ID: 1042835048

View in Genome Browser
Species Human (GRCh38)
Location 8:73072108-73072130
Sequence CTGTGTGAGAGGAAGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042835042_1042835048 19 Left 1042835042 8:73072066-73072088 CCTGCAGGCCTTTGACAAGCACA 0: 1
1: 0
2: 2
3: 20
4: 191
Right 1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG No data
1042835043_1042835048 11 Left 1042835043 8:73072074-73072096 CCTTTGACAAGCACATTTGTCTG 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042835048 Original CRISPR CTGTGTGAGAGGAAGGAGAG GGG Intronic
No off target data available for this crispr