCCAAAGGGCAAGG + Intergenic
1148855739 17:50578427-50578449 CAGAAGGCCAGCACAGAGCTGGG - Exonic
1152008973 17:77699102-77699124 CAGAAGAGGACCTCAGAGCCTGG - Intergenic
1153634269 18:7099592-7099614 CAGAAGAAAACCTAAGATCTTGG + Intronic
1154934271 18:21035290-21035312 CAGCAGTGCACCAAAGTGCTGGG - Intronic
1156493305 18:37509299-37509321 CAGAAAAGCACCACGAAGCTAGG + Intronic
1157867611 18:51199024-51199046 TTAAAAAGCACCAAAGAGCTGGG - Intronic
1162090626 19:8277346-8277368 CAAAAGAAAACGAAAGAGCTGGG - Intronic
1162092859 19:8292178-8292200 CAAAAGAAAACGAAAGAGCTGGG - Intronic
1163297934 19:16424389-16424411 CAGAAGATCACTAGAGAGGTGGG + Intronic
1164219280 19:23178903-23178925 GAGAAGAGCAGCAATGAGATGGG - Intergenic
1165447474 19:35864522-35864544 AGTAAGAGCACCCAAGAGCTGGG - Intronic
1166632169 19:44416267-44416289 CAGAAGAGTCCCCGAGAGCTGGG - Intergenic
1166636576 19:44456680-44456702 CAGAAGAGCCCCTGAGGGCTGGG + Intergenic
1166774669 19:45305065-45305087 CAGAAGATCAGGAAAGAGGTCGG + Intronic
925036509 2:691099-691121 CAGAAGAGCCCCGTTGAGCTGGG + Intergenic
925684370 2:6456675-6456697 AAGAAGACCCCAAAAGAGCTGGG + Intergenic
925929622 2:8696556-8696578 GAGAAGAGGACAAAAGACCTGGG - Intergenic
927003747 2:18826308-18826330 GAGAACAGCACCAAAGGGGTTGG - Intergenic
927304203 2:21551605-21551627 CAGAAGAAATTCAAAGAGCTGGG - Intergenic
927939617 2:27095374-27095396 CAGCATGGCACCAAGGAGCTGGG + Intronic
929510792 2:42564449-42564471 CAGAAGAGCCCCAAGGAGAAAGG - Intronic
929615697 2:43305680-43305702 CAGAAGAGCTCAAAGGATCTGGG + Intronic
930431018 2:51276535-51276557 CAGAAGAGAAGCAAAGAGAGTGG - Intergenic
933230771 2:79804943-79804965 AAGAAGAGCAAGAATGAGCTGGG + Intronic
934043032 2:88145808-88145830 CAGAAGACCACCCACAAGCTGGG + Intergenic
936474006 2:112824018-112824040 CAGAGGAGCAGGAAAGAGCCAGG - Intergenic
937987811 2:127646348-127646370 CAGACCATCACCAAAGAGATGGG - Intronic
938089688 2:128423310-128423332 CAGAAGAGCAAGTCAGAGCTTGG - Intergenic
938756762 2:134387723-134387745 CTGAACAGCACAAAAGAGTTTGG + Intronic
938994317 2:136661199-136661221 CATAATAGCACCAAACTGCTAGG - Intergenic
940130169 2:150372118-150372140 CAGAAGGGCAGCACAGAGATAGG + Intergenic
941499710 2:166257048-166257070 AAGAAGAGAAGCAAAGAGCTAGG + Intronic
942283774 2:174393201-174393223 CACAAGAAGACTAAAGAGCTTGG + Intronic
942437934 2:176001813-176001835 CACAAGTGGGCCAAAGAGCTGGG + Intronic
942549017 2:177095056-177095078 AAGAAGAGGACCAAAGCTCTAGG + Intergenic
944369783 2:198968432-198968454 CTGCTGAGCACCAAAGAACTAGG - Intergenic
946195202 2:218028639-218028661 CAGAAAAGGACCCTAGAGCTTGG + Intergenic
946923939 2:224607416-224607438 CAGAGGAACCCCAAATAGCTCGG - Intergenic
947896668 2:233680762-233680784 AAGATGAGCACCAAAGTGATTGG + Intronic
1169317384 20:4603822-4603844 CAGAAGCGAACCCCAGAGCTGGG - Intergenic
1171120230 20:22562235-22562257 CAGAAGGGCACCACAATGCTGGG - Intergenic
1171220028 20:23387859-23387881 CAGAATAACACCAAATATCTGGG - Intronic
1176016150 20:62934168-62934190 CAGGAGAGCAGGAAAGAGGTAGG - Intronic
1178464413 21:32833627-32833649 CAGAAAAGGACCAAAGAGGCAGG + Intergenic
1179281856 21:39940567-39940589 TAGAAGAGGACCAGAGAGGTAGG + Intergenic
1180055827 21:45358816-45358838 CAGCTGAGCAGCACAGAGCTTGG + Intergenic
1181822370 22:25486100-25486122 CATAAGAGCACCAAAGAGTCTGG - Intergenic
1182481256 22:30610390-30610412 CAGCAGGGCACCAAAGAGCGGGG + Intronic
1182715237 22:32352833-32352855 CTGAAGAGCACCAGAGCGGTAGG - Intergenic
1184144882 22:42604071-42604093 CAGAAGAAGCCCAAAGACCTTGG - Intronic
1184158485 22:42684359-42684381 CAGAAGAGGACCATAGGGCCAGG + Intergenic
1184762496 22:46552483-46552505 CAGAAGAGCACTTAAGGCCTAGG - Intergenic
949278497 3:2318067-2318089 CAGGCGAGAACCACAGAGCTCGG - Intronic
950476414 3:13217940-13217962 CAGAAGAGCTGGAAAGACCTGGG + Intergenic
952006621 3:28848734-28848756 CAGAAAAGCTCCAGAGAGCTAGG + Intergenic
955308797 3:57863086-57863108 CAGCACAGCACTAAATAGCTGGG - Intronic
955731350 3:61990856-61990878 ATGAATAGCACCAAAGGGCTAGG - Intronic
955775675 3:62430366-62430388 CAGAAAAGCACCAAAACACTCGG + Intronic
956809138 3:72847644-72847666 CAGAAGAGCAGCAGACAGCAGGG + Intronic
961870129 3:129981457-129981479 AAGAAGATCAGCAAAGGGCTTGG + Intergenic
963964469 3:151350182-151350204 AAGAAGAGCACCACAGAGACAGG + Exonic
964651438 3:159015818-159015840 CAGAAGAGGAGCCAGGAGCTTGG + Intronic
964941166 3:162158833-162158855 CAGAAGAGCAGAAAAGGGGTGGG + Intergenic
968943247 4:3650254-3650276 CAGAAGAGGAACCAAGAGCGGGG - Intergenic
969879490 4:10161358-10161380 AAGAATAACAGCAAAGAGCTTGG + Intergenic
970511355 4:16784872-16784894 GAGCAGAGCACCAGTGAGCTAGG - Intronic
973379652 4:49311368-49311390 CAGAAGAGTACCTGAGGGCTGGG - Intergenic
976249827 4:83039129-83039151 CAGAAAAGAACCATACAGCTGGG - Intronic
976494910 4:85716917-85716939 CAGAAGAGCACAAGAGAGACAGG - Intronic
977479333 4:97555121-97555143 CAGAAAAGCACCATAGAACAAGG - Intronic
977672986 4:99717017-99717039 CAGAAGAGGATCAGAGACCTTGG - Intergenic
979113825 4:116795154-116795176 CACAAAAGCACTAAAAAGCTGGG - Intergenic
980479519 4:133369753-133369775 CAGAAGCCAACCAAATAGCTGGG - Intergenic
980877140 4:138672937-138672959 AAGAAGTGCACCAAAGAGGAGGG - Intergenic
981451077 4:144898483-144898505 CAAAAGAGCACAAAAGAGACTGG - Intergenic
982530366 4:156533999-156534021 TAGATGAGAACCTAAGAGCTAGG - Intergenic
983717731 4:170805606-170805628 CAGAAGGGCACCTAAGAGGCAGG + Intergenic
984437091 4:179721587-179721609 CAGAAAAGCAGGAAAGGGCTTGG - Intergenic
