ID: 1042837199

View in Genome Browser
Species Human (GRCh38)
Location 8:73089872-73089894
Sequence CTCAAAAAAAAGTAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 728
Summary {0: 1, 1: 0, 2: 5, 3: 76, 4: 646}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042837199_1042837207 2 Left 1042837199 8:73089872-73089894 CCCTGCCCCTACTTTTTTTTGAG 0: 1
1: 0
2: 5
3: 76
4: 646
Right 1042837207 8:73089897-73089919 AGGGTCTTACTCTGTGGCCCAGG 0: 26
1: 1122
2: 15225
3: 75752
4: 182488
1042837199_1042837206 -4 Left 1042837199 8:73089872-73089894 CCCTGCCCCTACTTTTTTTTGAG 0: 1
1: 0
2: 5
3: 76
4: 646
Right 1042837206 8:73089891-73089913 TGAGACAGGGTCTTACTCTGTGG 0: 20
1: 329
2: 1413
3: 2382
4: 3428
1042837199_1042837208 16 Left 1042837199 8:73089872-73089894 CCCTGCCCCTACTTTTTTTTGAG 0: 1
1: 0
2: 5
3: 76
4: 646
Right 1042837208 8:73089911-73089933 TGGCCCAGGCTGAAGTGCAGTGG 0: 98
1: 6686
2: 147849
3: 265710
4: 208363
1042837199_1042837211 21 Left 1042837199 8:73089872-73089894 CCCTGCCCCTACTTTTTTTTGAG 0: 1
1: 0
2: 5
3: 76
4: 646
Right 1042837211 8:73089916-73089938 CAGGCTGAAGTGCAGTGGCATGG 0: 52
1: 1647
2: 3524
3: 4402
4: 3941

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042837199 Original CRISPR CTCAAAAAAAAGTAGGGGCA GGG (reversed) Intronic
900255392 1:1695555-1695577 CTCAAAAAAAAATAAAGGCCGGG - Intronic
900263953 1:1747786-1747808 CTCAAAAAAAAATAAAGGCCGGG - Intergenic
900287335 1:1907998-1908020 CTCAAAAAAAAGGCCGGGCGCGG - Intergenic
901577772 1:10214581-10214603 CCCAAAAAAAAAAAAGGGCAGGG - Intronic
902270519 1:15301123-15301145 ATTAAAAAAAAGTAGGGGCCGGG - Intronic
902428521 1:16343816-16343838 CTCAAAAAAAAATATTGGCCAGG + Intronic
902562346 1:17285479-17285501 CTCAAAAAAAAGGATAGGGATGG + Intergenic
902595379 1:17506101-17506123 CTCAAAAAAAAATAGAGTCCTGG - Intergenic
902906839 1:19564461-19564483 CTCAAAAGAAAGTAGTGGACAGG + Intergenic
902977490 1:20099367-20099389 CTCAAAAAAAAGAGGGGGCGGGG + Intergenic
903039344 1:20516788-20516810 CTCAAAAAAATGGAAGGGAAGGG + Intergenic
903257714 1:22114042-22114064 CTCAAAACAAAGAAGGGAAAGGG - Intergenic
904634372 1:31868326-31868348 CTCAAAAGAAAACAGGTGCAAGG + Intergenic
905142262 1:35856817-35856839 CTCAAAAAAAAAAAGGGGGGGGG + Exonic
905218460 1:36426999-36427021 CTCAAAAAAAAAAAGAGGCCAGG - Intronic
905403328 1:37718075-37718097 CTCAGAGAAAAGCTGGGGCAGGG - Exonic
906420677 1:45664318-45664340 CTCAAAAAAAAGGCCGGGCGTGG + Intronic
907109439 1:51913470-51913492 CTCAAAAAAAAAAAAGGGGAGGG - Exonic
907455096 1:54570513-54570535 CTCAAAAAATAAAAAGGGCAAGG - Intronic
907467319 1:54647447-54647469 CTTAAAAAAAAGGCTGGGCATGG + Intronic
907677671 1:56533518-56533540 CTCATAACTAAGTAGTGGCATGG - Intronic
908490798 1:64642233-64642255 CTGAAAAAAAAGGTGGGGCAGGG - Intronic
908491312 1:64646727-64646749 CTCAAAAAAAGGTGGGGGGTGGG + Intronic
909321997 1:74301397-74301419 CTCAAAAAAAATGATGGGGAGGG + Intronic
910130536 1:83899754-83899776 CTCAAAAAAAAAGAGTAGCAGGG + Intronic
910967082 1:92818645-92818667 CTCAAATAAAACTAGAGGCCAGG + Intergenic
911003847 1:93197685-93197707 CTCAAAAACAAGTTATGGCAAGG + Intronic
911095837 1:94054362-94054384 CCCAAAATAAAGTAGGGTAAGGG + Intronic
911489061 1:98539917-98539939 GTTAAAAAAAATTAGGGGTAAGG + Intergenic
911569100 1:99500939-99500961 ATCAAAAGAAAGCAGGTGCAAGG + Intergenic
911710388 1:101064814-101064836 CTCAAAAAAAATTAAGGACTTGG + Intergenic
912317603 1:108680394-108680416 TTAAAAATAAAGTAGGGGCTGGG + Intergenic
912415978 1:109508844-109508866 CTCAAAAAGCAGCAGGGACAAGG + Exonic
912624122 1:111193742-111193764 GTCATAAAACAGTAGGGGTAGGG - Intronic
913274646 1:117124986-117125008 ATCAAAAAAAATAAAGGGCAGGG - Intergenic
913694231 1:121308641-121308663 TGCAAAAAAAAGTATGGGCCGGG + Intronic
914046149 1:144094487-144094509 CTCAAAAAAAAAAAGGGGGCGGG + Intergenic
914131961 1:144866200-144866222 CTCAAAAAAAAAAAGGGGGCGGG - Intergenic
914199737 1:145474195-145474217 GTCTAAAAAAAGCAGGGGAAGGG + Intergenic
914516316 1:148377828-148377850 CTCAAAAAAAAAAAGGGGGGGGG + Intergenic
915459260 1:156060053-156060075 CTCAAAAAAAAAAAGAGGCCTGG - Intergenic
915492656 1:156259825-156259847 CACAAAAATAAGTTGGGGCCAGG - Intronic
915502941 1:156332030-156332052 CTCAAAAAAAAAAAGAGACATGG + Intronic
916901423 1:169228380-169228402 CTTAAAAAAAAGTACAGGCCGGG + Intronic
917952638 1:180056468-180056490 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
917956876 1:180108497-180108519 CTCAAAAAAAAAGTGGGGCGGGG + Intronic
918207190 1:182319967-182319989 CTCAAAAAAAAGGTATGGCAGGG + Intergenic
918507524 1:185273030-185273052 CTCAAAAAAAAAAAGGGGGAGGG + Intronic
918681358 1:187358513-187358535 CTCCAAAAAATGAAGGGGAAGGG - Intergenic
918733388 1:188027008-188027030 AAGAAAAAAAAGTACGGGCATGG - Intergenic
919081525 1:192872093-192872115 CTCAAAATAAAGCAGGAGCTGGG + Intergenic
920133153 1:203748313-203748335 CTTAAAAAAAATTACAGGCATGG - Intergenic
922028188 1:221772838-221772860 CTCATAGAAAAGAAGGGGCTGGG + Intergenic
922190689 1:223316198-223316220 ACCCAAAAAAGGTAGGGGCATGG + Intronic
922535825 1:226379934-226379956 CTCCAAAAAAAGCAAGGGCCAGG - Exonic
922644520 1:227273295-227273317 CTCAAAAAAAAGGCCGGGCATGG + Intronic
922995922 1:229961437-229961459 CTCCTAAAAAAGCAGGGGCTTGG + Intergenic
923492016 1:234492488-234492510 CTCACACAACAGAAGGGGCAAGG + Intergenic
924301654 1:242645342-242645364 CTTTAAAAAAAGGAGGGGAAGGG - Intergenic
924424135 1:243934285-243934307 CTCAAAAAAAAGGAAAGGAAAGG - Intergenic
924782583 1:247165885-247165907 CTCAAAAAATAGCCTGGGCAGGG + Intronic
1062863919 10:833457-833479 CCCAAACAAAAGGAGGGGAAAGG + Intronic
1062879418 10:966121-966143 CTAAAAAGACAGTAGAGGCAAGG + Intergenic
1063456686 10:6188119-6188141 CAGAAAAAAAAATAGGGGCTGGG - Intronic
1064021364 10:11811900-11811922 TTTAAAAAAAAGTAGGGGCTGGG - Intergenic
1064196995 10:13251951-13251973 AAAAAAAAATAGTAGGGGCATGG - Intergenic
1064269673 10:13853534-13853556 CTGAAAAAAAAGTGGGGGCCAGG + Intronic
1064385460 10:14887209-14887231 GTCAAGGAAAAGTAGGTGCACGG + Intronic
1065037968 10:21659976-21659998 CTCAAAAAAAAGTTTAAGCAAGG - Intronic
1065386417 10:25138118-25138140 CAGAAAAAAAAGCAGGGGAAAGG + Intergenic
1065507898 10:26447719-26447741 CTCAAAAAAAAGAAAAGTCATGG - Intronic
1065852388 10:29801594-29801616 CTCATGAAAAAGTAGGGTAATGG + Intergenic
1066120363 10:32280448-32280470 CTCAAAAAAAAGGCCAGGCACGG + Intronic
1066680377 10:37932104-37932126 CTCAAAAAAAAGGGGGGGGGAGG - Intergenic
1067278155 10:44852284-44852306 CCCAAAGACAAGTAGGGGCCTGG + Intergenic
1067383889 10:45800585-45800607 CTCAAAAAAAAAGTGGGGGAGGG + Intergenic
