ID: 1042833244

View in Genome Browser
Species Human (GRCh38)
Location 8:73054391-73054413
Sequence GTTTTGTTTTTAAGGACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042833239_1042833244 18 Left 1042833239 8:73054350-73054372 CCACAGGTGTGCATCACCACGAC No data
Right 1042833244 8:73054391-73054413 GTTTTGTTTTTAAGGACACAGGG No data
1042833241_1042833244 -4 Left 1042833241 8:73054372-73054394 CCGTTTTTTGTTTTGTTTTGTTT 0: 149
1: 386
2: 828
3: 25787
4: 36456
Right 1042833244 8:73054391-73054413 GTTTTGTTTTTAAGGACACAGGG No data
1042833240_1042833244 2 Left 1042833240 8:73054366-73054388 CCACGACCGTTTTTTGTTTTGTT No data
Right 1042833244 8:73054391-73054413 GTTTTGTTTTTAAGGACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042833244 Original CRISPR GTTTTGTTTTTAAGGACACA GGG Intergenic
No off target data available for this crispr