984891988 4:184502508-184502530 AAGAAGTGCACCACAGGGCTGGG + Intergenic
985475403 5:76150-76172 CACAAGAGCAGCAGAGAGCGTGG - Intergenic
987370686 5:17189916-17189938 CTGAAGAGCAACTGAGAGCTAGG - Intronic
989475605 5:41869971-41869993 CCGACGAGCGCCAAAGGGCTCGG + Intronic
989764122 5:45059195-45059217 CAGAATATCCCAAAAGAGCTGGG - Intergenic
990182819 5:53181466-53181488 AAGCAGAGAACCAAAGACCTTGG - Intergenic
990327996 5:54697036-54697058 CAGAGGAGCACAAAAGGGCAGGG + Intergenic
993834663 5:92803681-92803703 CAGATGTGCAACAAAGAGATAGG - Intergenic
997422394 5:133779763-133779785 GAGAAGACCAGCAGAGAGCTGGG - Intergenic
998648355 5:144089936-144089958 CAGAAAAGAAGCAAACAGCTTGG + Intergenic
999119088 5:149195159-149195181 CAAATGAGCTCCAGAGAGCTGGG + Intronic
1001522960 5:172408021-172408043 TAGAACAGCACCAAAGAGGCCGG - Intronic
1003826443 6:9957952-9957974 CAGGAGAACCCCAGAGAGCTGGG - Intronic
1004324098 6:14658151-14658173 CAGGAAAACACCAGAGAGCTGGG - Intergenic
1005128636 6:22476917-22476939 CAGAAAAATACTAAAGAGCTCGG - Intergenic
1008224615 6:48899312-48899334 CAGCATAGCACGAAAGAGCATGG - Intergenic
1008881477 6:56384542-56384564 CAAAAGAACACCAAAGGGTTTGG + Intronic
1011145766 6:84214299-84214321 CAGAAGAGGAACACTGAGCTTGG - Intronic
1011330490 6:86199832-86199854 AATAACAGCACAAAAGAGCTAGG + Intergenic
1016902060 6:149113053-149113075 CTGAGCAGCACCAAAGAGCATGG - Intergenic
1017404540 6:154104141-154104163 CACAAGAGCCCCTAATAGCTAGG - Intronic
1018829105 6:167428928-167428950 CAGCAGAACACCAGAGTGCTGGG - Intergenic
1022720207 7:32935893-32935915 CAGAAGAGCAAGAGAGAGCATGG + Intergenic
1023977100 7:45038703-45038725 CAGAAGAGGGTTAAAGAGCTGGG + Intronic
1024267000 7:47614505-47614527 CACAGTTGCACCAAAGAGCTGGG + Intergenic
1024286939 7:47766033-47766055 CAGTAGAGGACCACTGAGCTGGG + Intronic
1025158948 7:56636341-56636363 CAGAAGACAAGCAAAGAGGTGGG + Intergenic
1026979601 7:74518581-74518603 CAAAATAGCACCAAAGTGGTCGG + Intronic
1028117383 7:87015371-87015393 CAGGAGAGTAGGAAAGAGCTAGG - Intronic
1030078560 7:105757978-105758000 AAGAAGAGCACCAGCCAGCTGGG - Intronic
1030729134 7:112963912-112963934 AAGAAGGGCACTAAAAAGCTCGG + Intergenic
1032130920 7:129226528-129226550 CAGAACAGCAACAAAGAGACGGG + Intronic
1034245319 7:149639687-149639709 CGGGACAGCACCAAGGAGCTGGG - Intergenic
1034530802 7:151695298-151695320 CAGAAGAGTCCCAAAGATCAAGG - Intronic
1034627461 7:152504397-152504419 CTGAAGAGCAGCAATGAGCAAGG - Intergenic
1035985488 8:4427044-4427066 CGGAACAGCCCCAGAGAGCTTGG + Intronic
1036293823 8:7518599-7518621 CAAAAGAGAACCAGAGAGCCAGG + Intergenic
1036328738 8:7802396-7802418 CAAAAGAGAACCAGAGAGCCAGG - Intergenic
1036821091 8:11940746-11940768 CAGAAAATCACAAAAGAGGTGGG + Intergenic
