ID: 1042833155

View in Genome Browser
Species Human (GRCh38)
Location 8:73053434-73053456
Sequence ATGGGGAAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042833155_1042833167 26 Left 1042833155 8:73053434-73053456 CCCTCCTCCTCCTCCTTCCCCAT No data
Right 1042833167 8:73053483-73053505 ACTCTCCTTTTACTTGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042833155 Original CRISPR ATGGGGAAGGAGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr