ID: 1042826766

View in Genome Browser
Species Human (GRCh38)
Location 8:72987351-72987373
Sequence AACTATTTGGTCACAAGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042826762_1042826766 12 Left 1042826762 8:72987316-72987338 CCGAAAAGGAGTAACTCTCCATC No data
Right 1042826766 8:72987351-72987373 AACTATTTGGTCACAAGTTAAGG No data
1042826758_1042826766 25 Left 1042826758 8:72987303-72987325 CCCTCCGTACTTCCCGAAAAGGA No data
Right 1042826766 8:72987351-72987373 AACTATTTGGTCACAAGTTAAGG No data
1042826761_1042826766 13 Left 1042826761 8:72987315-72987337 CCCGAAAAGGAGTAACTCTCCAT No data
Right 1042826766 8:72987351-72987373 AACTATTTGGTCACAAGTTAAGG No data
1042826760_1042826766 21 Left 1042826760 8:72987307-72987329 CCGTACTTCCCGAAAAGGAGTAA No data
Right 1042826766 8:72987351-72987373 AACTATTTGGTCACAAGTTAAGG No data
1042826763_1042826766 -6 Left 1042826763 8:72987334-72987356 CCATCTACTACTCCTTCAACTAT No data
Right 1042826766 8:72987351-72987373 AACTATTTGGTCACAAGTTAAGG No data
1042826759_1042826766 24 Left 1042826759 8:72987304-72987326 CCTCCGTACTTCCCGAAAAGGAG No data
Right 1042826766 8:72987351-72987373 AACTATTTGGTCACAAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042826766 Original CRISPR AACTATTTGGTCACAAGTTA AGG Intergenic
No off target data available for this crispr