ID: 1042854302

View in Genome Browser
Species Human (GRCh38)
Location 8:73250348-73250370
Sequence ATTACTTACATATAAATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 492}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042854300_1042854302 2 Left 1042854300 8:73250323-73250345 CCTGAATATTATATATTATCATA 0: 1
1: 0
2: 6
3: 40
4: 529
Right 1042854302 8:73250348-73250370 ATTACTTACATATAAATTCAGGG 0: 1
1: 0
2: 4
3: 45
4: 492
1042854299_1042854302 18 Left 1042854299 8:73250307-73250329 CCTTAGTCTTCTTTAGCCTGAAT 0: 1
1: 0
2: 0
3: 20
4: 220
Right 1042854302 8:73250348-73250370 ATTACTTACATATAAATTCAGGG 0: 1
1: 0
2: 4
3: 45
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042854302 Original CRISPR ATTACTTACATATAAATTCA GGG Intronic
902109083 1:14063076-14063098 ATTACTGACATGTGAATTAATGG + Intergenic
902270834 1:15303537-15303559 ATTATTTATAGATAATTTCACGG - Intronic
906741310 1:48188058-48188080 AGTCCTTACATATAATTTAATGG + Intergenic
907339357 1:53723532-53723554 ATTACTTACATTTAAATTTAAGG - Intronic
907478637 1:54727003-54727025 AATATTCACATAGAAATTCAAGG + Intronic
908146008 1:61244523-61244545 TTAACTCACATATACATTCAAGG - Intronic
909829314 1:80166001-80166023 TTTATTTACATATTTATTCACGG - Intergenic
909875818 1:80801192-80801214 ATTACATACATGTAATTTAATGG + Intergenic
909881891 1:80890095-80890117 AAAATTTACATATAATTTCATGG - Intergenic
910507927 1:87971430-87971452 ATTACTAACTTATAGTTTCAGGG - Intergenic
910734606 1:90439098-90439120 ATTAACTACATATAATTTAAAGG + Intergenic
910984492 1:92992384-92992406 ATGGCCTACATATAAATTCCTGG - Intergenic
911427594 1:97739489-97739511 AATACTTTTATATAAATTTAGGG - Intronic
911446272 1:97996811-97996833 ATTGATTAAATATAGATTCATGG + Intergenic
911788106 1:101976622-101976644 TTTACTTATATACAAATTTAGGG - Intronic
911950786 1:104171925-104171947 ATTAATTACATATAAATCAAGGG + Intergenic
913712341 1:121497682-121497704 ATTACCTACATATTGAATCAAGG - Intergenic
914377908 1:147089352-147089374 AATATTAGCATATAAATTCACGG + Intergenic
914450376 1:147786392-147786414 TTTAATTACATACAAATTAAGGG + Intergenic
915061479 1:153189562-153189584 GTTACTTACATATAAAAAGATGG - Intergenic
916139206 1:161679172-161679194 ATAATTTACATATAAATAAAAGG - Intergenic
917179119 1:172274748-172274770 ATTACTTGCAGATCAATGCAAGG + Intronic
917208417 1:172603266-172603288 AATACTTACATTTAAATGAATGG + Intronic
917325920 1:173832263-173832285 AATACTTACGTTTAAGTTCATGG + Intronic
918224683 1:182470949-182470971 TTTACCTACATATATATTGAAGG - Intronic
918455840 1:184713054-184713076 ATTACTTGCATGTAATTTCCTGG + Intronic
918598370 1:186320629-186320651 ATTAATTACATATAAATCACAGG - Intronic
918760607 1:188400569-188400591 ATTACTTGGCTATAAATACATGG - Intergenic
919286585 1:195569652-195569674 ATTTATTCCATATATATTCAAGG - Intergenic
919317733 1:195996602-195996624 ATTATTCACATATGAATTTAAGG + Intergenic
920994171 1:210971470-210971492 ATTAGTTACATCAAAATCCAAGG + Intronic
921234334 1:213109502-213109524 AATGCTTACAAATAAATTTAAGG - Intronic
921845343 1:219873458-219873480 GTTAGTTACATATATATACATGG - Intronic
921885853 1:220304670-220304692 ATAACTTACAAATATGTTCAAGG + Intergenic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
923347444 1:233068332-233068354 ATTATTTACCTATTATTTCAGGG - Intronic
924160827 1:241230048-241230070 AAAACTTAAATATAAATTGATGG - Intronic
924390830 1:243554686-243554708 GTTACTTAGATATAAATTTTTGG - Intronic
924450043 1:244169841-244169863 ATTATATATATATATATTCAAGG + Intergenic
1063062478 10:2570841-2570863 ACTAGTTACATATGAATTTATGG - Intergenic
1063533849 10:6863420-6863442 ATTACATACATGCAAATTAAGGG + Intergenic
1064458261 10:15508609-15508631 ACTCCTTACATATAAATCAATGG + Intergenic
1065053895 10:21823621-21823643 TTTACTTACATATAAACCAAGGG + Intronic
1065337178 10:24664607-24664629 ATTTAGTACACATAAATTCACGG - Intronic
1065423083 10:25568724-25568746 ATTAATAGCAGATAAATTCATGG - Intronic
1065517298 10:26537057-26537079 ATTACATACTTATAAATTTGAGG - Intronic
1065681400 10:28237127-28237149 GTTGCTTACATATAACTTGAAGG - Intronic
1067117157 10:43444390-43444412 TTTATTTATATATAATTTCAGGG + Intronic
1067498453 10:46779974-46779996 ATTACTTCTACATAAATTCACGG + Intergenic
1067596195 10:47560439-47560461 ATTACTTCTACATAAATTCACGG - Intergenic
1068340661 10:55698014-55698036 ATTTCTTACATAAAATTTCCAGG - Intergenic
1068546806 10:58356297-58356319 ATAATATACATATAAATTCTAGG - Intronic
1068876801 10:62005698-62005720 TTTCCTTTCATAAAAATTCAAGG - Intronic
1069149876 10:64947243-64947265 AATATTTACATAAAAATACATGG - Intergenic
1069709617 10:70480007-70480029 ATTACTCACATAGCAATTAATGG - Intronic
1071155130 10:82678898-82678920 ATTACATACATATGTATACACGG - Intronic
1071219635 10:83449968-83449990 AGTGCTTAGATATAAATTAAAGG + Intergenic
1071314062 10:84374668-84374690 AATATGCACATATAAATTCATGG - Intronic
1071350415 10:84735325-84735347 TTTAATTACATATTAATTCCAGG + Intergenic