1067484882 10:46639016-46639038 CTCAAAAAAAACGAGAGGCCGGG + Intergenic
1069180975 10:65357990-65358012 CTCAAAAAAAAAAAGTGGCCTGG - Intergenic
1069350397 10:67519414-67519436 CTCAATAATACATAGGGGCAAGG + Intronic
1069398878 10:68020469-68020491 CTAAAAAAAAAGTTTGGGCCGGG + Intronic
1069510202 10:69036426-69036448 CTCAAAAAAAAAAAGGGGGGGGG + Intergenic
1070182240 10:74025609-74025631 GTCAAAAAAAAGAAAGGGAAGGG + Intronic
1070217858 10:74405453-74405475 CTAAAAAAAAAGAATGGGAAAGG - Intronic
1070365291 10:75730784-75730806 TTCAAAAAAAAGAAGGTTCAAGG - Intronic
1070398274 10:76031724-76031746 CTCAATTAAAAATATGGGCAGGG + Intronic
1070913785 10:80139674-80139696 CTCAAAAAAAAGTGGGGAGGGGG + Intronic
1071503771 10:86221058-86221080 CTCAGAAAATATTAGGAGCAGGG - Intronic
1071625469 10:87164251-87164273 CTCAAAAAAAAAGAGAGGCCAGG - Intronic
1071810459 10:89175443-89175465 CTCTACAAAAAGTATGGGCATGG + Intergenic
1072162647 10:92782751-92782773 GACAACAAAAAGTTGGGGCAGGG + Intergenic
1072242889 10:93513943-93513965 CTCAAAAAAAAAAAAGGGGAGGG - Intronic
1072474515 10:95747015-95747037 ATCATAAAAAAGATGGGGCATGG + Intronic
1072587574 10:96796440-96796462 CTCAAAAAAAAGTGGGTGGGGGG - Intergenic
1074505605 10:114067721-114067743 CTCAAAAAAAAGGCTGGGCATGG - Intergenic
1074633234 10:115282975-115282997 TTAAAAAAAAAGTGGGGGTAGGG - Intronic
1074650352 10:115515932-115515954 CTTAAAAAAAAGAAGTGGAAAGG - Intronic
1074850870 10:117438729-117438751 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1075098766 10:119490985-119491007 CTCAAAAAAAAAAAGAGGCAGGG + Intergenic
1076296673 10:129391217-129391239 CTCAAAAGAAAGAAAGGGAAGGG + Intergenic
1076582805 10:131524415-131524437 CTCCATAAAAAGTAGAGGCTGGG - Intergenic
1077293385 11:1811564-1811586 AAAAAAAAAAATTAGGGGCATGG - Intergenic
1077980242 11:7292618-7292640 CTCAAAAACATGTAGGGACTGGG - Intronic
1078253992 11:9641813-9641835 CTCAAAAAAAAGGGGGGGTGGGG - Intergenic
1078344661 11:10536221-10536243 TTAAAAAAAAAGTAGGGAAATGG + Intronic
1078676074 11:13415570-13415592 AAAAAAAAAAAGAAGGGGCAGGG - Intronic
1079643545 11:22835316-22835338 AAAAAAAAAAAGTAGGGGCCGGG + Intergenic
1080415684 11:32067951-32067973 CCCTAAAAAAAGGAGAGGCAGGG + Intronic
1080516991 11:33032866-33032888 CTTAAGAAAAAGAAGGGACATGG - Intronic
1080619762 11:33977587-33977609 TTAAAAAAAAAGTAGAGACAGGG - Intergenic
1080734653 11:35001299-35001321 CTTCAAAAAAAGCAGGGGCCAGG - Intronic
1081237449 11:40662457-40662479 CTTAAAAAAGAGTTTGGGCAGGG + Intronic
1081764245 11:45598297-45598319 CTCAAAAAAAAACGGGGGGAAGG + Intergenic
1081912969 11:46712160-46712182 CACAAAAAACAGTCTGGGCATGG - Intergenic
1082662680 11:55932208-55932230 CTCCAAAAAGAGGAGGGGAATGG + Intergenic
1083589623 11:63885831-63885853 CTCAAAAAAAAAAAGAGGCCGGG + Intronic
1083931137 11:65846268-65846290 CTCAAAAAAAAGAATAGGCCAGG + Intronic
1084059058 11:66657736-66657758 CTCAAAAAAAAGGTGGGGGAGGG - Intronic
1084122941 11:67080070-67080092 CTCAAAAAGAAGTAAAGGCTGGG - Intergenic
1084330601 11:68427677-68427699 CTCAAAAAAAAAAAAGGGCCAGG + Intronic
1085057735 11:73416943-73416965 CTCAAAAAAAAGGTGGGGGTGGG + Intronic
1085628366 11:78091085-78091107 CTCAAAAAAAAAAAAGGGCGGGG - Intergenic
1086029530 11:82337176-82337198 CTCAAAAAATAGTCTGCGCACGG + Intergenic
1086144751 11:83539192-83539214 TTCAGAAAAAAGGAGGGGGAAGG + Intronic
1086192359 11:84094628-84094650 CTCACATAAAGGAAGGGGCAAGG + Intronic
1088276814 11:108096193-108096215 TTCAAAAAAAAGGAGAGGCTGGG + Intronic
1089248475 11:117139304-117139326 CTCAAAAAAAAAGAGGCGCCCGG - Intergenic
1089380630 11:118028703-118028725 CTAAAAACAAAGTAAGGTCAAGG + Intergenic
1089549009 11:119255905-119255927 AAAAAAAAAAAGTAGAGGCAGGG + Intronic
1089886637 11:121831058-121831080 CAAAAAAAAAAATAGGGGCATGG + Intergenic
1090165786 11:124545464-124545486 CTCAAAGAAAAGTGGGTGGAAGG - Intergenic
1090206735 11:124888553-124888575 TTCAACAAAAAGTATGGGCAGGG - Intronic
1090513439 11:127399500-127399522 CTCAAAAAAAAGCGGGGGGGAGG - Intergenic
1090948509 11:131452104-131452126 CTCGAAAAGAAGTGGGGGGAGGG + Intronic
1091249483 11:134130443-134130465 CTAAAAAAAAAATAGTGACAAGG + Intronic
1091987806 12:4926959-4926981 CACAAAAACACTTAGGGGCATGG - Intronic
1092410215 12:8247021-8247043 CTCAAAAAAAAATTGAGTCAGGG + Intergenic
1094307862 12:29040779-29040801 CTGAAAACAAAATAGAGGCAAGG - Intergenic
1095290453 12:40473785-40473807 CTGAAAAAATAGTAGTAGCAGGG + Intronic
1095499975 12:42827338-42827360 GTCAAAAAATAAGAGGGGCAGGG - Intergenic
1096087253 12:48874056-48874078 CTAAAAAAAAATTAGGAGGAAGG + Intergenic
1096593747 12:52680354-52680376 CTTAGAGAAAAGTAGGAGCAAGG + Exonic
1097293274 12:57937870-57937892 CTCAAAAAAAAGGGGCGGCAGGG - Intergenic
1097454482 12:59780444-59780466 CTCAAAAAAAATCATGTGCATGG - Exonic
1097844036 12:64348275-64348297 ATGAAAAAAAAGCAGGGGTAGGG + Intronic
1100418813 12:94408578-94408600 CTCAAAAAAAAGTATTAGTATGG - Intronic
1101547793 12:105732963-105732985 CTCAACAACAAGCAGGGACAAGG - Intergenic
1101868451 12:108541831-108541853 CTTAAAAAAAAGTCTGGGCCGGG - Intronic
1102142195 12:110624215-110624237 CTCAAAAAAACATAGAGGCTGGG - Intronic
1102468614 12:113145762-113145784 CTCAAAAGGAAGGAGGGGGAGGG - Intergenic
1102537283 12:113590940-113590962 TTCAAAAAAAAGTAGGGGTACGG + Intergenic
1102577183 12:113863142-113863164 CTCATAAACAAGTCGGGGGATGG + Intronic
1102734838 12:115150245-115150267 CTCAAACAGCAGAAGGGGCAAGG + Intergenic
1102917304 12:116763776-116763798 CTCAAAAAAAAAAGGGGGCGGGG + Intronic
1103388899 12:120555789-120555811 CTCAAAAAAAAAAAGAGGCCAGG - Intronic
1103538372 12:121649240-121649262 TTAAAGAAAAAGTGGGGGCAGGG - Intergenic
1104003033 12:124872583-124872605 CTCAAAAAAAAGTAAGGCCAGGG - Intronic
1104634888 12:130432068-130432090 CTCAAAAACCAGTGGGGGTATGG + Intronic
1108252312 13:48579417-48579439 CTCAAAAATAAGAAAGGGAAGGG - Intergenic
1108420059 13:50239774-50239796 CTCAAAAAAAAGTGCTGACAGGG - Intronic
1109064511 13:57669145-57669167 CTTTAAAAAATGTAGGGACATGG - Intronic
1109316154 13:60752487-60752509 ATCAAACAAAAATAGGGGAAAGG - Intergenic
1109556316 13:63980885-63980907 CTCAAAAATAAGGCCGGGCATGG + Intergenic
1110259029 13:73464546-73464568 CTTAAAAAAAATTAGGGGCCAGG - Intergenic
1110902207 13:80837409-80837431 CTCAAAAAAAAGTGGGGGGGTGG - Intergenic
1111924925 13:94452810-94452832 TTAAAAAAAAAGTGGGGGAAAGG + Intronic
1112278626 13:98043716-98043738 CTCAAAAGAAAATGGGGGCCAGG - Intergenic
1112755686 13:102630457-102630479 CTAAAGAAAAAGTAGGGACTTGG + Intronic
1112919779 13:104597874-104597896 CTCAGAAAGAAGGAGGGCCAGGG - Intergenic
