ID: 1042847213

View in Genome Browser
Species Human (GRCh38)
Location 8:73180535-73180557
Sequence GCGTCTCTTTCCTACCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042847212_1042847213 6 Left 1042847212 8:73180506-73180528 CCAAATTCAGCAAGCTTCTTGAA No data
Right 1042847213 8:73180535-73180557 GCGTCTCTTTCCTACCATCCTGG No data
1042847210_1042847213 21 Left 1042847210 8:73180491-73180513 CCAGATCTACACCATCCAAATTC No data
Right 1042847213 8:73180535-73180557 GCGTCTCTTTCCTACCATCCTGG No data
1042847211_1042847213 10 Left 1042847211 8:73180502-73180524 CCATCCAAATTCAGCAAGCTTCT No data
Right 1042847213 8:73180535-73180557 GCGTCTCTTTCCTACCATCCTGG No data
1042847209_1042847213 22 Left 1042847209 8:73180490-73180512 CCCAGATCTACACCATCCAAATT No data
Right 1042847213 8:73180535-73180557 GCGTCTCTTTCCTACCATCCTGG No data
1042847208_1042847213 23 Left 1042847208 8:73180489-73180511 CCCCAGATCTACACCATCCAAAT No data
Right 1042847213 8:73180535-73180557 GCGTCTCTTTCCTACCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042847213 Original CRISPR GCGTCTCTTTCCTACCATCC TGG Intergenic
No off target data available for this crispr