1072582646 10:96752731-96752753 ATATTTTACATATGAATTCAAGG + Intergenic
1073089319 10:100921052-100921074 ATTAATCACATACAAGTTCAGGG + Intronic
1073921411 10:108464154-108464176 AGTATTTACATATACATTAAGGG - Intergenic
1074294985 10:112177771-112177793 TGTACTTACAGATAATTTCAGGG - Intronic
1075355471 10:121769189-121769211 AGGACTGACATATAAATACATGG + Intronic
1075504052 10:123006677-123006699 TTTACTTACATAATAATTTATGG + Intronic
1079227280 11:18617945-18617967 CTTACTTACTTATAGATTGATGG - Intronic
1079449027 11:20583282-20583304 AGAATTCACATATAAATTCAGGG - Intergenic
1079946202 11:26744818-26744840 ATTTCTTACATAGTAATTTAGGG - Intergenic
1080057380 11:27920150-27920172 ATTACATACAAATAAATTTGGGG + Intergenic
1080126304 11:28738171-28738193 AATAATTATATATAATTTCAGGG - Intergenic
1080280145 11:30547720-30547742 TTTTATTCCATATAAATTCATGG + Intronic
1080527222 11:33135591-33135613 TTTACTCACATATAAAATGAGGG + Intronic
1080932498 11:36826406-36826428 ATTATTTATATATAAAGTCTCGG - Intergenic
1081012903 11:37838242-37838264 AATACTTTCATATAAATGGAAGG - Intergenic
1081024947 11:37999800-37999822 ATTTCTTACATATAAACCAATGG - Intergenic
1081041420 11:38219230-38219252 ATTATTTAAATTTAAATTAATGG + Intergenic
1081075774 11:38671991-38672013 ATTACTAACAGGAAAATTCAGGG + Intergenic
1081143284 11:39531111-39531133 ATTTAATACATTTAAATTCAAGG + Intergenic
1082559521 11:54601877-54601899 ATTAGTTAAATATACAATCATGG - Intergenic
1083075232 11:60029969-60029991 ATTTGTTAAATATAACTTCAAGG + Intergenic
1083703398 11:64496248-64496270 ATCACCTTAATATAAATTCAGGG - Intergenic
1085090253 11:73706085-73706107 ATTACTTACATTATGATTCAAGG + Intronic
1086019103 11:82204612-82204634 ATTACTAACATCAAAATCCAGGG + Intergenic
1086124913 11:83340456-83340478 TTTACTTACAGATAACTTGAAGG + Intergenic
1086322098 11:85661849-85661871 ATTAGTTAAATTTCAATTCAAGG + Exonic
1086630192 11:89008212-89008234 AGTGCTGACATGTAAATTCAAGG + Intronic
1087324343 11:96702460-96702482 ATTTCTTAAATTTAAATTAATGG + Intergenic
1087580389 11:100043894-100043916 TTTATTTTTATATAAATTCAAGG + Intronic
1087944939 11:104147544-104147566 ATTAATCACATTTAAATTCTAGG + Intronic
1088108681 11:106235461-106235483 AATATTTACATTTAAATTTATGG + Intergenic
1089711882 11:120321282-120321304 ATTTCTTTCATAAAAAATCACGG - Intergenic
1089921018 11:122209652-122209674 TTTTCCTACTTATAAATTCAAGG - Intergenic
1090585703 11:128210060-128210082 TTTTCTTACAAATAAATACAGGG - Intergenic
1090898461 11:131002952-131002974 TTTACTCATATATAAATTCTGGG + Intergenic
1092614737 12:10206497-10206519 ATTTCTTACATATGAACTAAAGG - Intergenic
1095660200 12:44723734-44723756 TTTACTGACACATAATTTCAGGG + Intronic
1095830304 12:46578635-46578657 ATTACTGAGATATTAATTGAAGG - Intergenic
1095887011 12:47199177-47199199 ATTACTTAGGTATAAATCTAAGG + Intronic
1097420443 12:59372231-59372253 TTTTCTTAAATATAAATTCAAGG - Intergenic
1097484366 12:60176261-60176283 ATCACTTACCTATAAAATGAGGG - Intergenic
1097505945 12:60470277-60470299 ATTACCAACATATAAATATATGG + Intergenic
1097510071 12:60528472-60528494 ATTTCTTACATACATATTTATGG - Intergenic
1097604477 12:61735462-61735484 ATTACATAAAGATCAATTCAGGG + Intronic
1098302099 12:69064704-69064726 ATGACATACATTTAAATTAATGG - Intergenic
1098790722 12:74818020-74818042 AATACTTGCAGAAAAATTCATGG + Intergenic
1098886542 12:75966483-75966505 ATTACTCACATGTCAAATCAAGG - Intergenic
1099215422 12:79847157-79847179 TTTACACACATATAAATTTATGG - Intronic
1100322990 12:93514660-93514682 ATTTATTTCATATAGATTCAGGG - Exonic
1100717397 12:97320557-97320579 ATTACTTACATATTGAGACATGG + Intergenic
1101828600 12:108240148-108240170 ATGACTTACAAAAACATTCACGG - Intronic
1101932421 12:109025318-109025340 ATTACATAGATATAAATATAAGG - Intronic
1102614569 12:114142188-114142210 ATTACTTAAATATATTATCACGG + Intergenic
1103284556 12:119789487-119789509 ATTTCTTTTATAGAAATTCATGG - Intronic
1103432121 12:120897317-120897339 ATGATTTAAATATAAATTCATGG + Intronic
1103670265 12:122608602-122608624 TTAACTTACATGTAAGTTCAAGG + Intronic
1104366272 12:128180686-128180708 ATTAATTTCATCTATATTCAAGG + Intergenic
1104885013 12:132102037-132102059 ATCACCTTCATAGAAATTCAAGG - Intronic
1105717158 13:23078726-23078748 ATTAATAAGATATAAATTAATGG - Intergenic
1106676812 13:31968562-31968584 ATAACTTAAATATCAATTGAAGG - Intergenic
1106819874 13:33452671-33452693 ATTCCTTACATATAAAATGGAGG + Intergenic
1108126775 13:47253008-47253030 ATTACTTGCATATGATTACAAGG + Intergenic
1108197303 13:48007881-48007903 ATTAATAAAATAAAAATTCATGG + Intergenic
1108926775 13:55758924-55758946 TATACATACATATAAATTTATGG - Intergenic
1109065987 13:57691740-57691762 ATTATTTAAATTTTAATTCATGG + Intronic
1109098080 13:58143683-58143705 ATTCCTTACCAATAAATTCAGGG + Intergenic
1109364461 13:61338101-61338123 CTTGCTAACATAAAAATTCATGG + Intergenic
1109428672 13:62201916-62201938 ATAACTTACAAAAAAATTCAAGG - Intergenic
1109439900 13:62356454-62356476 ATCAATTAAATATAAATTTATGG + Intergenic
1109445525 13:62434315-62434337 ATTTGTTACATATAAAATGAAGG + Intergenic
1109765861 13:66896270-66896292 ATTACTTCATTGTAAATTCATGG - Intronic
1110012772 13:70358897-70358919 ATTAGTTAGCTATAAATGCATGG - Intergenic
1110639975 13:77812541-77812563 GTTAATTACACATAACTTCAAGG + Intergenic
1110781228 13:79467324-79467346 ATTATTTACATATCAAACCAAGG + Intergenic
1110980687 13:81893152-81893174 ATCAATTACAAATAAATTAATGG - Intergenic
1111143150 13:84148739-84148761 ATAACTTAGATATAAATTAAAGG - Intergenic
1111623174 13:90750025-90750047 ATTATTTTCATCTAAATTAAAGG - Intergenic
1111772322 13:92613695-92613717 ATTATATATATATAAAATCAGGG + Intronic
1112528023 13:100171514-100171536 ATTACTTCCATGTCAAGTCAAGG + Intronic
1113152216 13:107276521-107276543 AATACATACACATAAATTCTGGG + Intronic
1113350983 13:109529138-109529160 ATCACATATAAATAAATTCATGG - Intergenic
1113678856 13:112228032-112228054 AATGCTTACACACAAATTCAAGG + Intergenic
1114930697 14:27464415-27464437 CTTAATTAGATATACATTCACGG - Intergenic
1115410838 14:33072791-33072813 ATTCATTACCTATAATTTCAAGG - Intronic
1115764886 14:36613524-36613546 AATTTTTACATATAACTTCAAGG - Intergenic
1116187535 14:41616826-41616848 ATCACTAACATATATATTGAAGG - Intronic
1116669604 14:47823779-47823801 AATACATACTTATAAATTTAAGG - Intergenic
1117216363 14:53556679-53556701 ATCACACACATATATATTCATGG - Intergenic
1117565163 14:56986993-56987015 AATACATGTATATAAATTCATGG - Intergenic
1118719157 14:68581458-68581480 ATTACATCCAGATAAATGCAGGG - Intronic
1119010014 14:70975436-70975458 ATTAATTAATTAAAAATTCACGG - Intronic
1120045030 14:79796141-79796163 ATTACATACATATAAAGGCCTGG - Intronic
1120077462 14:80175113-80175135 ATTACTTGCATATACATTCTGGG - Intergenic
1121481593 14:94281524-94281546 AATACATACACACAAATTCAGGG - Exonic
1121508903 14:94497651-94497673 ATAAATCACATATGAATTCAAGG + Intronic
1123163693 14:106305116-106305138 ATTACTTCTAAATAAATTCAAGG + Intergenic
1124243154 15:28047849-28047871 ATTTTCTACATATAGATTCATGG - Intronic
1125103645 15:35945475-35945497 ATTACTTTGATAGAAGTTCAGGG - Intergenic
1126288152 15:47040334-47040356 TTCACTTACATATAAATAAATGG + Intergenic
1127406155 15:58648761-58648783 ATTACGGACATACAAATTAAAGG + Intronic
1127603555 15:60562887-60562909 GTTATTTAAATATAAATTCTTGG + Intronic
1128123904 15:65176170-65176192 ACTACTAACATACAAATTCTAGG + Intronic
1128126948 15:65200068-65200090 ACTACTTGCATTTAAATCCAGGG - Intronic
1131645240 15:94334987-94335009 AGTACTTCCATAGAACTTCATGG - Intronic
1131713533 15:95081952-95081974 ATTACTTTATTATAAATTCAAGG + Intergenic
1131720577 15:95163993-95164015 ATTAATTAAATTTTAATTCAGGG - Intergenic
1134797234 16:17052382-17052404 ATTAAGTACATTTACATTCAGGG + Intergenic
1135011089 16:18879425-18879447 ATTTCTTACATATCGATTTAAGG + Intronic
1135094150 16:19550041-19550063 TTTAGATACATATTAATTCAAGG - Intronic
1135317982 16:21467022-21467044 ATTTCTTACATATCCATTTAAGG + Intergenic
1135370877 16:21898817-21898839 ATTTCTTACATATCCATTTAAGG + Intergenic
1135440908 16:22471900-22471922 ATTTCTTACATATCCATTTAAGG - Intergenic
1136314749 16:29446732-29446754 ATTTCTTACATATCGATTTAAGG + Intronic
1136328191 16:29548468-29548490 ATTTCTTACATATCGATTTAAGG + Intergenic
1136442876 16:30288491-30288513 ATTTCTTACATATCGATTTAAGG + Intergenic
1138959660 16:62013449-62013471 AATACATACATCTATATTCATGG + Intronic
1139889623 16:70240966-70240988 ATTTCTTACATATCGATTTAAGG + Intergenic
1141352922 16:83315756-83315778 ATAATTTAGATATAAATTGATGG - Intronic
1141486341 16:84342796-84342818 ATTATTTTCATATAAATTCTTGG - Intergenic
1142129329 16:88425580-88425602 ATTCCTCACCCATAAATTCAGGG + Intergenic
1143915019 17:10284761-10284783 ATTACTAACAGGTAAATTCCAGG + Intergenic
1144150563 17:12439384-12439406 ATTAAGTACTTACAAATTCACGG - Intergenic
1146143093 17:30386815-30386837 ATTACTAACATATACATTCAAGG - Intronic
1146328713 17:31909728-31909750 ATTAATTAAATATAGAGTCAGGG - Intergenic
1147589450 17:41672313-41672335 TTTACTTACATAGAAACCCAGGG - Intergenic
1148257890 17:46152542-46152564 ATTAGTTTCACCTAAATTCAGGG - Intronic
1149072657 17:52561296-52561318 ATTAATTACAGATAATTTAAAGG - Intergenic
1149977051 17:61276712-61276734 AAAATTTACATATAAATTCAAGG + Intronic
1151462909 17:74265661-74265683 CTTGCTTACATACAAATTCAGGG + Intergenic
1153423284 18:4933042-4933064 ATTCCTTACAAATTTATTCAAGG - Intergenic
1155822782 18:30399084-30399106 AGTACATACATATATATTAATGG - Intergenic
1155836125 18:30586487-30586509 ATCATTGACATATAAACTCATGG - Intergenic
1156160448 18:34351815-34351837 TTTAATTACATGTAAATTAAGGG - Intergenic
1156197317 18:34789810-34789832 ATAACTTTCATATAATTTCTAGG + Intronic
1156541529 18:37916540-37916562 AATACTTGGATATAAATTGATGG + Intergenic
1159149495 18:64503231-64503253 ATTACATATCTAGAAATTCAAGG - Intergenic
1159338046 18:67096678-67096700 ATTACATTAATATAAATACAAGG + Intergenic
1160090706 18:75824288-75824310 ATAGCTGCCATATAAATTCAAGG - Intergenic
1161248118 19:3266114-3266136 TTTAATTACATTTAAATTAAGGG + Intronic
1164929010 19:32159300-32159322 ATTACTTACAAATCAACTTAGGG + Intergenic
1165084455 19:33333925-33333947 ATTCCTTATATGTACATTCAGGG + Intergenic
1165190102 19:34056087-34056109 ATAACTCTCATATAAATTCATGG + Intergenic
1166115909 19:40654346-40654368 ATTACTTTCATAATAATTCCAGG - Intergenic
1167773537 19:51538967-51538989 ATTACTTATATATCAAATAAAGG - Intergenic
1167867693 19:52341607-52341629 ATTAATTAAAAATAAATTTAGGG - Intronic
925842227 2:8003312-8003334 ATTCATTATCTATAAATTCAGGG - Intergenic
926577036 2:14593794-14593816 ATGACTTACTTACAAATTCCTGG + Intergenic
927229393 2:20805817-20805839 AATACAAACATATAAAGTCATGG + Intronic
927404594 2:22752901-22752923 ATTACAAACATATTAGTTCATGG - Intergenic
927626910 2:24731142-24731164 AATACTTTTATAAAAATTCAAGG - Intronic
928703278 2:33920617-33920639 ATTAATTAAATGCAAATTCAGGG - Intergenic
928880816 2:36094431-36094453 ATTACTTTAATTTAAATTTATGG + Intergenic
930934243 2:56928282-56928304 ATTATTTTTAGATAAATTCAAGG + Intergenic
930940654 2:57010490-57010512 ATTTCCTACATATATAATCATGG - Intergenic
931165252 2:59740238-59740260 TTTTCTTACATTTAAATTCTTGG - Intergenic
931570935 2:63668566-63668588 ATAACGTAAATATATATTCATGG + Intronic
931674468 2:64680370-64680392 ATTATTTACATGTGCATTCAGGG + Intronic
932189250 2:69725379-69725401 TTTATTTATATATAAATACATGG + Intronic
933641659 2:84768835-84768857 AAAACTTATATATAAATGCAAGG + Intronic
937582771 2:123508339-123508361 TTAACTTACATATAAATTCCAGG - Intergenic
939447423 2:142328377-142328399 ATGACTTACATATAAATAAAAGG + Intergenic
939717461 2:145602462-145602484 ATTACTTATATTTATATTTAGGG + Intergenic
941458939 2:165744230-165744252 ATAAATGACCTATAAATTCATGG + Intergenic
941976573 2:171411820-171411842 ATTGCTTACATTTAAATGTATGG + Intronic
942549472 2:177100009-177100031 TTTCCTTACATATAAAAACAGGG - Intergenic
942705208 2:178764124-178764146 AATACTTACAAATAATTACATGG - Intronic
943098694 2:183460156-183460178 ATTCCCTGGATATAAATTCAAGG - Intergenic
944945599 2:204681310-204681332 TTTAATTACATATAAAATGAGGG - Intronic
944993103 2:205260627-205260649 ATCACTTTCATATAATTTCTTGG + Intronic
945358049 2:208861698-208861720 ATTTCATATATATAAAATCAGGG + Intergenic
945595969 2:211793319-211793341 AATACTTAGATATACAATCAGGG - Intronic
945763135 2:213940017-213940039 ATTTCTTATCTACAAATTCAAGG + Intronic
947283704 2:228485285-228485307 ACTACTAAGGTATAAATTCAGGG + Intergenic
947540608 2:230974943-230974965 GTGACTTAGATATAAAATCAGGG - Intergenic
947784468 2:232803464-232803486 ATAATTTACATTTAAGTTCATGG + Intronic
948557528 2:238823828-238823850 TTTAATTACATACAAATTAAGGG - Intergenic
1168819771 20:765034-765056 ATTACTTACATACATACGCATGG - Intronic
1169549127 20:6684155-6684177 ATTACTTACATAATAACTAAGGG - Intergenic
1169579779 20:7007281-7007303 AGTAATTACATATATATTTATGG - Intergenic
1170216990 20:13901975-13901997 TTTAATTACATATAGATTAAGGG + Intronic
1170738351 20:19029892-19029914 ATTAGTTTCTTATAAATTTAAGG - Intergenic
1170751571 20:19152678-19152700 ATATCTTACATTTAAATTAATGG - Intergenic
1172582893 20:36062605-36062627 TTTATTTACATGCAAATTCAGGG - Intergenic
1173129470 20:40376139-40376161 TTTACTTTCATATAAATTTTAGG + Intergenic
1176328908 21:5529494-5529516 ATTAGTTGCATCTGAATTCAAGG + Intergenic
1176398849 21:6291457-6291479 ATTAGTTGCATCTGAATTCAAGG - Intergenic
1176438308 21:6697647-6697669 ATTAGTTGCATCTGAATTCAAGG + Intergenic
1176462570 21:7024717-7024739 ATTAGTTGCATCTGAATTCAAGG + Intergenic
1176486131 21:7406495-7406517 ATTAGTTGCATCTGAATTCAAGG + Intergenic
1177509231 21:22062191-22062213 AGTATTTACATATAATTTAAAGG - Intergenic
1177525352 21:22283541-22283563 TTTCCTTACTTGTAAATTCAAGG + Intergenic
1177627602 21:23683924-23683946 CTTACTTAAATATAATATCATGG + Intergenic
1177656777 21:24027100-24027122 ATTGCTAACTTATAAATTCATGG - Intergenic
1177688369 21:24469889-24469911 GTGACTTACATGTAAATTCATGG + Intergenic
1178490492 21:33047938-33047960 ATTACGAACATACAAATTCGTGG - Intergenic
1184866910 22:47206469-47206491 TTTAATTACATGTAAATTGAGGG - Intergenic
949117935 3:350861-350883 ATTATTCACAAAGAAATTCAAGG + Intronic
949196202 3:1311813-1311835 ATGACTTGCATATATGTTCATGG - Intronic
949776066 3:7633752-7633774 ATTACATACAAAGAAATTAACGG - Intronic
949792997 3:7813896-7813918 ATTTTTTAAATATAAAGTCAGGG + Intergenic
949937436 3:9126911-9126933 TTTATTTACGTATAAATTTATGG - Intronic
950775151 3:15343114-15343136 ATAAATTACATAAAAATTGATGG - Intergenic
951399861 3:22218435-22218457 TATATTTATATATAAATTCAAGG - Intronic
951438429 3:22692705-22692727 AATAATTACATTTAATTTCATGG + Intergenic
952092292 3:29902598-29902620 CTACCTTACAAATAAATTCAAGG + Intronic
952194370 3:31057432-31057454 TTTAATTACATATACATTAAGGG - Intergenic
953873135 3:46645001-46645023 TTTAATTATATATAAATTAAGGG + Intergenic
954841056 3:53512160-53512182 ATTATTGAAATATAAATTAATGG + Intronic
957021346 3:75131473-75131495 ATTAATTACATACAAATCAAAGG - Intergenic
957027943 3:75205987-75206009 ATTACTCAAATAAAGATTCAAGG - Intergenic
957159649 3:76593942-76593964 ATTATTTACATAGAAAAGCATGG + Intronic
957229726 3:77496681-77496703 ATTACTTACATAGTAATTACAGG - Intronic
957277158 3:78105384-78105406 AATACTTTCATAAAAATTTAGGG + Intergenic
957280836 3:78149447-78149469 TTTGCTTACATATAAACCCAGGG - Intergenic
957378259 3:79389188-79389210 CTTACTTAAATTCAAATTCAGGG - Intronic
958034473 3:88153297-88153319 AGTACTTAAATATAACTTCTCGG - Exonic
958079880 3:88733761-88733783 ATAACTTAAAAAGAAATTCAGGG + Intergenic
958725343 3:97898708-97898730 ATTACTTCCATATAGTTTAAAGG - Intronic
959044551 3:101458246-101458268 AGTACTTTGACATAAATTCAAGG + Intronic
959058913 3:101597948-101597970 TATACTTACATATAAAATGAGGG - Intergenic
959761380 3:109969629-109969651 TTTAATTGCATATAAATCCACGG - Intergenic
959887882 3:111523479-111523501 TTTCCTTACATATAAAATTATGG - Intronic
960286820 3:115839151-115839173 ATTACTTACATTCAAATAAATGG - Intronic
960308979 3:116097592-116097614 ATTACTTACTTATTTACTCATGG - Intronic
960512118 3:118562861-118562883 ATTACTTAAACATCAATCCATGG - Intergenic
961744939 3:129058681-129058703 ATTCATTACATGCAAATTCAGGG - Intergenic
963456176 3:145551049-145551071 AGTACTTGCATATTAAGTCATGG - Intergenic
963530308 3:146466488-146466510 ATTATCTACATTTTAATTCAAGG - Intronic
963593586 3:147296499-147296521 ATTCCTTATATATAAATATAAGG - Intergenic
963992992 3:151674560-151674582 ATTATTTATATATATTTTCAGGG + Intergenic
964054572 3:152437491-152437513 ATTCCTTACATGTAAAATTAGGG + Intronic
964092473 3:152892833-152892855 ATTATTGAGATAAAAATTCAAGG - Intergenic
964283277 3:155090254-155090276 ATTACTTAATTATTAATACAAGG + Intronic
964669212 3:159206832-159206854 ATTAATCACATATAAAGTAAAGG + Intronic
965287724 3:166839127-166839149 AATACTTACAAATAAATTATAGG + Intergenic
965834624 3:172837855-172837877 TTTACATACATATATATACATGG - Intergenic
967530948 3:190548530-190548552 AATAAGTACATATAAATACAAGG - Intronic
967620496 3:191627937-191627959 TTTAATTACATACAAATTAAGGG - Intergenic
967791491 3:193553873-193553895 GTTATTTACATATTAATTCCAGG + Intronic
968242883 3:197107610-197107632 AATACTTAAGTATAAATTTAAGG - Intronic
970110623 4:12633759-12633781 CTAAATTACATATAAATTTATGG + Intergenic
971541533 4:27823113-27823135 AGTACTTTCTTATACATTCATGG + Intergenic
972232409 4:37090136-37090158 ATTATTTACTTATAAAATCTAGG + Intergenic
972326019 4:38016005-38016027 AGTACTTATAAATAAATGCAGGG - Intronic
972728898 4:41773611-41773633 ATTATTAACATATAAAATTATGG + Intergenic
972929793 4:44057906-44057928 ATTAAATACATGCAAATTCAAGG - Intergenic
974153102 4:58035670-58035692 ATTACTGACATATACACCCATGG - Intergenic
974257889 4:59485692-59485714 ATTAATTCCATAAAAATGCAGGG - Intergenic
974464347 4:62234752-62234774 ACATCTAACATATAAATTCATGG - Intergenic
975901668 4:79160855-79160877 ATTATTTACATGAAAATTTAAGG + Intergenic
976013726 4:80524296-80524318 ATCACCTACATACAAATTAAGGG + Intronic
976889050 4:90022361-90022383 ATTAAGGACATAGAAATTCAAGG - Intergenic
977013734 4:91665772-91665794 ATTAGTTATATAAAAATTCAAGG - Intergenic
977194005 4:94036594-94036616 ATTATCTATGTATAAATTCATGG - Intergenic
977449867 4:97181560-97181582 TTTACTTACATGGAAATTAAAGG - Intergenic
977776223 4:100922237-100922259 GTTAGTTACATATATATACATGG - Intergenic
977801008 4:101231331-101231353 CTGACTTACAGATAAAATCATGG - Intronic
977983766 4:103358500-103358522 AATCCTTACATTTACATTCAAGG - Intergenic
978020553 4:103805636-103805658 ATAACTTATATGCAAATTCAGGG - Intergenic
979089485 4:116463709-116463731 TTTACTTGCATCTAATTTCAAGG + Intergenic
979476297 4:121161631-121161653 ATTACTCACATACATGTTCATGG - Intronic
979713478 4:123808814-123808836 ATTACTTACATTTAAAAACTGGG - Intergenic
979754323 4:124321841-124321863 ATCACTTACAGATATAATCAAGG + Intergenic
980024631 4:127750418-127750440 ATTATTTCCTTATAAACTCATGG + Intronic
980449772 4:132955927-132955949 ATGACTAACATATAAATACTGGG + Intergenic
980454158 4:133017502-133017524 ATTACTCACCTATAAATAGAGGG + Intergenic
980646452 4:135648381-135648403 ATAACTTCCATTTCAATTCAAGG - Intergenic
980647811 4:135666030-135666052 ATTAAATAAATATAAATTAAGGG + Intergenic
981403962 4:144345130-144345152 TGTACTTGCATAAAAATTCATGG + Intergenic
981729263 4:147880704-147880726 ATTAAGTAAAGATAAATTCAGGG + Intronic
981875839 4:149544738-149544760 ATTAGTTGCATATAAATGCATGG - Intergenic
983888712 4:173009029-173009051 ATAAATTGCATACAAATTCAAGG + Intronic
984130750 4:175872694-175872716 ATTGCTTACATATTAATCCTTGG - Intronic
984434585 4:179692763-179692785 ATTACTAACATTTTACTTCACGG - Intergenic
984636637 4:182118151-182118173 ATTAATTACTTATTAATTCCAGG + Intergenic
986246236 5:6009509-6009531 ATTACTTATATAGAAAATAATGG - Intergenic
987318781 5:16748665-16748687 ATTACATAAATATAAATCCCCGG + Intronic
987638081 5:20572080-20572102 ATTACATACACAGAAGTTCATGG - Intronic
988287499 5:29238979-29239001 AGTACTAAATTATAAATTCATGG - Intergenic
989591365 5:43116105-43116127 ATTGCTATCATATAAATTCCTGG + Intronic
989965296 5:50460000-50460022 ATTACGTACATATTGAATCAAGG + Intergenic
990227229 5:53668256-53668278 ATTATTTGTATATCAATTCAGGG + Intronic
990525773 5:56625889-56625911 AATACTTACACAAAAATTCAGGG + Intergenic
990639869 5:57770674-57770696 ATTAATTTCATTTAAATGCAAGG - Intergenic
991253887 5:64593952-64593974 CTTAATTTCATATAAATTTATGG + Intronic
991337703 5:65567802-65567824 AAGACATACATATAAACTCAGGG - Intronic
992171317 5:74104808-74104830 ATTACTTACATATTAATGGATGG - Intergenic
992415067 5:76544450-76544472 TTAACCTACATATAAAATCAAGG + Intronic
992983433 5:82201856-82201878 AATATTTACATAAAAATTTAAGG - Intronic
993082757 5:83322325-83322347 TTTAATTGCATATAAAGTCATGG - Intronic
993284607 5:85976508-85976530 AATATTTACTTATAAATACAAGG - Intergenic
993486516 5:88494319-88494341 TTTACCTATATATAAATGCATGG + Intergenic
993649394 5:90500229-90500251 TTTACTTCCATGTAAATTAATGG - Intronic
993698214 5:91087176-91087198 AAAAGTTACATAAAAATTCAGGG - Intronic
993843926 5:92915913-92915935 ATTCCTTACATTAAACTTCAGGG - Intergenic
994254052 5:97571557-97571579 ATTTCCTATCTATAAATTCAAGG + Intergenic
994308791 5:98241586-98241608 ATACCTTTCATATAAATTAAAGG + Intergenic
994417107 5:99486026-99486048 ATTACTTATATAAAAATTTAAGG + Intergenic
994462868 5:100089142-100089164 ATTACTTATATAAAAATTTAAGG - Intergenic
994556064 5:101305287-101305309 ATTACTTACTTAAATATTCATGG + Intergenic
994661465 5:102659522-102659544 ATTAATTAAATATAAATAGAAGG - Intergenic
995370472 5:111412888-111412910 TTTAATTACATATAAATTAAGGG - Intronic
995886790 5:116903684-116903706 ATTATTTAACTAAAAATTCAAGG + Intergenic
997138827 5:131356525-131356547 TTTACTTAAATAAAAATCCATGG + Intronic
997179425 5:131813085-131813107 GTTACTTACTTATGACTTCAGGG - Intronic
997910236 5:137864368-137864390 GATACTAACTTATAAATTCAAGG - Intergenic
998305785 5:141075600-141075622 ATTACTTAAATGTAAATTCATGG - Intergenic
998744302 5:145239653-145239675 ATTATTTAAAAAGAAATTCAAGG + Intergenic
1000545246 5:162592174-162592196 GATACTTACAAAAAAATTCAGGG - Intergenic
1001209681 5:169798482-169798504 ATTACTAAGATATGAATCCAAGG - Intronic
1001777668 5:174341047-174341069 ATTATATCCATATATATTCAAGG + Intergenic
1001906260 5:175476071-175476093 AGTGCCTACATATAAATTCAGGG + Intergenic
1004397825 6:15261761-15261783 ATACCTTATATACAAATTCAGGG + Intronic
1004889640 6:20088247-20088269 TTTCCTAACATATAAATTTAAGG + Intergenic
1005706994 6:28465117-28465139 ATTAAATACATATATGTTCAAGG - Intergenic
1007121640 6:39387171-39387193 ATTCCTTACATATAACTTAATGG - Intronic
1007220364 6:40274242-40274264 ATTAAATACTTTTAAATTCATGG + Intergenic
1007539908 6:42632284-42632306 ATTACTCAAAGATAAATTCAGGG - Intronic
1008137517 6:47794241-47794263 ATTACTTCAATATAGACTCAGGG - Intronic
1008816526 6:55574531-55574553 ATCACTAACATGTCAATTCAGGG + Intronic
1008860793 6:56147694-56147716 ATTACTTAGATATATATTATAGG - Intronic
1008865668 6:56206444-56206466 ATTAGTTGCATATATATTTAGGG - Intronic
1008905806 6:56676523-56676545 ATTACTTGGATATATATCCAAGG + Intronic
1009313141 6:62182230-62182252 ATTCCTCATATATAAATTTATGG - Intronic
1009649992 6:66463332-66463354 TTTAATTACATAAAAATTAAGGG - Intergenic
1009733968 6:67650954-67650976 ATTCTTTACATTTAGATTCAGGG - Intergenic
1009742384 6:67762980-67763002 AGAACTAATATATAAATTCAGGG + Intergenic
1010008551 6:71024047-71024069 ACCACTTACAGAAAAATTCATGG + Intergenic
1010042813 6:71406671-71406693 ATTAATTACAAAGAAATTCAAGG - Intergenic
1010866609 6:80983358-80983380 TTTAATTACATATAAAGTAAGGG - Intergenic
1011149219 6:84251320-84251342 AATAATTATACATAAATTCAAGG - Intergenic
1011331546 6:86212715-86212737 ATTAGTTACATATGTATACATGG - Intergenic
1011365364 6:86575644-86575666 ATTAGTTACATATGTATACATGG - Intergenic
1011880658 6:92020513-92020535 ATTTCTTACATGTAATTTCAAGG + Intergenic
1011905963 6:92368083-92368105 ATAAATTATATATATATTCATGG + Intergenic
1011911479 6:92445725-92445747 GTTACATTCATATTAATTCAGGG - Intergenic
1012155242 6:95811869-95811891 ATTACTTAGATATCAAACCAGGG - Intergenic
1012321755 6:97856586-97856608 ATTTCTTAAAAAAAAATTCATGG + Intergenic
1012498974 6:99867598-99867620 ATTAGATGCATATGAATTCATGG + Intergenic
1012592529 6:101000139-101000161 ATTAGTCACGTATAAATTAAGGG - Intergenic
1012725094 6:102800608-102800630 AGTAATTAAATATAAATACATGG - Intergenic
1012797367 6:103779524-103779546 ATTGCCTCCATACAAATTCATGG + Intergenic
1012849956 6:104434732-104434754 ATTATTTGCATATAAGATCATGG - Intergenic
1013203298 6:107923022-107923044 AATACATACATATATATTCAGGG + Intronic
1013326815 6:109054111-109054133 ATTACTTAGATGTATGTTCAGGG - Intronic
1013790427 6:113830113-113830135 ATTAGGTTCATAAAAATTCAAGG - Intergenic
1014700981 6:124687485-124687507 ATTCCATACATATACATACATGG + Intronic
1014700983 6:124687513-124687535 ATTCCATACATATACATACATGG + Intronic
1014700985 6:124687541-124687563 ATTCCATACATATACATACATGG + Intronic
1015013858 6:128385948-128385970 ATTAGTTAAATATAACTTAAAGG + Intronic
1015285636 6:131483582-131483604 ATCAGTTTCATATAAATACATGG + Intergenic
1015867775 6:137744649-137744671 TTTACTTACAAATAAATACTCGG - Intergenic
1016141135 6:140612407-140612429 ATCACTTCCATATATATTTATGG + Intergenic
1016145365 6:140665351-140665373 ATTACTTAATTATAAAATTATGG + Intergenic
1016218844 6:141639652-141639674 ATTATTAATATATAAATTGATGG - Intergenic
1017444070 6:154491466-154491488 ATGACATACATATGATTTCATGG + Intronic
1018604915 6:165586616-165586638 ATTATTTCTATATAACTTCAGGG - Intronic
1018754837 6:166839991-166840013 ATTGCTTACATATATATATATGG - Intronic
1018974203 6:168552515-168552537 ATTATTTTCATACAAATTCATGG - Intronic
1019229192 6:170543877-170543899 ATTACTAACATAAAATTTTAAGG + Intronic
1019230430 6:170556325-170556347 ATTACATTTATAAAAATTCAGGG + Intronic
1019829573 7:3313563-3313585 AGCAATTACATATAAATTTAAGG - Intronic
1019956058 7:4415301-4415323 TTTAATTACATACAAATTAAGGG + Intergenic
1022151124 7:27607627-27607649 ATTATTTCCATATAAAATCCTGG - Intronic
1023384740 7:39645200-39645222 ATCACTTACATTAAAATTCTTGG + Intronic
1025763875 7:64422555-64422577 ATTACTTAGAAAGAATTTCATGG - Intergenic
1026721129 7:72831468-72831490 ATTACTTACATATTAATAGCTGG + Intergenic
1027448328 7:78300481-78300503 TTTACTTATATGAAAATTCATGG - Intronic
1027460364 7:78444741-78444763 AACACATACATATAAATTGAGGG - Intronic
1027904027 7:84155773-84155795 ATTACTTTGATATAAATACAAGG - Intronic
1028260709 7:88660902-88660924 AATAGTTATATATAAATACATGG - Intergenic
1028499742 7:91506335-91506357 AATACTTACTTATATGTTCATGG + Intergenic
1028728196 7:94113341-94113363 ATTAGTTGTATATAAAATCAGGG - Intergenic
1028924494 7:96342999-96343021 ATTACTTACATAAAATGTCCAGG + Intergenic
1030119327 7:106092162-106092184 ATCTCTAACATATAAAATCATGG + Intronic
1030628443 7:111869449-111869471 ATTACTGACATTCCAATTCAAGG - Intronic
1030723332 7:112895564-112895586 CTTACTCAGTTATAAATTCAGGG + Exonic
1030778752 7:113570811-113570833 TTTACTTATATCTAAATTTAAGG - Intergenic
1031222065 7:118980147-118980169 AGTATTTAAAGATAAATTCAAGG - Intergenic
1031564885 7:123283973-123283995 AGTAATTGCATATAAATGCAAGG + Intergenic
1031797164 7:126189278-126189300 ATTCCTTACATATATATATATGG + Intergenic
1031809910 7:126353527-126353549 ATTGCTAACATAAAAATACAGGG - Intergenic
1031944833 7:127828850-127828872 ATTATTTCCATATTAAATCATGG + Intronic
1032940752 7:136787602-136787624 ATCAGTTACACATAAATGCATGG + Intergenic
1033239708 7:139667367-139667389 ATTAATTACTTATAATTTTAAGG + Intronic
1034966352 7:155393640-155393662 ATTAATTAAATATAAATTGCTGG - Intronic
1035257393 7:157639657-157639679 ATTCCCTACATCTAAAATCAGGG + Intronic
1036134398 8:6146583-6146605 ATTGTTTACACATAAATGCAAGG + Intergenic
1036976290 8:13416745-13416767 ATTACTTAAATGTAGATTCCTGG + Intronic
1037156370 8:15704425-15704447 ATCACTTAGATTAAAATTCAAGG - Intronic
1037445277 8:18959266-18959288 ATATCTTACATATCATTTCAGGG + Intronic
1038508616 8:28108755-28108777 ATTATTAAAATATAAATTCCAGG - Intronic
1038787399 8:30631315-30631337 ATTACTTATATTTAAATTCTCGG - Intronic
1041045957 8:53886333-53886355 ATTACATGATTATAAATTCATGG + Intronic
1041343259 8:56868391-56868413 ATTGCTTAAATATTAATTGACGG + Intergenic
1041993388 8:64023349-64023371 ATAACTTATATAAACATTCAAGG + Intergenic
1042693573 8:71530504-71530526 ATAACTTAAATATAAAACCATGG - Intronic
1042854302 8:73250348-73250370 ATTACTTACATATAAATTCAGGG + Intronic
1043119555 8:76305796-76305818 ATTATTTCCACATATATTCATGG + Intergenic
1043213703 8:77558374-77558396 ATCAGTTGCTTATAAATTCATGG - Intergenic
1043284056 8:78507336-78507358 ATTATATAAATATAAATACAAGG - Intergenic
1043426453 8:80153018-80153040 TTAATATACATATAAATTCAGGG - Intronic
1043539769 8:81247460-81247482 TGCAATTACATATAAATTCAAGG - Intergenic
1044023151 8:87132070-87132092 ATTACATACATATAAAAATAAGG - Intronic
1044176581 8:89132029-89132051 ATATATTACATATATATTCATGG + Intergenic
1044237369 8:89846458-89846480 ATCACTAACATATAAATAGAAGG + Intergenic
1044245017 8:89933612-89933634 ACAACATACATATCAATTCAAGG + Exonic
1044304953 8:90628298-90628320 ATTTCTTATATGCAAATTCAGGG + Intronic
1045597678 8:103674888-103674910 AATTATTAAATATAAATTCAAGG - Intronic
1045717050 8:105059397-105059419 ATTTGTTATATATATATTCATGG + Intronic
1045993485 8:108337242-108337264 TTTCCTTACATATGCATTCATGG + Intronic
1045998151 8:108387411-108387433 ATTAGTTACATATGTATGCATGG - Intronic
1046105375 8:109659066-109659088 AGAACTTACATATCATTTCAAGG + Intronic
1046438189 8:114222713-114222735 ATTACTTAAAGATAAATTACAGG - Intergenic
1046747133 8:117888337-117888359 ATTACATTCATATAGATTCATGG + Intronic
1047267442 8:123319479-123319501 ATTTCCTACATATAAAATCATGG + Intergenic
1047719836 8:127629514-127629536 ACTACTAACATAAAAAGTCATGG + Intergenic
1047975306 8:130124004-130124026 AATACTTACATATCACTTGAAGG + Exonic
1047979460 8:130165471-130165493 ATTACTGACACATAAATCCTAGG - Intronic
1049678621 8:143905006-143905028 TTTACTTACATGCAAATTAAGGG - Intergenic
1050315259 9:4395171-4395193 ATTACTAAGACTTAAATTCATGG - Intergenic
1050748768 9:8910942-8910964 ATTAAGAACATATAAATTAATGG + Intronic
1051203681 9:14661051-14661073 ATTATTTACGTTTAAATTCAAGG + Intronic
1051270980 9:15354531-15354553 ATATTTTACATATAAGTTCATGG + Intergenic
1051767211 9:20538346-20538368 CTTACTTACTTATAAATTTTGGG - Intronic
1051800784 9:20931382-20931404 ATTACTAACATAACTATTCATGG + Intronic
1052291705 9:26848935-26848957 ATCACTGACATATAAATAAATGG - Intronic
1052487586 9:29121802-29121824 ATTAATCACACATAAAATCAAGG - Intergenic
1052500482 9:29282989-29283011 ATTACTTACTTCTAATTTCAGGG + Intergenic
1052710233 9:32045973-32045995 ATAAATTAGATATACATTCATGG + Intergenic
1053401733 9:37830456-37830478 GTTACATACATATGAATTCATGG + Intronic
1053623662 9:39845788-39845810 TTTAATTACATGTAGATTCAGGG - Intergenic
1053881207 9:42597440-42597462 TTTAATTACATGTAGATTCAGGG + Intergenic
1054220236 9:62404911-62404933 TTTAATTACATGTAGATTCAGGG + Intergenic
1054230479 9:62504261-62504283 TTTAATTACATGTAGATTCAGGG - Intergenic
1054853770 9:69875946-69875968 AACTCTTACATATATATTCAAGG - Intronic
1058352421 9:104041542-104041564 ATCATTTGCATATAAATACATGG + Intergenic
1058759526 9:108117581-108117603 ATTACTTAGATGGAAACTCAGGG - Intergenic
1059702533 9:116789605-116789627 ACTACATACATTTCAATTCAGGG + Intronic
1059722952 9:116979483-116979505 ATTATTTACATCCACATTCAAGG - Intronic
1059857000 9:118410398-118410420 ATTAGTTTTATATAAGTTCAGGG - Intergenic
1059952912 9:119486297-119486319 ATTATATACATATATATTCAAGG + Intergenic
1060601038 9:124877660-124877682 ATTAATTACATACAAATCAAAGG - Exonic
1061336965 9:129944996-129945018 AATAAATACATATATATTCAGGG + Intronic
1061338968 9:129963462-129963484 ATAACTTACCAGTAAATTCAAGG - Intronic
1062701510 9:137907854-137907876 ATCACTCACACATAAATTCCAGG - Intronic
1185947296 X:4391622-4391644 ATTGCATACACATCAATTCAAGG + Intergenic
1186191662 X:7072878-7072900 ATTGCTTACATATCACTTCTAGG - Intronic
1186236137 X:7512662-7512684 ATTACTTACATATACATTTAAGG + Intergenic
1186567400 X:10678162-10678184 GTTGCTTACATATAATTTTATGG - Intronic
1187158859 X:16745848-16745870 ATTACATACATAAAAACACAAGG - Intronic
1187762313 X:22601703-22601725 AATACTTACAAATAAAGTTAAGG - Intergenic
1188360663 X:29248908-29248930 ATTACTGACATATACATCAATGG + Intronic
1188558032 X:31433814-31433836 AGTACTTACATCTAAATTTGTGG - Intronic
1188808912 X:34627236-34627258 ACTACTTAAACATGAATTCATGG - Exonic
1189094727 X:38126186-38126208 ATTACTTATTTATAGATTAAGGG + Intronic
1191195319 X:57714580-57714602 ATTAGTTACATATGTATACATGG - Intergenic
1192078869 X:68028648-68028670 ATTACATAGATATTAATTGATGG - Intergenic
1192611201 X:72569110-72569132 TTTACTTACCTATAAACTCAAGG - Intronic
1193524179 X:82568263-82568285 ATTAATTCCATATAAATTTTAGG + Intergenic
1193885229 X:86975918-86975940 ATTAGGTACATAAACATTCAGGG + Intergenic
1194723726 X:97370369-97370391 ATTAGTAAGATATAAATTAAGGG + Intronic
1194912230 X:99660310-99660332 CTCATTTACATATATATTCAGGG + Intergenic
1196017263 X:110953345-110953367 ATTCCTGACATATAAAATGAGGG + Intronic
1196408062 X:115386586-115386608 TTTACTTACAAATAACTTTAAGG + Intergenic
1197407857 X:126075243-126075265 AAAAATTACATATATATTCAAGG - Intergenic
1197419192 X:126217077-126217099 AATATTTGCATATAATTTCAGGG + Intergenic
1197436555 X:126435602-126435624 AATGTTTACATAGAAATTCAAGG + Intergenic
1197846882 X:130812629-130812651 ATTTCTTTCATTTACATTCATGG - Intronic
1198126936 X:133654156-133654178 ATTAATTATATATATATTGAGGG + Intronic
1198635748 X:138698505-138698527 ATTAAGTGCATATAAACTCATGG + Intronic
1198651502 X:138868215-138868237 ATTATTTACATATCGATTCCAGG + Intronic
1199090290 X:143683426-143683448 ATTAACCACATATAAATGCATGG + Intergenic
1199275211 X:145933494-145933516 ATTACCTACAAATATATTTATGG + Intergenic
1199337162 X:146631566-146631588 GTTACTTAAACATAGATTCATGG - Intergenic
1199708038 X:150448044-150448066 ATTATTTCCATGTAAATTCAAGG - Intronic
1200712045 Y:6494246-6494268 ATTATTTAAAAATAAATTTAAGG - Intergenic
1200939354 Y:8765992-8766014 ATGAATTCCATGTAAATTCAAGG + Intergenic
1201016951 Y:9614266-9614288 ATTTTTTAAATATAAATTTAAGG - Intergenic
1201021886 Y:9667726-9667748 ATTATTTAAAAATAAATTTAAGG + Intergenic
1201504565 Y:14683575-14683597 ATAACTTACAGATGAATTCAGGG - Intronic
1201602016 Y:15741404-15741426 GTTACTTACATATACATTTGTGG + Intergenic
1202198145 Y:22317551-22317573 ATTATTTAAAAATAAATTTAAGG + Intronic