1113409124 13:110068667-110068689 ATAAAAAAAAAGAAGGGACAAGG - Intergenic
1113449423 13:110396426-110396448 CTCAAGAAAAACACGGGGCATGG - Intronic
1113520671 13:110938260-110938282 CTCCAAAAAAAGCAAGGGCCAGG + Intergenic
1114101288 14:19384422-19384444 CTAACAAAAAGGTAGGGCCAAGG + Intergenic
1114398150 14:22385300-22385322 CTAAGAAAAAAGTAGGCCCAAGG + Intergenic
1114470437 14:22957401-22957423 CTCAAAAAAAAAACGAGGCAAGG - Intronic
1114930156 14:27457252-27457274 TTCAAAAAAAGTAAGGGGCAAGG - Intergenic
1115064766 14:29244496-29244518 CTAAAAAAAAAATAGAGGCCGGG + Intergenic
1115184841 14:30674641-30674663 CTCAAAAAAAAGAAGGAGGGAGG + Intronic
1115198413 14:30827198-30827220 ATAAAAGAAAAGTAGGGACAAGG + Intergenic
1115279537 14:31646185-31646207 CTCAAAAAAAAAGCGGGGGAAGG - Intronic
1115599097 14:34938510-34938532 CTCAAAGAAAAAAAAGGGCAGGG - Intergenic
1115838264 14:37434578-37434600 TTAAAAAAAAAATAGAGGCAAGG + Intronic
1116075085 14:40100885-40100907 CTCAAAAAAAGGAAAGGGAAGGG - Intergenic
1116328649 14:43567452-43567474 TTAAAAAAAAAGTATAGGCAGGG - Intergenic
1116662183 14:47724568-47724590 CTCCAAAAAAAGAAAGTGCAAGG - Intergenic
1117083409 14:52175078-52175100 CTCACTAAAAAGTCTGGGCATGG - Intergenic
1117341029 14:54791696-54791718 CTCAAAACAAGGTGGGGACAGGG - Exonic
1117466698 14:56001218-56001240 TTCAAAACCAGGTAGGGGCAGGG + Intergenic
1117520820 14:56549809-56549831 AACAAAAAAAAGTAGGGGGTGGG - Intronic
1117894493 14:60467738-60467760 ATCCAAAAAAAGTAGGATCAGGG + Intronic
1118628955 14:67685621-67685643 CTCAAAAAAATGAAGGGGATGGG - Intronic
1119076137 14:71641425-71641447 CTAAAGAAAAAGTAGAGGCCGGG + Intronic
1119281576 14:73413465-73413487 CTAAAAAATAAGGCGGGGCATGG + Intronic
1119503512 14:75151507-75151529 CTTAAAAAAAAGGCTGGGCATGG - Intronic
1119563282 14:75607775-75607797 CTCAAAAAAAAAGGGGGGCTCGG + Intronic
1119866997 14:77982185-77982207 CTCAAAAAAAAGCAGGGATGGGG - Intergenic
1120635917 14:86950750-86950772 ATGAAAAACAAGTAGAGGCATGG - Intergenic
1120922486 14:89767549-89767571 TTGCAAAAAAAGTAGGGGGATGG - Intergenic
1121110917 14:91312385-91312407 CTCAAAAATAAGTAAGGGTCGGG + Intronic
1122023029 14:98854831-98854853 CCCAAAAAGAAGTCGGGGCTGGG + Intergenic
1122184314 14:99978399-99978421 CTCAAAAAAAAAAAAAGGCATGG + Intronic
1122561117 14:102615132-102615154 CTCAAAAAAAGGTGGGGGCGGGG - Intronic
1122622803 14:103069360-103069382 CTCAAAAAAAAATAAAGGCCGGG + Intergenic
1124336751 15:28862913-28862935 CAAAAAAGAAAGTAGGGGCTGGG - Intergenic
1125165208 15:36695842-36695864 CTCAAAAAAAAAAAGAGGCGGGG + Intronic
1125323803 15:38515780-38515802 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1126501195 15:49347236-49347258 CACAAAAATAAGTAGAGACATGG + Intronic
1126578145 15:50217758-50217780 CTCAAAAAACAGAAGAGGCCAGG + Intronic
1126700808 15:51366015-51366037 TTAAAAATAAAGTAAGGGCAAGG + Intronic
1126769169 15:52037942-52037964 CACAGAAAAAAGGAGGGGAATGG + Intronic
1126783904 15:52161296-52161318 CTCAAAAAAAGAAAGAGGCATGG - Intronic
1128036084 15:64528096-64528118 CTCAAAAAAAAAAAGGAGCCAGG - Intronic
1128281614 15:66399445-66399467 CTCAAAAAAAAAGAGGGGGTGGG - Intronic
1128350586 15:66885759-66885781 CTCAAATGAAGGAAGGGGCAAGG + Intergenic
1128503157 15:68243771-68243793 CACAAAAAAAAGGATGGGCATGG + Intronic
1128644908 15:69369673-69369695 CCACAAAAATAGTAGGGGCATGG + Intronic
1129476224 15:75786082-75786104 GGCCAAGAAAAGTAGGGGCAGGG + Intergenic
1129867199 15:78918218-78918240 CTCAAAAAAAAGAGGGGGAGGGG - Intergenic
1129969605 15:79766522-79766544 CAGAAAAAAGATTAGGGGCAGGG - Intergenic
1130635888 15:85619502-85619524 CTTAAAAAAAAGTAGAAGCTGGG - Intronic
1130957015 15:88634274-88634296 CTCAAAAAAAACTATAGGCCAGG - Intergenic
1130975758 15:88772904-88772926 CTCAAAAAAAAAAAGGCCCAAGG - Intergenic
1131045843 15:89314841-89314863 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1131601174 15:93850567-93850589 CTCAAAGAAAAGAGGGGGAATGG - Intergenic
1132509368 16:330059-330081 CTCAAAAAAAAAAAAGGGCCGGG - Intronic
1133096681 16:3451915-3451937 CTCAAAAAAAAAAATGAGCATGG + Intronic
1133503487 16:6387749-6387771 CTCTTAGAGAAGTAGGGGCATGG - Intronic
1134058795 16:11186618-11186640 CAAAAAAAAAAGTGGGGGCTGGG + Intergenic
1134640695 16:15827364-15827386 CTCAAGACAAAGCAGGGACATGG + Intronic
1135134446 16:19877244-19877266 ATCCAAAAAAAGCAGGGGCTGGG - Intronic
1135523936 16:23199015-23199037 TTAAAAAAAAAATAGAGGCAGGG - Intronic
1136047793 16:27628870-27628892 ATCAAAATTAATTAGGGGCAGGG + Intronic
1136144879 16:28310669-28310691 CTTAAAAAAAAATAGAGACAGGG - Intronic
1136487203 16:30581162-30581184 CTCAAAAAAAAAAAGAGGCTGGG + Exonic
1136852206 16:33621109-33621131 CTCAAAAAAAAAAAAGGGCAGGG - Intergenic
1136939877 16:34513361-34513383 CTAAAAAAAAAATGTGGGCATGG + Intergenic
1136959942 16:34835205-34835227 CTAAAAAAAAAATGTGGGCATGG - Intergenic
1138476421 16:57272954-57272976 CTCAAAAAAAAGTTGGGGGTGGG + Intronic
1139399226 16:66667027-66667049 CTAAAATAAAAGTTGGGGCCGGG + Intronic
1139544045 16:67640732-67640754 ATTAAAAAAAAGTTGGGGCCGGG - Intergenic
1139724571 16:68886804-68886826 CAAAAAAAAAAGTATGGGCCAGG - Intronic
1140020410 16:71233050-71233072 CTCAAAAAAAAGGGGGGGAGGGG + Intergenic
1140438009 16:74964377-74964399 CTCAAAAAAAAAAAAGAGCAGGG + Intronic
1141337517 16:83170986-83171008 CTCAAAAAAAAGGAGGCGGGCGG - Intronic
1141595722 16:85095754-85095776 CTCAAAAAAAAAAAAAGGCAGGG + Intergenic
1141671660 16:85495246-85495268 CTCAGAAAACATTACGGGCAGGG - Intergenic
1142162285 16:88564155-88564177 CTCCAAAAAAAAAAGAGGCAGGG + Intergenic
1142398434 16:89846320-89846342 CTCAAAAAAAAAAAGAGGCCAGG - Intronic
1142407667 16:89900016-89900038 CTCACAAAAATGTAGGTGCAGGG + Intronic
1203113802 16_KI270728v1_random:1469580-1469602 CTCAAAAAAAAAAAAGGGTAGGG - Intergenic
1142617439 17:1144588-1144610 CAAAAAAAAAAAAAGGGGCAGGG + Intronic
1142809755 17:2389950-2389972 CTCAAAAAAAAAAAGCGGGAGGG + Intronic
1143797914 17:9352762-9352784 CTTAAAAAAAAGTGGGAGTAAGG - Intronic
1143812363 17:9482174-9482196 ATTAAAAAAAAATAGGGACAGGG - Intronic
1144554902 17:16273593-16273615 CAGAAAAAAAAGCAGTGGCAGGG + Intronic
1144567591 17:16372870-16372892 CTCAAAAAAAAGAACAGGCTGGG - Intergenic
1144871274 17:18373065-18373087 AGAAAGAAAAAGTAGGGGCAGGG + Intergenic
1145070459 17:19801276-19801298 CTCAAAAAGAAGTTGGGGCCGGG + Intronic
1146027861 17:29338334-29338356 CTTAAAAATAAGTATGGGCCAGG + Intergenic
1146357628 17:32147451-32147473 GTTAAAAAAAAGTAGAGGCAGGG - Intronic
1146664547 17:34688950-34688972 AACAAAAAAAAGGATGGGCAGGG + Intergenic
1147116885 17:38307330-38307352 CTCAAAAAAAAAAAGGGGGCCGG - Intronic
