ID: 1042847992

View in Genome Browser
Species Human (GRCh38)
Location 8:73187376-73187398
Sequence CCTCGCGTGTACAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042847992_1042848002 9 Left 1042847992 8:73187376-73187398 CCTTCCTCCTTGTACACGCGAGG No data
Right 1042848002 8:73187408-73187430 TAACCGCCTTGTGCTCTCACGGG No data
1042847992_1042848006 17 Left 1042847992 8:73187376-73187398 CCTTCCTCCTTGTACACGCGAGG No data
Right 1042848006 8:73187416-73187438 TTGTGCTCTCACGGGCATGGTGG No data
1042847992_1042848004 14 Left 1042847992 8:73187376-73187398 CCTTCCTCCTTGTACACGCGAGG No data
Right 1042848004 8:73187413-73187435 GCCTTGTGCTCTCACGGGCATGG No data
1042847992_1042848001 8 Left 1042847992 8:73187376-73187398 CCTTCCTCCTTGTACACGCGAGG No data
Right 1042848001 8:73187407-73187429 ATAACCGCCTTGTGCTCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042847992 Original CRISPR CCTCGCGTGTACAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr