ID: 1042858812

View in Genome Browser
Species Human (GRCh38)
Location 8:73294201-73294223
Sequence GCTGCGGAAGACAGCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042858812_1042858819 -2 Left 1042858812 8:73294201-73294223 CCCACAGGGCTGTCTTCCGCAGC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1042858819 8:73294222-73294244 GCGCCTGATCGCAGGCGGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1042858812_1042858814 -10 Left 1042858812 8:73294201-73294223 CCCACAGGGCTGTCTTCCGCAGC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1042858814 8:73294214-73294236 CTTCCGCAGCGCCTGATCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 43
1042858812_1042858817 -6 Left 1042858812 8:73294201-73294223 CCCACAGGGCTGTCTTCCGCAGC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1042858817 8:73294218-73294240 CGCAGCGCCTGATCGCAGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 74
1042858812_1042858816 -7 Left 1042858812 8:73294201-73294223 CCCACAGGGCTGTCTTCCGCAGC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1042858816 8:73294217-73294239 CCGCAGCGCCTGATCGCAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1042858812_1042858822 27 Left 1042858812 8:73294201-73294223 CCCACAGGGCTGTCTTCCGCAGC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1042858822 8:73294251-73294273 GTGCTCTAGCTTACGAAAAGTGG 0: 1
1: 0
2: 1
3: 2
4: 49
1042858812_1042858821 3 Left 1042858812 8:73294201-73294223 CCCACAGGGCTGTCTTCCGCAGC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1042858821 8:73294227-73294249 TGATCGCAGGCGGGGCGGTCTGG 0: 1
1: 0
2: 1
3: 3
4: 47
1042858812_1042858818 -5 Left 1042858812 8:73294201-73294223 CCCACAGGGCTGTCTTCCGCAGC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1042858818 8:73294219-73294241 GCAGCGCCTGATCGCAGGCGGGG 0: 1
1: 0
2: 1
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042858812 Original CRISPR GCTGCGGAAGACAGCCCTGT GGG (reversed) Intronic
900112662 1:1015083-1015105 GCTGCAGAAGACAGCCTGGGTGG + Intergenic
900337461 1:2171688-2171710 GCTGCGGAAGACAGTCCGGCAGG - Intronic
900463347 1:2811675-2811697 GCTGCTGAAGGCAGCCCGGCCGG + Intergenic
901016449 1:6234635-6234657 GCTGCGGATGACAGCACCTTTGG + Intronic
901754734 1:11434677-11434699 GCTGCTGAAGACAGCCCCTGGGG - Intergenic
903296007 1:22343502-22343524 GCTGCGGAAGCCCGAACTGTGGG + Intergenic
903803916 1:25990571-25990593 GCTCAGGAAGACAGACCTGGGGG + Intronic
904475090 1:30759772-30759794 GATGTGGCAGACAGCCCTGGAGG + Intergenic
906568019 1:46814222-46814244 GGAGCGGAAGGCAGCCCTGCAGG + Exonic
906652559 1:47523117-47523139 GCTGGGGAAAACAGCACTGGGGG + Intergenic
906884564 1:49630408-49630430 GCTGAGGAAAATAGGCCTGTTGG - Intronic
908768939 1:67578523-67578545 GATGAGGTAGATAGCCCTGTTGG + Intergenic
911200330 1:95037502-95037524 GCTGCTGGAGGCAGCACTGTGGG + Intronic
917293324 1:173493620-173493642 GTTGGGGAACACAGCCCAGTAGG - Intergenic
917788326 1:178483403-178483425 GCTGCAGAAGCCAGCGATGTGGG + Intergenic
919793580 1:201307888-201307910 GCTGCTGAAGATGGCCCTGTTGG + Intronic
920819557 1:209367702-209367724 GCTGCAGAAGATAGCACTGTGGG + Intergenic
922246360 1:223802206-223802228 GCTGGTGAAGCCAGCCCTGCCGG - Exonic
923375508 1:233358012-233358034 TCTGAGTCAGACAGCCCTGTTGG + Intronic
1062882108 10:987752-987774 GTTGCGAGAGACAGTCCTGTGGG - Intergenic
1067915392 10:50392535-50392557 CCTGAGGAAGACAGCTCTGCTGG - Intronic
1069681947 10:70291715-70291737 GAGGCTGAAGACAGCCCTGTGGG + Intergenic
1070238697 10:74656271-74656293 GCTGTGGGAGGAAGCCCTGTGGG - Intronic
1072279031 10:93849259-93849281 CCTTCAGAAGACAGCACTGTCGG + Intergenic
1072720853 10:97780270-97780292 GCTGGGGAAGGCAGCCCTAGGGG + Intergenic
1076338565 10:129727351-129727373 GCCAGGGAAGTCAGCCCTGTTGG + Intronic
1076894529 10:133303379-133303401 GCTCCGGGAGCCAGCCCCGTGGG + Intronic
1081030837 11:38080764-38080786 GCTGTAGAAGACAGAGCTGTAGG - Intergenic
1081061581 11:38484997-38485019 GCTGCAGAAGACAGAACTTTAGG + Intergenic
1088593543 11:111423097-111423119 CCTGCAGAAGAGACCCCTGTTGG + Intronic
1091143525 11:133257342-133257364 TCTGAGAAAGGCAGCCCTGTGGG + Intronic
1093806027 12:23434343-23434365 GCTCTGGAGGTCAGCCCTGTGGG - Intergenic
1097175706 12:57141679-57141701 GCTTGGTCAGACAGCCCTGTGGG + Intronic
1097188818 12:57209891-57209913 GCTGGGGAAGGGAGGCCTGTGGG + Intronic
1101328958 12:103741819-103741841 GCTGCTGAAGACAGACCAGTGGG - Intronic
1102647920 12:114415612-114415634 GCTGCTGCAGACAGCCCCTTTGG - Intergenic
1102740901 12:115206797-115206819 TATGGGGAAGATAGCCCTGTGGG - Intergenic
1102951245 12:117033043-117033065 GCAGTGGGAGACGGCCCTGTTGG - Intergenic
1103285853 12:119800936-119800958 TCTGCTGTAGGCAGCCCTGTGGG - Intronic
1103585191 12:121948005-121948027 GCTGCAGGAGACAGCACTGAGGG - Intronic
1103860357 12:124007392-124007414 GCTCTGGAAGACACCCCTGCTGG + Intronic
1105207092 13:18233923-18233945 GCTGTGGAAGGCGACCCTGTTGG - Intergenic
1109988428 13:70020568-70020590 ACAGAGGAAGACAGCCCAGTTGG - Intronic
1120919287 14:89740186-89740208 GATGTGGAAGACAACCCAGTCGG - Intergenic
1121800752 14:96772336-96772358 GGTGGGGAAGTCAGCCCTGTGGG + Intergenic
1123977212 15:25564785-25564807 GGGGCTCAAGACAGCCCTGTGGG - Intergenic
1124148995 15:27160004-27160026 ACTGTGGCAGGCAGCCCTGTGGG - Intronic
1124209170 15:27748046-27748068 GCTACAGAAGACAGCCCAGATGG + Intergenic
1124440569 15:29682685-29682707 GCTGCAGCAAACATCCCTGTAGG + Intergenic
1125492848 15:40161141-40161163 GTTGCGGAAGAAAGCCCAGGCGG + Exonic
1126257660 15:46646813-46646835 CCAGAGCAAGACAGCCCTGTAGG + Intergenic
1128574885 15:68766896-68766918 CCTGCGGAAGACAGCCCATATGG + Intergenic
1129723661 15:77891037-77891059 ACTGCCGAAGACAGGGCTGTCGG - Intergenic
1130371272 15:83286478-83286500 GCTGAGGAAGTCAGCCTTCTTGG + Intergenic
1131865800 15:96708279-96708301 GCCTGAGAAGACAGCCCTGTGGG + Intergenic
1132759710 16:1502713-1502735 GCTGCGCCAGAGAGCCCTGGTGG + Exonic
1134339471 16:13332157-13332179 ACTGGAGAAGACAGGCCTGTTGG + Intergenic
1136390852 16:29963271-29963293 GCTGCGCAGGCCAGTCCTGTGGG - Exonic
1136394955 16:29987625-29987647 GCTGCGGAAGCCATCCTTGTTGG - Exonic
1144455919 17:15418190-15418212 GGTGGGGCAGACACCCCTGTAGG - Intergenic
1145016669 17:19403210-19403232 GATGGGGAAGGCAGCCATGTTGG + Intergenic
1146779631 17:35657603-35657625 GATGCAGGTGACAGCCCTGTTGG + Exonic
1147013259 17:37469214-37469236 GCTTCTTAACACAGCCCTGTGGG + Intronic
1147888926 17:43703607-43703629 GATGCAGAAAACAGCCTTGTTGG - Intergenic
1147988182 17:44318415-44318437 GCTGCGGAAGAAAGCACGCTGGG + Exonic
1149603289 17:57907189-57907211 GCTGGGGGAGACAGCACTGCAGG + Intronic
1150222358 17:63503619-63503641 GCTGCGGAAAACAGTCTGGTGGG - Intronic
1150464747 17:65382935-65382957 GCTCCTGAAGATAGCCCTGCAGG - Intergenic
1154254204 18:12768533-12768555 CCTGAGGAAGACAGCTCTGCAGG + Intergenic
1155916968 18:31566678-31566700 TCTGCAGAAGACAGCTCTGGTGG + Intergenic
1156312437 18:35937200-35937222 GCTGCTGACAACAACCCTGTGGG - Intergenic
1156450039 18:37261731-37261753 GCTGCGGCAGCCATCCCTGAGGG + Intronic
1158931162 18:62325768-62325790 GCCGCGGGAGACAGCGCCGTGGG + Intronic
1159003608 18:62993634-62993656 GCTGAGGAAGCCAGCACTTTGGG + Intergenic
1160424825 18:78772712-78772734 GCTGCGGGAGGCAGCTCTGCAGG + Intergenic
1162066333 19:8127547-8127569 GGTGTGGAAGACAGTCTTGTGGG - Intronic
1163428037 19:17249879-17249901 GCTTCGGGAGACAGGCCAGTTGG + Exonic
1163815218 19:19460899-19460921 GCACCGGAAGCCAGCCCTGAAGG - Intronic
1164041774 19:21498906-21498928 GCCGGGGAATGCAGCCCTGTAGG + Intronic
1165335279 19:35165630-35165652 TCTGGGGAATACAGCCCAGTAGG + Intronic
1165854200 19:38870132-38870154 GCGGCGACAGACAGCCCTGCGGG - Exonic
925345393 2:3168550-3168572 GCTGCAGAAGACTGGCCCGTGGG - Intergenic
929053361 2:37856329-37856351 GCTTTGGCAAACAGCCCTGTGGG - Intergenic
929794020 2:45044747-45044769 GCAGCAAAAGACAGCCCTGGAGG - Intergenic
933085876 2:78053407-78053429 GCTGTGGAAGTGAGACCTGTGGG + Intergenic
933677133 2:85066903-85066925 GCTGGGAAACACAGCCCTGCTGG - Intergenic
940385720 2:153069082-153069104 GCTGTGCAAGAATGCCCTGTAGG + Intergenic
942810731 2:179997414-179997436 CCTGAGGATGAGAGCCCTGTAGG + Intronic
947831955 2:233147680-233147702 CGTGCGGAAGACAGACCTGCAGG - Intronic
1169468337 20:5861068-5861090 GCTGCTGAAGAAAGGCCAGTTGG + Intronic
1170731770 20:18982411-18982433 GCTAAGGAAGACAGGCCTTTGGG - Intergenic
1172936912 20:38627017-38627039 GCTGCAGGACACAGGCCTGTCGG + Exonic
1179647416 21:42784358-42784380 GCTGTGCCAGACTGCCCTGTGGG - Intergenic
1180842638 22:18966388-18966410 GCTGGGGGAGGCAGCCCTGTGGG + Intergenic
1180938012 22:19638615-19638637 GCTCCTGAAGACACCCCTGCAGG - Intergenic
1182979923 22:34659318-34659340 GCTGCTGAAGACCGCCCAGTGGG - Intergenic
1184680359 22:46069773-46069795 GCTGTGGAAGGCAGCTCAGTGGG + Intronic
1184759083 22:46534798-46534820 GCTCTGAAAGACAGGCCTGTGGG + Exonic
950467080 3:13161995-13162017 GCTGTGGAACCCAGCCCTGGGGG - Intergenic
950584056 3:13880290-13880312 GCTGGGGAGCACAGCCCGGTTGG + Intergenic
953509391 3:43520085-43520107 GTTGTGGAAGTCAGCCATGTGGG - Intronic
961427326 3:126858442-126858464 GCTGAGGAAGGCAGCCCAGCAGG + Intronic
961995180 3:131234744-131234766 GCTGTGGAATACAGCACAGTGGG + Intronic
963729337 3:148956377-148956399 ACTGCGGAAGACAGGGCTTTAGG - Intergenic
964763293 3:160154583-160154605 GAGGAGGAACACAGCCCTGTGGG + Intergenic
969495645 4:7524724-7524746 GCTGCGGAGGCCAGGCCGGTGGG - Intronic
986939569 5:12935023-12935045 GCTGCTGAATAAAGCCATGTTGG + Intergenic
992213703 5:74505619-74505641 GCTGCCAAAGACAGCACTGCAGG + Intergenic
995243048 5:109906951-109906973 TCTGCTGTAGACAACCCTGTGGG - Intergenic
999204240 5:149836762-149836784 GCTGCTGGAGACCGCCCTGGAGG + Exonic
1001315056 5:170636061-170636083 CCTGGGGAAGACAGACCAGTTGG + Intronic
1001808833 5:174611376-174611398 GCTGCAGAAGACAGCCTTCGTGG - Intergenic
1002186108 5:177455568-177455590 GCTGCGGATGGAAGCCCTGAGGG - Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006315966 6:33291927-33291949 GCTGAGAAATCCAGCCCTGTGGG - Exonic
1006505598 6:34486683-34486705 GCCCCGGAAGGCAGCCCTGCAGG - Intronic
1007706279 6:43793445-43793467 GCTTCTGAAGACAGCCCTGGGGG - Intergenic
1007718399 6:43870411-43870433 GCTGGGGAAGTCAACCCTGCAGG - Intergenic
1012193963 6:96316395-96316417 GCAGAGGAAGGCAGCCCTGCAGG - Intergenic
1014915453 6:127141611-127141633 GCTGCTGAATACAGCCCAGTTGG - Intronic
1016744069 6:147559191-147559213 CCTGCAGACCACAGCCCTGTGGG + Intronic
1018143850 6:160864840-160864862 GCTCTGGAAGACAGTCCTGGGGG - Intergenic
1018814993 6:167323896-167323918 GCTCAGGAAGACAGTCCTGGTGG + Intergenic
1019273318 7:162823-162845 GCTGGGGAAGACGACCGTGTGGG + Intergenic
1023905798 7:44520948-44520970 GCTGGGGAGGACAGACATGTGGG - Intronic
1028623291 7:92847813-92847835 AGTGAGGAAGACAGACCTGTAGG - Intergenic
1036417435 8:8563803-8563825 GCAGTGAAAGACATCCCTGTGGG + Intergenic
1037278643 8:17210452-17210474 GCTGTGGAATTCAGCCCTGCAGG - Exonic
1037393199 8:18416291-18416313 GCTGGGGATGCCAGCCTTGTGGG - Intergenic
1038861763 8:31395770-31395792 GCTGAGGTAGACAGACCTCTGGG - Intergenic
1039903009 8:41766802-41766824 GCAGAGGAAGGCAGACCTGTTGG - Intronic
1040289356 8:46116478-46116500 CCTGCCCAAGACAGCCCTGGGGG + Intergenic
1040331206 8:46386681-46386703 CCTGCACAGGACAGCCCTGTGGG - Intergenic
1040341646 8:46444100-46444122 CCTGCTCAAGACAGCCCTGAGGG + Intergenic
1042858812 8:73294201-73294223 GCTGCGGAAGACAGCCCTGTGGG - Intronic
1045968368 8:108052357-108052379 TCTGGGGAATACATCCCTGTTGG - Intronic
1045981724 8:108197403-108197425 GCTGTGGAAGACAACCCAGATGG + Intergenic
1047192506 8:122690898-122690920 GCTCCGGTAGACAGCCCTGGAGG - Intergenic
1047195600 8:122718449-122718471 GCTGCCGATGGGAGCCCTGTTGG - Intergenic
1049551522 8:143262035-143262057 GCTGCCGGAGACAGCCGTGAGGG - Intronic
1049629853 8:143647847-143647869 GGTGCAGATGGCAGCCCTGTAGG + Intronic
1049689809 8:143953520-143953542 GCCGCTGAAGCCAGCCCAGTAGG + Intronic
1053456947 9:38240453-38240475 GCTGCACATGAAAGCCCTGTGGG - Intergenic
1056378332 9:86035526-86035548 GTGGTGGAAGACAGACCTGTAGG - Exonic
1056713339 9:89009182-89009204 GCTTGGTAAGACAGCCCAGTAGG - Intergenic
1059506133 9:114801333-114801355 GCTGCACTTGACAGCCCTGTAGG - Intronic
1061876102 9:133544864-133544886 GCTGCAGATGAGATCCCTGTGGG + Intronic
1062617360 9:137403844-137403866 GAAGGGGAAGACAGACCTGTGGG + Intronic
1187144691 X:16626742-16626764 GCAGCTGAAGACAGACCTGCTGG - Intronic
1200091810 X:153639532-153639554 GCTGCAGAAGCCATCTCTGTGGG + Intergenic
1201264233 Y:12190667-12190689 CCTGTGGAAGAAAGCCCTGAGGG + Intergenic
1201668749 Y:16491153-16491175 GCTGAGGAAGACTGCCTTGAAGG + Intergenic