1147682098 17:42256245-42256267 CTCAAAAAAAGTTGGGGGGATGG - Intronic
1147714319 17:42494231-42494253 CTCAAAAAAAAAAAGGGGGGTGG + Intronic
1148024700 17:44578678-44578700 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1148509615 17:48157528-48157550 CTCAAAAAAAAAAAGAGGCCGGG - Intronic
1148552114 17:48556576-48556598 CTCAAAAAGAAAAAGGGGGAGGG - Intronic
1148880620 17:50723653-50723675 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1150162378 17:62909381-62909403 TTAAAAAAAAAGCAGGGGCCAGG - Intergenic
1150494622 17:65597751-65597773 CTCAAAAAAAAGGCGGGGGGGGG - Intronic
1151055541 17:71027046-71027068 AATAAAAAAAATTAGGGGCATGG - Intergenic
1151502420 17:74499636-74499658 CTCCAAAAAAAGTGGGGGGAGGG + Intergenic
1152214578 17:79024799-79024821 CCCACAAAAAACTAGGGGGAAGG - Intronic
1152395076 17:80027595-80027617 CTCAAAAAAAAAAAGAGGCCGGG + Intronic
1153480374 18:5542483-5542505 CTCAACAAAAAGGACAGGCAGGG + Intronic
1153763499 18:8353658-8353680 CCCAAATAAAAGTAGGTGTAAGG + Intronic
1154114291 18:11597502-11597524 CACAGAAAAAAGGAGGGACAAGG + Intergenic
1154976492 18:21462359-21462381 TTCAAAAATAAGCAGAGGCAAGG - Intronic
1155658325 18:28217887-28217909 CTGAAAAAAAGGTAGGAGGAAGG - Intergenic
1155762132 18:29581781-29581803 GTCAAAAAAAAGGGGGGGCGGGG + Intergenic
1155949849 18:31899940-31899962 CTCAAAAAAAAACATGGGCTGGG + Intronic
1156657223 18:39303048-39303070 CTAAAAAAAAATTAGGGGTAAGG + Intergenic
1156714957 18:39997032-39997054 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1156725434 18:40120869-40120891 CTAAAGAACAAGCAGGGGCAAGG - Intergenic
1156899331 18:42282701-42282723 CTGGAAAAAAACTAGGTGCAAGG - Intergenic
1157206793 18:45707479-45707501 CTCAAAAAAAAAAAGGAGCTGGG + Intergenic
1157263062 18:46193285-46193307 CTAAAAAAAAAGCAGGGGTGGGG - Intronic
1158168046 18:54564175-54564197 CTAAAAAAAACGGAGGGGGAGGG - Intergenic
1158714380 18:59864703-59864725 TTAAAAAAAAAGAAGGTGCAGGG + Intergenic
1160025591 18:75212399-75212421 ATAAAAAAAAAGTGGGGGCGGGG - Intronic
1160700283 19:503284-503306 CTCAAAAAAAAAAATGGGCCGGG + Intronic
1160728842 19:631325-631347 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
1161085616 19:2333607-2333629 CTCAAAATGAAGTAGGGGGCAGG - Intronic
1161374990 19:3934876-3934898 CTCGAAAAATATTAGGGGCAGGG - Intronic
1161462674 19:4408009-4408031 CTCAAAAAAAAAGAGGGGGTGGG - Intronic
1161561576 19:4975947-4975969 CTTAAAAAAAAAATGGGGCATGG + Intronic
1161637996 19:5401339-5401361 AACAAAAAAACGAAGGGGCAGGG + Intergenic
1162068354 19:8139051-8139073 CTCAAAAAAAATAAAGGGCCGGG + Intronic
1162387114 19:10366310-10366332 AAAAAAAAAAAGTAGAGGCACGG + Intronic
1162470537 19:10870193-10870215 CTCAAAAAACAAAAGGGGCCGGG + Intergenic
1162537259 19:11270405-11270427 CTCAAAAAAAAAAAGAGACATGG + Intergenic
1162564889 19:11440445-11440467 CTCAAAAAAAAGTGTGGGCCAGG - Intronic
1162945544 19:14041196-14041218 CTCAAAAAAAAAAGGGGGCCGGG - Intronic
1162981986 19:14246436-14246458 CTCAAAAAAAAAAAAGGCCAGGG + Intergenic
1163278826 19:16302629-16302651 TTAAAAAAAAAGTAATGGCAAGG + Intergenic
1163511561 19:17738592-17738614 CTCAAAAAATAAAAGGGGGAGGG + Intergenic
1163794283 19:19327618-19327640 CTCTAATAAAAGTAGAGGCCGGG - Intronic
1164107674 19:22123240-22123262 CTCAGAAAAAAGTAGGTCAAAGG - Intergenic
1164134802 19:22405279-22405301 AAAAAAAAAAATTAGGGGCAGGG + Intronic
1164268352 19:23643680-23643702 GTCAAAAATAAGTTGGGGGAAGG + Intronic
1164637265 19:29800515-29800537 CTCAAAAAAAGGGAGTGGCAGGG + Intergenic
1165244164 19:34488367-34488389 CTCCAAAAAAAGAAGAGGCCAGG - Intronic
1165429276 19:35763198-35763220 CAAAAAAAAAAGGGGGGGCATGG - Intronic
1165474942 19:36025070-36025092 AAAAAAAAAAAGAAGGGGCAGGG + Intronic
1165667032 19:37640589-37640611 TTAAAAATAAAATAGGGGCAGGG + Intronic
1165678237 19:37747008-37747030 CTCAAAAAACAGAAGGATCAGGG + Intronic
1165702095 19:37946284-37946306 CACAAAAAAAAGTGTGGGGAGGG - Intronic
1165754429 19:38284134-38284156 CTAAAAAAAAAGCAGGGGCTGGG - Intronic
1166320952 19:42018656-42018678 CTCAAAAAAAAGCGGGGGGGGGG + Intronic
1166531791 19:43547187-43547209 CTCAAAAAAAAAAAGAGGGAGGG - Intronic
1166695031 19:44847253-44847275 CTCCAGAAAAATTAGGGGCCGGG + Intronic
1166738761 19:45101717-45101739 CAAAAGAAAAAGGAGGGGCATGG + Intronic
1166754891 19:45184603-45184625 CTCAAAATAAAAAAGGGGCCGGG + Intronic
1166834888 19:45661289-45661311 CTCAAAAGAAAAGAAGGGCAGGG - Intergenic
1166877651 19:45907354-45907376 TTAAAAAAAAAGAAGGGGCCAGG + Intergenic
1166889981 19:45985263-45985285 CTTAAAAAAAAGAAAGGGCTGGG - Intergenic
1166964838 19:46523001-46523023 ATTAAAAAAAAGTGGGGACAGGG + Intronic
1167212933 19:48144912-48144934 CTCAAAAAAAAATAGAGGTTGGG - Intronic
1167533614 19:50034620-50034642 TTAAAAAACAAGAAGGGGCAAGG - Intronic
1167646144 19:50706156-50706178 CTCAAAAAAAAGGGGGGGTTGGG + Intronic
1167884324 19:52487952-52487974 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1167909178 19:52688168-52688190 ACCAAAGAAAAGAAGGGGCAGGG - Intronic
1168377660 19:55894032-55894054 AAAAAAAAAAAGTTGGGGCATGG - Intronic
1168708671 19:58484657-58484679 ATCGAAAAAAAGTAGAGACATGG - Intronic
926991526 2:18685711-18685733 TGCAAAAAAAAGAGGGGGCATGG - Intergenic
927231707 2:20830415-20830437 CTCAAAAAAAAGGAGAGGTGGGG - Intergenic
927652819 2:24922549-24922571 CTCAAAAAAAAGTGGGGGTTGGG + Intergenic
927802969 2:26118312-26118334 CTCAAAAAAAAGGGGGAGGAGGG - Intronic
927831616 2:26356124-26356146 ATACAAAAAAAGTAGGGGGAAGG - Intronic
927902749 2:26833071-26833093 CACAAAAATAAATAGAGGCAAGG + Intergenic
928469922 2:31564187-31564209 CACAAAATTAAGTAGGGACATGG + Intronic
929155491 2:38785126-38785148 CTTAAAAAAAACTAAGTGCATGG - Intergenic
929311958 2:40435736-40435758 CGAAAAATAAAGTAGGGGAAAGG - Intronic
929652840 2:43699383-43699405 CTTTAAAAAAAATAGAGGCAGGG + Intronic
929957632 2:46470847-46470869 CTCAAAAAAAAAAAGGATCAGGG - Intronic
930011235 2:46940272-46940294 CTCAAAAGACAGCAGGGTCAGGG - Intronic
930642861 2:53872012-53872034 CTCCAAAAAAAGGGGGGGCGGGG + Intronic
931073953 2:58688137-58688159 CTGCAAAAAAAATGGGGGCATGG - Intergenic
931565070 2:63607532-63607554 CTCAAAAAAAAGAAGAGGACTGG + Intronic
932507440 2:72249258-72249280 CTCAAAAAATAAAAGGGACAAGG - Intronic
932518512 2:72380631-72380653 CTCAAAAAAGAGGAGAGGGAAGG + Intronic
932597688 2:73104280-73104302 CTCAAAAGTAAATAGGGGCCAGG + Intronic
933257476 2:80097899-80097921 TTGAAAAAAAATTAGGTGCATGG - Intronic
933757734 2:85653312-85653334 CTCAAGAACAAGCAGGGGCCAGG - Intergenic
933794909 2:85911817-85911839 CTCAAAAAAAAGGCCGGGCACGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
935566660 2:104615936-104615958 TTCAAAAATAATTATGGGCATGG - Intergenic
935870174 2:107439439-107439461 GCCAAAAAAAAGTGGGGGCGGGG - Intergenic
936631658 2:114209751-114209773 CTGAACAAACAGTAGGTGCATGG - Intergenic
937162893 2:119782706-119782728 CTCAAAAAAAAAAAGGGGGGTGG - Intronic
937448550 2:121979852-121979874 ATCAAAAAAAAGTAGGGGTAGGG - Intergenic
937944243 2:127317243-127317265 CTTAAAAAGAAGTAGAGACAAGG - Intronic
938041995 2:128083659-128083681 CTCAAAAAAAAAGGGGGGGAGGG - Intergenic
938196477 2:129333516-129333538 CTCAAAAAAAAGCGGGGGGTGGG - Intergenic
938589481 2:132722763-132722785 CTGGAAAAAACGTAGGGTCAAGG - Intronic
938617751 2:133017347-133017369 CTTAAAACAAAGCAGGGTCAGGG + Intronic
939628711 2:144510041-144510063 CTGAAAAAAAAGTATGGAGAAGG + Intronic
939649845 2:144746653-144746675 CTAAAAAATAAGAAGGGGCTGGG - Intergenic
941505938 2:166345523-166345545 AACAAAAAAAAGTAGGGAAAAGG + Intronic
941865893 2:170334132-170334154 CTAAAAAGAAAGAAGGGGGAAGG + Intronic
942145635 2:173023768-173023790 CTCAAGGAAAAGAAGGAGCAAGG + Intronic
943035086 2:182734142-182734164 ATCATAAAAAAGTAGAGGGAAGG - Intronic
944549324 2:200830907-200830929 CTTAAAAAAAAGGCTGGGCATGG + Intergenic
944576938 2:201099059-201099081 CTCAAAAAAAAAGTGGGGGAGGG - Intergenic
945069459 2:205976452-205976474 ATCAAAAACAAGAAGGGCCATGG + Intergenic
945418630 2:209606522-209606544 CTCAAAAAAAGGAGGGGGCATGG + Intronic
945954908 2:216077505-216077527 CTCAAAAAAAAATACATGCAGGG + Intronic
946235190 2:218320207-218320229 AGCAAAAAAGAGTAGGGCCAAGG - Intronic
946378204 2:219327067-219327089 CTCAAAAAACAGCAGGGTCCAGG + Intergenic
946769146 2:223070404-223070426 CTCATAAAAAAGTTGGGGAGGGG - Intronic
947737173 2:232461679-232461701 CTCAAAAAAAAGAAGGAGGGAGG + Intergenic
1169148223 20:3268328-3268350 CTCAAAAAAAAAAAGGGGCCGGG - Intronic
1169219954 20:3816354-3816376 CTCTAAATAAAGGAGGGCCAGGG + Intergenic
1169617384 20:7464086-7464108 CTCAAAAAAATGTAGAGCTATGG + Intergenic
1170564469 20:17589208-17589230 AAAAAAAAAAAGTAGGGGGAGGG - Intronic
1170695786 20:18657327-18657349 CTGAAAAAAAACAAGGGGAAAGG + Intronic
1172087780 20:32401553-32401575 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1172419964 20:34807813-34807835 CTAAAAAAAAAGGCCGGGCACGG - Intronic
1172552468 20:35812066-35812088 CTTAATAAAAAGCAGGGGCCGGG - Intronic
1172642785 20:36451218-36451240 CTCAAAAACAATTATGGGTATGG - Intronic
1172858946 20:38032547-38032569 TTAAAAAAAAAATAGGGTCAAGG + Intronic
1173056614 20:39619991-39620013 TTCAAAGATAAGTAGAGGCATGG + Intergenic
1173143903 20:40508635-40508657 CTCAAAAATGAGTAGGGGCTGGG - Intergenic
1173894474 20:46540125-46540147 AACAATAAAAAGTAGGGCCATGG + Intergenic
1173912338 20:46679611-46679633 CTCAAAAAAAAAAAGGGGGTGGG + Intronic
1174144550 20:48442283-48442305 CTCAAACGACAGAAGGGGCAAGG + Intergenic
1174753205 20:53132578-53132600 GACAAAAAAAATTATGGGCAGGG - Intronic
1174895285 20:54442676-54442698 CCCATAAAAAAGTAGGGGAAAGG - Intergenic
1174992737 20:55530080-55530102 CTCAAAAATAGCTGGGGGCAGGG + Intergenic
1175103299 20:56595631-56595653 CTCAAAAAAATGAAGAGGCCAGG - Intergenic
1175111657 20:56652770-56652792 CTCAAAAAAAAAAAAGGGCCAGG - Intergenic
1175537342 20:59724011-59724033 CTCAATAAAAGGTGTGGGCAAGG - Intronic
1176197002 20:63841890-63841912 CTCAAAAAATAGGCCGGGCACGG - Intergenic
1176661992 21:9645699-9645721 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1176989713 21:15480750-15480772 CTCAACAAATACTAGTGGCATGG + Intergenic
1177254259 21:18639091-18639113 CTCAAATAAAATTATTGGCAAGG - Intergenic
1177388783 21:20440636-20440658 CTGAAATAAAGGTAGTGGCAGGG - Intergenic
1178122275 21:29481476-29481498 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1178569331 21:33720555-33720577 CTTAAAAAAAAAGAAGGGCAGGG - Intronic
1178603084 21:34011993-34012015 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1178867854 21:36345246-36345268 CTCAAAAAAAAGGAAGGGAAAGG - Intronic
1179515109 21:41900799-41900821 GTCAAAAAAAAGTAAGGGCCGGG + Intronic
1180479450 22:15738169-15738191 CTAACAAAAAGGTAGGGCCAAGG - Intergenic
1182011305 22:27002946-27002968 CTGAAATGGAAGTAGGGGCAAGG - Intergenic
1182256165 22:29040178-29040200 CTCAAAAAAAAAAAGGGGGAGGG - Intronic
1182345832 22:29664106-29664128 CTCAAAAAAAAGAAGGGTTTAGG - Intronic
1182367130 22:29786796-29786818 CTCAAAAAAAAAAAGAGACAAGG + Intergenic
1182643513 22:31788571-31788593 CTCAAAAAAAAATATGGGCTAGG - Intronic
1182680731 22:32077423-32077445 CTTAAAAGAGAGTAGGGGGAAGG - Intronic
1182708340 22:32304129-32304151 CTCAAAAAAAAGAAAGGAAAAGG - Intergenic
1182766841 22:32763936-32763958 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1183071162 22:35397314-35397336 CTCAAAAAAAAAAAGTGGTAAGG + Intergenic
1183287124 22:36973886-36973908 CTCAAAAAAAAAAAGTGTCATGG + Intergenic
1183495527 22:38141353-38141375 CTCAAAAAAAAGAAAGTGCTAGG + Intronic
1184512880 22:44943371-44943393 CTCAAAACAAAATAGGGGCTTGG - Intronic
1184704434 22:46200921-46200943 CTCAAAAAAAAGTTGGGGCGTGG + Intronic
1184751437 22:46488658-46488680 CTCAAAAAAAAAAAAGGGCAGGG - Intronic
1185302297 22:50088286-50088308 ATCAAAAATAAGTCGGGGCTGGG + Intergenic
949482943 3:4511296-4511318 GTAAAAAAAAAGGGGGGGCAGGG - Intronic
949538394 3:5013292-5013314 AGCAAGAAACAGTAGGGGCATGG - Intergenic
950403832 3:12792082-12792104 CTCAATAAAAAGGAGGGAAATGG - Intergenic
950550528 3:13663432-13663454 CCAAAAAAAAAGATGGGGCAAGG - Intergenic
951245979 3:20342036-20342058 TTCAAAAAAAATTTGGGGCTGGG - Intergenic
951344212 3:21526556-21526578 CTCAAAAAAATCTAGTGTCATGG + Intronic
951501912 3:23398015-23398037 CTCAAAAGAAACTTGGGGCCAGG + Intronic
951904986 3:27696825-27696847 CTCAAAAGAAAAAAAGGGCAGGG - Intergenic
952362926 3:32648679-32648701 ATTAAAAAACAGTAGGGGCCGGG - Intergenic
952396256 3:32922998-32923020 CTCAAAAGAAAATAGGGACATGG + Intergenic
952535395 3:34304044-34304066 CTCTAAGAAAAGCAGGGTCAGGG + Intergenic
952949925 3:38514767-38514789 CAAAAAAAAAAGCAGGGGGAGGG - Intronic
953182357 3:40607826-40607848 CTCAAAAGAGAGTAGCAGCAGGG + Intergenic
953500452 3:43428048-43428070 CTCAAAAAAAAAAAGGTTCAGGG - Intronic
954016430 3:47696064-47696086 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
954176488 3:48849332-48849354 CTCAAAAAAAAATAGGGGCCTGG - Intergenic
954206921 3:49066284-49066306 CTCAGAAAAAAATAAGGGTAAGG + Intronic
954262352 3:49448692-49448714 CTCAAAAAAAAAAAAGGGCCAGG - Intergenic
954340200 3:49947249-49947271 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
954548032 3:51455606-51455628 CTCAAAAAAAAGGCTGGGCGCGG + Intronic
954902117 3:54028863-54028885 CTCAAATCAAAGTAGAGGGATGG - Intergenic
955106815 3:55906443-55906465 AAAAAAAAAAAGTAGTGGCAGGG + Intronic
955379612 3:58427023-58427045 CTCAAAAAAAAGAATTGGCTGGG - Intergenic
955628680 3:60948580-60948602 CTCAAAACAGAGTAGGTGAATGG + Intronic
955891841 3:63658572-63658594 TTAAAAAAAAAATAGGGACAAGG + Intronic
957570322 3:81939144-81939166 CTCAAAAAAAAGTCCTGGTAGGG - Intergenic
958606067 3:96360174-96360196 CTTAAAAAAATGTTGGGGCTAGG + Intergenic
958727201 3:97920530-97920552 ATCTAAAAAAAGTGGGGGGAGGG - Intronic
959041619 3:101428519-101428541 CTCATCAAAAAGTAGGTGAAGGG - Intronic
959334582 3:105048175-105048197 CTCATAAAAAACTGGTGGCAAGG + Intergenic
959700325 3:109292270-109292292 CTCAAAAAAAAATAGACTCATGG + Intergenic
959717301 3:109446858-109446880 CTCAAAAAAAAGAAAGAGAAAGG - Intergenic
959924282 3:111904275-111904297 CTCAAAAAAAAAAAAGGCCAAGG + Intronic
959969753 3:112396367-112396389 TCCAAACAAAAGTAGTGGCATGG + Intergenic
960171034 3:114461298-114461320 CTCAAAAAAAAAGAGGGGGGGGG - Intronic
960996151 3:123341928-123341950 CTTAAAAAAAAATAGAGACAGGG + Intronic
961883228 3:130077823-130077845 CTCAAAAAAAAAAAAGTGCACGG + Intergenic
961889121 3:130115535-130115557 CTCAAAAAAAAATTGAGTCAGGG + Intergenic
962110700 3:132443691-132443713 CTCTAAAAAGAGGAGCGGCATGG + Intronic
962157630 3:132965269-132965291 CTCAAAGACAAGGAGGGGCATGG + Intergenic
962304589 3:134274266-134274288 CACAGAAGAAAGTAGAGGCAAGG + Intergenic
962504307 3:136030215-136030237 CTCAATAAAAAGTTGGGGCGGGG + Intronic
965350643 3:167607758-167607780 CTCAAGATAAATTAGGGGCTTGG - Intronic
965539603 3:169859004-169859026 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
966164308 3:176999964-176999986 ATTAAAAAAAAATAGAGGCAGGG - Intergenic
966234210 3:177682711-177682733 CCCAAAAAAAAGTACAGGGAGGG - Intergenic
966332871 3:178834643-178834665 CTAAAAAAAAAGTGGGGGCGTGG + Intronic
966794801 3:183702831-183702853 CTCAAAAAAAAAAAAGGGAATGG + Intronic
967137844 3:186527601-186527623 GTCAAAAAACAGAAGGGGCATGG - Intergenic
967386795 3:188920018-188920040 CTCAAAAAAAAAAATGGGAATGG - Intergenic
967415138 3:189208448-189208470 CTCATAAAAAATTGGGGCCAGGG + Intronic
967507270 3:190266997-190267019 CTGAAACTAAAGTAGAGGCAGGG - Intergenic
967702762 3:192612864-192612886 CTCAAAGAAAAATTTGGGCAAGG - Intronic
967757531 3:193186900-193186922 CTCAAAAGAAAGTCGGGAAAGGG - Intergenic
967858760 3:194136521-194136543 CTCAAAATTAAGTAGGGGTTGGG + Intronic
968090163 3:195894418-195894440 CTCAAAAAAAAAAAGGGGGTGGG - Intronic
968532727 4:1102849-1102871 CTCAAAAAAAAGGCCGGGCACGG + Intronic
971456783 4:26852618-26852640 CTCAAAAAACAAAAGGGGCGGGG - Intergenic
972295984 4:37738970-37738992 TTCAAAAAAAAGGGGGGGCTGGG - Intergenic
972352768 4:38252225-38252247 CAAAAAAAAAAGCGGGGGCAGGG - Intergenic
972366882 4:38384203-38384225 GTCAGAAAAAATTAGGAGCAAGG - Intergenic
973768234 4:54183171-54183193 TTAAAAAAAAAGTCTGGGCACGG - Intronic
973768765 4:54187870-54187892 CTCAGAAAAAAGGAGAGGCCGGG + Intronic
973860834 4:55063061-55063083 ATCAAACAAAAGTAGGGAGAAGG - Intergenic
974057733 4:57001168-57001190 CTCCAAAAAAAATAAGGCCAAGG - Intronic
974062498 4:57048050-57048072 CTCAAAAAAAAAAAGGGGGGCGG - Intronic
975426720 4:74237824-74237846 TTCAAAAAAAGGTAGGGGAGAGG + Intronic
975700665 4:77063197-77063219 TTCAAAATATAGTTGGGGCAGGG + Intronic
976396820 4:84564868-84564890 CTCAAAAAAAAGGGGGGGGGAGG + Intergenic
976400916 4:84606678-84606700 TTAAAAAAAAAGTAAGGGAAGGG - Intronic
976623746 4:87156157-87156179 CTCAAAAAAAAAAAGGGGGGGGG + Intergenic
977201236 4:94119386-94119408 CTCTAAAAAAAGTAGGGGGGGGG + Intergenic
977307766 4:95346387-95346409 TTCAAAAAAATGAAGGAGCAGGG + Intronic
977333956 4:95672553-95672575 TTGAAAAAAAAGTAGGGGAGAGG + Intergenic
977621279 4:99140575-99140597 CAAAAAAAAAAGTCTGGGCAAGG + Intronic
978367142 4:107994303-107994325 TTAAAAACAAAGTAAGGGCAGGG + Intronic
979157740 4:117418981-117419003 ATCATAAACAAGTAGGGACAGGG - Intergenic
979441943 4:120760276-120760298 ATCAAGAAAAAGTAGGGGGCAGG + Intronic
980682771 4:136186276-136186298 CTCAAAACTAAGATGGGGCAGGG + Intergenic
980915207 4:139027173-139027195 CTCAAAAAAAAAAAGAGGCCGGG - Intronic
981160973 4:141498164-141498186 CTGAAAAAAAAATAGTGACATGG + Intergenic
981756297 4:148144563-148144585 TTTAAAAAGAAGTAGGGGAAAGG + Intronic
982581888 4:157189194-157189216 CTCAAAAAAAAAAATGGGGAGGG - Intergenic
983588188 4:169378695-169378717 CTCAAAAAAAGGTGGGGGGGGGG - Intergenic
983891652 4:173035917-173035939 CTGAAAACAAAGTAGTGGAAAGG + Intronic
983976711 4:173943774-173943796 CACACAAACAATTAGGGGCAGGG + Intergenic
984087748 4:175333057-175333079 CTCCAACAAAAATAGGGGTAAGG + Intergenic
984273245 4:177574045-177574067 CGCAAAAAAAAGTGGGGGAGAGG - Intergenic
984544159 4:181079241-181079263 CTAAATCAAAAGTAGGGGAAAGG - Intergenic
985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG + Intergenic
986770185 5:10965954-10965976 CTCAAAAAAAAATGGGGGGAAGG - Intergenic
986971186 5:13339093-13339115 AACAAAAAAAAATAGGGGAAGGG - Intergenic
988540834 5:32107625-32107647 CACAAAATAAAGTTGGGGTAAGG - Intronic
989501101 5:42169225-42169247 CTTAAAAAGAAGCAGGGGAAGGG - Intergenic
991378106 5:65987559-65987581 CTCAAAAAAAAGTCCAGGCGTGG + Intronic
991489544 5:67168933-67168955 GGAAAAAAAAATTAGGGGCAAGG - Exonic
991641207 5:68755208-68755230 CTGAAAAAAATTTAGGGACAGGG + Intergenic
992667815 5:79028133-79028155 ATAAAAAAAAAGTGGGGGCTGGG - Intronic
993515356 5:88826831-88826853 GTGGAAAAAAAGTAGTGGCAAGG - Intronic
994538929 5:101069729-101069751 TTCAAAAAGATGTAGGGCCAAGG - Intergenic
995207222 5:109494684-109494706 CTCAAAAAAAAGTTGGGGAGAGG - Intergenic
995828196 5:116325019-116325041 TTAAAAAAAAAATAGGGGCCAGG - Intronic
995873272 5:116764370-116764392 TTAAAAAAAAAGCAGGGGCTGGG + Intergenic
996009514 5:118466002-118466024 TTAAAAAAAAAGTAAGGGAAGGG + Intergenic
996057306 5:118995549-118995571 CTCAAACAAAACAAGGGGGATGG - Intergenic
996287998 5:121817762-121817784 CCCAAACAAAAGGAGGAGCATGG + Intergenic
996564313 5:124863562-124863584 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
997175006 5:131766356-131766378 GTTAAAGATAAGTAGGGGCAGGG - Intronic
997369002 5:133344957-133344979 AAAAAAAAAAAGTGGGGGCATGG - Intronic
997444068 5:133928602-133928624 CTCAAAAAAAAAAAGGGGGAGGG + Intergenic
998339196 5:141401340-141401362 CTCAAAAAAAAGGAAGGAGAAGG + Intronic
999375272 5:151082066-151082088 CTCAAAAAGAATTAGGGGAAAGG + Intronic
999420305 5:151436016-151436038 CTCAATAAACAGTAGTAGCAGGG - Intergenic
999750762 5:154626846-154626868 CTCAAAAAAAAGGGGGGGTTGGG + Intergenic
1000313455 5:160066576-160066598 CTGAAATAAAAGTTTGGGCACGG - Intronic
1001261667 5:170234164-170234186 CTCAGGAAAAGGTAGAGGCAAGG + Exonic
1002179332 5:177422309-177422331 CTCAAAAAAAAGGAAGGGTCTGG - Intronic
1002291088 5:178201378-178201400 TACAAAAAAAAGTCTGGGCATGG - Intergenic
1002339182 5:178503811-178503833 TTAAAAAAAAAGAAGGGGAAGGG + Intronic
1003180324 6:3785339-3785361 ACCAAAAAAAAGTAGGGAGATGG + Intergenic
1003794610 6:9586936-9586958 CTCAAAAATAAGTCAGAGCATGG - Intergenic
1003833058 6:10036079-10036101 CTCAAAAAAAAAAAGGGCTAAGG + Intronic
1004016404 6:11735940-11735962 GCCAAAAAAAAGTAGGGAGAGGG - Intronic
1004219036 6:13729637-13729659 CTCAAGAAAAAGCAGAGGCCAGG + Intergenic
1004621324 6:17333145-17333167 CTCAAAAAAAAGAAGAGTCAAGG - Intergenic
1005631817 6:27715219-27715241 CAAAAAACAAAGTTGGGGCAGGG + Intergenic
1005714028 6:28529983-28530005 CTCAGGAAAAAGCAGAGGCAGGG - Intronic
1005726218 6:28651248-28651270 CAAAAAAAAAAGTAGGGGGATGG + Intergenic
1006002248 6:30974284-30974306 CTCAAAAAAAAAAAGAGGAAGGG + Intergenic
1006205313 6:32336227-32336249 CTCTAAGGAAACTAGGGGCAAGG - Intronic
1006613139 6:35307396-35307418 CTCAAAAAAAGATAAGGACACGG + Intronic
1006871889 6:37258483-37258505 CTCAAGATAAAGTAAGGTCAGGG - Intronic
1006961392 6:37934181-37934203 CTCAAAAAAAAAAAAGGGCCGGG - Intronic
1007347180 6:41240367-41240389 CTCAAAAAAAAGGGGTGGGAAGG - Intergenic
1007400255 6:41599088-41599110 GACAAAAACACGTAGGGGCAGGG + Exonic
1007456839 6:41984895-41984917 CTCAAAAGAAGGTATGTGCATGG - Intronic
1007466089 6:42052320-42052342 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1008274893 6:49531603-49531625 CTCAATAAATACTAGGGGCAAGG + Intergenic
1008941459 6:57050312-57050334 CTAAAAAAAAAAAAGAGGCATGG - Intronic
1009981404 6:70730072-70730094 CAGAAAAAAAAGGAGGGTCAGGG - Intronic
1010210669 6:73360689-73360711 CTCAAAAAACAGGGCGGGCATGG - Intergenic
1010333564 6:74654040-74654062 CTCAAAAAAAAGAAGGGTTATGG + Intergenic
1010393069 6:75359001-75359023 CTCAAAAATAAATAAGGGCTGGG - Intronic
1012246532 6:96932567-96932589 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1012408485 6:98928623-98928645 ATTAAAGAAAAGTTGGGGCAGGG - Intronic
1013276514 6:108590282-108590304 CTCAAAAAAAGGTGGGTGCTGGG - Intronic
1013778044 6:113700807-113700829 CTCCAAAAAAAAGGGGGGCAGGG + Intergenic
1014688092 6:124529231-124529253 ACCAAACAAAAGTAGGGGCAGGG + Intronic
1014912152 6:127107682-127107704 CTCAAAAAAAAAAAGTGACAAGG + Intergenic
1015234111 6:130951252-130951274 CCAAAAAAAAAGGAGGGGGAGGG + Intronic
1015274116 6:131366944-131366966 CTTAAAAAAAAGTTGAGGCCGGG + Intergenic
1015475321 6:133653896-133653918 CTGAAAAAAAGGTAGGAGGAAGG - Intergenic
1015888713 6:137947170-137947192 GCTAAAGAAAAGTAGGGGCAGGG - Intergenic
1017002831 6:150007672-150007694 AAAAAAAAAAAGTAGGGACATGG - Intergenic
1017194960 6:151690145-151690167 CTAAACTAAAAGCAGGGGCAAGG - Intronic
1017349160 6:153419250-153419272 CTCAAAAAAAAGAAAGGTAAAGG + Intergenic
1017534045 6:155327574-155327596 CTCAGAAAAATGAAGGGGCTGGG + Intergenic
1017691804 6:156973744-156973766 ACCAAAAATAAGTGGGGGCAGGG - Intronic
1017699467 6:157054221-157054243 CTCAAAAAAAAGAAGGTGGATGG + Intronic
1017806665 6:157952525-157952547 CTCAAAAAAAAAAAGAGTCAAGG - Intergenic
1018156455 6:160989961-160989983 CTGAAGACAAAGTGGGGGCACGG + Intergenic
1018193853 6:161337449-161337471 ATCAAGAAAAATGAGGGGCAGGG - Intergenic
1018279566 6:162171207-162171229 CAGAAAAAAACGTAGGGTCATGG + Intronic
1018361845 6:163078492-163078514 CTCAAAAAAAAAGGGGGGGAGGG + Intronic
1020250010 7:6460032-6460054 CTCAAAAAAAAGAAAGAGCCAGG - Intronic
1020457899 7:8395032-8395054 CACAACAAAAAGAAGGGCCAGGG - Intergenic
1020799665 7:12718113-12718135 CTCAAAAAAAAGAAGAAGGAAGG - Intergenic
1021304031 7:19009647-19009669 CTCAAAAAAAAGTAGTCATAAGG - Intergenic
1021539821 7:21745024-21745046 TTCAAACAAAACTAGGTGCATGG - Exonic
1021743958 7:23719425-23719447 CCAAAAAAAAAGTGGGGGAAAGG + Intronic
1022113983 7:27247136-27247158 CCAACAAAAAAGTGGGGGCAGGG - Intronic
1022523733 7:31024053-31024075 CTCTATTAAAAGTATGGGCAAGG - Intergenic
1022988212 7:35681305-35681327 AGCAAAAACAAGTATGGGCAAGG + Intronic
1023132312 7:37015149-37015171 CTCCAGATAAAGTAAGGGCATGG + Intronic
1023414952 7:39923156-39923178 CCCCAAACAAAGTGGGGGCAGGG + Intergenic
1023612828 7:41988461-41988483 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
1024611140 7:51065441-51065463 CTCCATAAACTGTAGGGGCAAGG + Intronic
1026008764 7:66620391-66620413 ATCAAAAAAAAGAAGAAGCAGGG - Intergenic
1026036106 7:66831692-66831714 CTCAAAAAAAAGAAATGGCCAGG - Intergenic
1026305846 7:69141088-69141110 TTAAAAAAAAAGTGGGGGAAAGG + Intergenic
1026347166 7:69483924-69483946 CTCAAAAAAAAGGGGGGGGAGGG + Intergenic
1026810155 7:73457131-73457153 CTGAAAAAAAATTAGAAGCAGGG + Intronic
1026863353 7:73808137-73808159 CTCAAAAAAAAAGAGAGACAGGG - Intronic
1028177935 7:87679387-87679409 CTTAAAAAAAAGTTGGGGGCCGG - Intronic
1028786687 7:94802486-94802508 TTCTAAAAAAAATAGGGGCAAGG - Intergenic
1028996451 7:97105410-97105432 CTCAAAAAAAAGAGGAGGCAGGG + Intergenic
1029487073 7:100849871-100849893 CTCAAAAAAAAAAAAGGGAAGGG - Intronic
1029489421 7:100862257-100862279 CTCAAAAAAAAGCGGGGGAGGGG - Intronic
1029577813 7:101415149-101415171 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1030020208 7:105266874-105266896 TTTAATAAAAAGTAGGGGCAAGG + Intronic
1030847554 7:114439703-114439725 CACAAAAAAAATTAGGAGCTAGG - Intronic
1030976715 7:116133542-116133564 AAAAAAAAAAAGTAGGGGGATGG + Intronic
1030979273 7:116167070-116167092 CTCAAATAAAAGTGTCGGCAGGG - Intergenic
1031867495 7:127053785-127053807 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
1031907251 7:127474428-127474450 CTCAAAGAGAAGTAGGGGGAAGG - Intergenic
1032404605 7:131646949-131646971 CTCAAAAAAAAGGCCGGGCCTGG - Intergenic
1032453727 7:132056149-132056171 ATCAATTAAAAGTAGGGGCAAGG - Intergenic
1034014253 7:147565290-147565312 CTCAAAATAAAGCAGGGGAAAGG + Intronic
1034457382 7:151178251-151178273 GAAAAAAAAAAGTAGGGTCAGGG + Intronic
1034705028 7:153134000-153134022 CTCGAAAAAAAGTATGGGAATGG - Intergenic
1036004295 8:4644406-4644428 CTCAAAAAAAAATAGGGCAAAGG - Intronic
1036235285 8:7034705-7034727 CTCAAAAAAAATTGGGGTGAAGG - Intergenic
1036378984 8:8224500-8224522 CTCAAAAAAAAATTGAGTCAGGG - Intergenic
1036797157 8:11764561-11764583 CTTAAAAAAAAGGAGGGGACCGG + Intergenic
1037464733 8:19149045-19149067 CTCAAATCAAAGTATTGGCAGGG - Intergenic
1037846474 8:22287082-22287104 CTCAAAAAAAAAAAGGGAGATGG + Intronic
