ID: 1042826347

View in Genome Browser
Species Human (GRCh38)
Location 8:72984010-72984032
Sequence CTCTTGCACTGTCTGATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042826347_1042826351 30 Left 1042826347 8:72984010-72984032 CCTTGCATCAGACAGTGCAAGAG No data
Right 1042826351 8:72984063-72984085 GTCCAATAACAATAACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042826347 Original CRISPR CTCTTGCACTGTCTGATGCA AGG (reversed) Intergenic
No off target data available for this crispr