1038155610 8:24986697-24986719 CAGAAGAGTACCTAAAAGTTAGG - Intergenic
1038155615 8:24986772-24986794 CAGAAGAGTACCTAAAAGTTAGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG + Exonic
1043528618 8:81124556-81124578 CAGCACAGCACCATAGAGATAGG - Intergenic
1044362625 8:91306356-91306378 AAGAAAAGCACCAAACAGCTGGG - Intronic
1044952022 8:97444179-97444201 TAGAATGGCACCAATGAGCTGGG - Intergenic
1045062677 8:98423021-98423043 CAGGAGAGCACCCCAGAGCCTGG + Intronic
1046876210 8:119257527-119257549 CAGAGGAGTACCAATGAGATTGG - Intergenic
1049866452 8:144941113-144941135 CAGAAGATCACTAAGGAACTAGG - Intronic
1051669771 9:19497746-19497768 CTGAAGTGCACCAAAGACCTCGG - Intergenic
1056046546 9:82723989-82724011 AAGATGAACACCAAAGTGCTGGG - Intergenic
1056989618 9:91398701-91398723 CAGAAGAGCACCCAGGATATGGG + Intergenic
1057815600 9:98291724-98291746 CAGAAGAGCACCCAGGAGCAGGG - Intronic
1059231347 9:112724451-112724473 CAGAAGAGCAGAAGAGAGCAAGG + Intergenic
1059389216 9:113988340-113988362 CAGAAGAGCACCAAGGTGGAGGG + Exonic
1059433138 9:114261575-114261597 CAGCAGAGCACCAGAGAACCCGG - Intronic
1060566831 9:124600210-124600232 CAGATGAGAACCAGAGATCTTGG - Intronic
1187209012 X:17210525-17210547 TAGAACAGCACCAAGGAGATGGG + Intergenic
1187813057 X:23201428-23201450 CAGAAGAGCTGCAAAGAGACCGG - Intergenic
1188691436 X:33133724-33133746 CTGAAGAGCTGCAAAGAGTTTGG - Intronic
1188912966 X:35872873-35872895 AAGGACAGCACCAAAGAGCATGG - Intergenic
1190963360 X:55273872-55273894 CAGAAGAGCAGATAAAAGCTGGG - Intronic
1192437614 X:71152689-71152711 TAGAAGAGAAACAAAGAGATAGG - Intronic
1192492980 X:71592544-71592566 CAGAAGAGCTCCGAAGAGACAGG + Exonic
1192493232 X:71594753-71594775 CAGAAGAGCTCCGAAGAGACAGG + Exonic
1195309581 X:103618439-103618461 CAAAAGAGCACCAGAGGGCTGGG + Intronic
1196243131 X:113366715-113366737 GAGAAGAGCACCAGAGAAATCGG - Intergenic
1196981670 X:121221256-121221278 CAGAAGAGCACATGAGAGCCTGG - Intergenic
1197715346 X:129702279-129702301 CAGGTGAGCACCAGAGATCTTGG - Intergenic
1200853497 Y:7910993-7911015 CAGAAGAGAAGCAAAGAAGTGGG + Intergenic
1202256644 Y:22928355-22928377 CAGAAAACCAGCAAAGAGGTAGG - Intergenic
1202266185 Y:23021554-23021576 CAGAAGAGAAGCAAAGAGGTGGG - Intergenic
1202269141 Y:23053647-23053669 CAGAAGACCAGCAAAGAGGTGGG - Intergenic
1202409635 Y:24562108-24562130 CAGAAAACCAGCAAAGAGGTAGG - Intergenic
1202419178 Y:24655297-24655319 CAGAAGAGAAGCAAAGAGGTGGG - Intergenic
1202422133 Y:24687387-24687409 CAGAAGACCAGCAAAGAGGTGGG - Intergenic
1202448653 Y:24982691-24982713 CAGAAGACCAGCAAAGAGGTGGG + Intergenic
1202451608 Y:25014787-25014809 CAGAAGAGAAGCAAAGAGGTGGG + Intergenic
1202461148 Y:25107969-25107991 CAGAAAACCAGCAAAGAGGTAGG + Intergenic