1038157385 8:25002582-25002604 CTCATAAAAGAGTATGGGCATGG + Intergenic
1038304429 8:26385600-26385622 CTCAAAAAAAAAAAGGGGCGAGG + Intronic
1038980535 8:32754576-32754598 TAAAAAAAAAAGGAGGGGCAGGG + Intronic
1039716201 8:40111940-40111962 CCCAAAAGAAATTAGAGGCAGGG - Intergenic
1039864531 8:41489949-41489971 CCCAAAGAAGAGTCGGGGCAGGG + Intergenic
1039867213 8:41516055-41516077 ACAAAAAAAAAGTAGGGGCTGGG + Intergenic
1040502743 8:48019524-48019546 CTCAAAAAAACGGCAGGGCATGG + Intronic
1040871413 8:52103457-52103479 TTCAAAAAAATGTTGGGGCCAGG + Intergenic
1041272571 8:56123365-56123387 AAAACAAAAAAGTAGGGGCAGGG + Intergenic
1041988530 8:63955908-63955930 CTCAAAAAGCAGTAGAGGGATGG - Intergenic
1042275550 8:67001527-67001549 GTCACAAAAAAGTAGGGGATAGG - Intronic
1042837199 8:73089872-73089894 CTCAAAAAAAAGTAGGGGCAGGG - Intronic
1043023708 8:75040004-75040026 CTCAAAAAAAAGTAAGTGGATGG - Intergenic
1043072134 8:75651507-75651529 CTCAAAAAAAAATAAGGCAATGG + Intergenic
1043320901 8:78985142-78985164 TTCAAAAAAAATTAAGAGCAGGG + Intergenic
1043690179 8:83141302-83141324 CTCTAAAAAAAGAAAGGTCAGGG + Intergenic
1044913230 8:97084380-97084402 CTCAAGAAAAAGATGGGGGAGGG - Intronic
1045004855 8:97908937-97908959 CTCAAAAAAAAAAGGGGGCGGGG - Intronic
1045380717 8:101621924-101621946 AGGAAAAAAAAGTAGGGGGATGG + Intronic
1045909762 8:107393506-107393528 TTTAAAAAAAATTAGGGGGATGG + Intronic
1046356680 8:113095308-113095330 TTAAAAAGAAAGTAGGAGCAAGG - Intronic
1048474553 8:134731711-134731733 TTTAAAAAGAAATAGGGGCAGGG + Intergenic
1049096861 8:140553697-140553719 CTCAAAAAAAAGGCCAGGCATGG - Intronic
1049230887 8:141480566-141480588 CTCAAAAGAAGGGAGGGACAAGG - Intergenic
1049999192 9:1058328-1058350 CTCAAAAAAAAGGGGGGGTGGGG - Intergenic
1050136450 9:2470522-2470544 TTTTAAAAAAAGCAGGGGCAGGG + Intergenic
1050454180 9:5817186-5817208 CTCAAAAAAAAGGCTGGGCACGG - Intronic
1050506774 9:6356993-6357015 CCCAAGAAAAAGAAGAGGCATGG + Intergenic
1051011467 9:12419370-12419392 CACAAGAAAAAGAAGGGGCCAGG - Intergenic
1052330736 9:27265264-27265286 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1052685756 9:31753523-31753545 CTCAAGAAGAAGGAGGGGGAGGG - Intergenic
1052891173 9:33701590-33701612 CTTAAAAAAAAATTGGGGCCAGG + Intergenic
1053440155 9:38109381-38109403 CTCAAAAAAAAGGGGGGGGTGGG - Intergenic
1054752420 9:68921477-68921499 CTCAGAAAACAGGAGGGGAATGG - Intronic
1054894488 9:70293337-70293359 CTAAAAAAAGAGTAGGGGGGTGG - Intronic
1055364581 9:75528798-75528820 CTCAAAAAAAAGAAAAGGCTGGG - Intergenic
1055453908 9:76455570-76455592 TTAAAAAAAAAGTAAGGGGATGG - Intronic
1056651688 9:88470593-88470615 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1057184815 9:93051295-93051317 ATCAAAAAAAAATGGGGGCTGGG + Intergenic
1057196323 9:93117343-93117365 CTCAAAAAAAAAAAGGGGCCGGG - Intergenic
1057403064 9:94741569-94741591 TTTAAAAAAAAGAAGGGGGAAGG - Intronic
1057736782 9:97669921-97669943 CTCAAAAAAAAGGTGGGGCGGGG - Intronic
1058075824 9:100649793-100649815 CTTAAAAAAAAGTTAGGGAATGG + Intergenic
1058468562 9:105253723-105253745 CTCAAAAAAAAATAAAGACAGGG - Intronic
1058716018 9:107722549-107722571 TTGAAAAAGAAGTAGGGGCCAGG - Intergenic
1060127860 9:121067265-121067287 CTCAAAAAAAAAAATAGGCAGGG + Intergenic
1060143307 9:121229174-121229196 CTGAAGACAAAGTAGGGGGAGGG - Intronic
1060202905 9:121662120-121662142 CTTAAAGAAAAGAAGGGGAAGGG - Intronic
1060258541 9:122053664-122053686 CCCAGAAAAAAGTATGCGCAGGG + Intronic
1060509234 9:124220025-124220047 CTCAAAAAAAAATATCGGCCAGG - Intergenic
1060795521 9:126510167-126510189 ATAAAAAAAAATTAGGAGCATGG + Intergenic
1060997038 9:127880134-127880156 TTTAAAAAAAAATAGGGGCCGGG - Intergenic
1061379563 9:130245934-130245956 CTCCAGAAAAAGCGGGGGCAAGG - Intergenic
1061985473 9:134127844-134127866 CACAAAAGAAAGTGGGGGCGGGG - Intergenic
1203639553 Un_KI270750v1:147542-147564 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1185682769 X:1902111-1902133 CTCAAAAAAAAAAAGAGGCTGGG - Intergenic
1186323372 X:8453204-8453226 CTTTAAAAAAAGTGGGGGGAGGG + Intergenic
1186425474 X:9461759-9461781 CTAAAAAAAAATTAGAGACAAGG + Intergenic
1187176928 X:16904361-16904383 AGAAAAAAAAAGTAGGGGGAGGG + Intergenic
1187256077 X:17643612-17643634 CTTGAAAAAAGGGAGGGGCATGG + Intronic
1187353117 X:18540687-18540709 CTCAAAAAAAAAGAAGGGAAGGG - Intronic
1187353884 X:18548083-18548105 CTTAAAAGAAAGTAGAGGAAAGG + Intronic
1187474992 X:19602727-19602749 CTAAATAAAAATTAGGGCCAGGG + Intronic
1187481081 X:19656239-19656261 ATGAAAAATAAGTAGAGGCATGG + Intronic
1188181025 X:27056228-27056250 CTCAAAAAAAAGAAAAGGAAAGG - Intergenic
1188495215 X:30776186-30776208 CTCAAAAAAAAAAAGAGGCCAGG - Intergenic
1189477636 X:41368405-41368427 TTAAAAAAAAAGTAGGGGCTGGG - Intergenic
1190560034 X:51677972-51677994 CTACAAAAAAAGTAGGAGGAGGG - Intergenic
1190564257 X:51715349-51715371 CTACAAAAAAAGTAGGAGGAGGG + Intergenic
1190834756 X:54090229-54090251 CTCAAAAAAAAAGAAGGGCAAGG - Intronic
1190864743 X:54375196-54375218 CTCAAAAAAAAGGCCGGGCGTGG - Intergenic
1192163316 X:68804893-68804915 CTCAAAAAAAGGTAGGAGATTGG + Intergenic
1193217976 X:78887024-78887046 CTGAAAAAAAGGTGGGGGGAGGG + Intergenic
1194641972 X:96413354-96413376 CTCAAAAAAAAATGGGGGGGGGG - Intergenic
1194728405 X:97426283-97426305 CTCAAAAAAAAAAAAAGGCAGGG - Intronic
1194729773 X:97439744-97439766 CTCAAAATAAAAGAGGGGCGGGG + Intronic
1195699356 X:107690837-107690859 CTTAAAAAAAAATAGAGGCCAGG - Intergenic
1195950577 X:110268017-110268039 CTCCAAAACAAGCAAGGGCATGG + Intronic
1196468507 X:115997168-115997190 TTCAAAAAAAATTAGGAGGAGGG - Intergenic
1197066414 X:122238530-122238552 ATGAAACAAAAGTGGGGGCAAGG - Intergenic
1197152510 X:123235233-123235255 CTCAGAAAAGGGGAGGGGCAGGG + Intronic
1197230886 X:124002622-124002644 CTCAAAAAAAATCAGGTGTATGG - Intronic
1197382045 X:125756741-125756763 CTCAAAAGATAGCAAGGGCACGG + Intergenic
1197439591 X:126472991-126473013 GTTAAAAAATAGTAGGGGGATGG - Intergenic
1197816861 X:130506660-130506682 CACAAAAAAAAGGAGAGGGAAGG - Intergenic
1198769199 X:140110407-140110429 TTCAAAAAAAAGAAGGGGGGGGG + Intergenic
1199835116 X:151582276-151582298 CTCAAAAAAAAGCGGGGGCCAGG - Intronic
1200329568 X:155282184-155282206 CTGAAAGAAAAGTGGGAGCAAGG - Intronic
1201379208 Y:13354395-13354417 CTCAAAAAAAAAGGGAGGCAGGG + Intronic
1202060502 Y:20882492-20882514 CCAAAAAAATAGTAGGGGGAAGG - Intergenic
1202063969 Y:20917916-20917938 TTTAAAAAAAGGTAAGGGCATGG - Intergenic
1202323158 Y:23657720-23657742 CTCAAAGAAAAGAAGAAGCAAGG + Intergenic
1202547614 Y:26012334-26012356 CTCAAAGAAAAGAAGAAGCAAGG - Intergenic