ID: 1042826786

View in Genome Browser
Species Human (GRCh38)
Location 8:72987552-72987574
Sequence TGTAATCTTAAAGTAGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042826783_1042826786 -4 Left 1042826783 8:72987533-72987555 CCATTATCTGGGACTTTTGTGTA No data
Right 1042826786 8:72987552-72987574 TGTAATCTTAAAGTAGGTGAGGG No data
1042826782_1042826786 4 Left 1042826782 8:72987525-72987547 CCTCTTTTCCATTATCTGGGACT No data
Right 1042826786 8:72987552-72987574 TGTAATCTTAAAGTAGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042826786 Original CRISPR TGTAATCTTAAAGTAGGTGA GGG Intergenic
No off target data available for this crispr