ID: 1042859050

View in Genome Browser
Species Human (GRCh38)
Location 8:73295054-73295076
Sequence TGCCGCGGCGGGCACAGTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042859042_1042859050 4 Left 1042859042 8:73295027-73295049 CCGGCAGGAGGCGCCGAGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 250
Right 1042859050 8:73295054-73295076 TGCCGCGGCGGGCACAGTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1042859045_1042859050 -9 Left 1042859045 8:73295040-73295062 CCGAGCCGGGTGACTGCCGCGGC 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1042859050 8:73295054-73295076 TGCCGCGGCGGGCACAGTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042859050 Original CRISPR TGCCGCGGCGGGCACAGTCC GGG Exonic
902786977 1:18739027-18739049 GGCATAGGCGGGCACAGTCCAGG - Intronic
904256584 1:29258621-29258643 AGCCGGGACGGGCACAGCCCGGG + Exonic
906532825 1:46533221-46533243 GGCCGCGGCGGGCCCGGGCCAGG - Intergenic
907430100 1:54406522-54406544 TGCCGCGGCCGGCGCTGTCAGGG - Intronic
915267599 1:154730229-154730251 TGCCATGGCTGGCACAGACCTGG - Intronic
919892144 1:201983124-201983146 GGCAGCGGCGGGCGCAGTCTGGG - Intronic
920401582 1:205679891-205679913 CACTGCGGCGCGCACAGTCCGGG - Intronic
921190048 1:212700328-212700350 CGGCGCGGGGGTCACAGTCCCGG + Intergenic
922001257 1:221480672-221480694 TGCGGAGGCGGGCACAGAACAGG + Intergenic
1062833267 10:620014-620036 TGCAGCTGCTGGCACAGCCCAGG + Intronic
1062942637 10:1435542-1435564 TGCAGAGGCAGGCTCAGTCCAGG - Intronic
1064728441 10:18304647-18304669 TGCAGCGGCAGGCAAAGTCAAGG - Intronic
1073241965 10:102065206-102065228 TGCCCGGGCGGGCGCGGTCCAGG + Intergenic
1075940577 10:126387807-126387829 TGCCCCGGAGGGCACAGCCTCGG - Intronic
1076850183 10:133088720-133088742 CGGCGGGGCGGGCGCAGTCCGGG - Exonic
1077137952 11:1010819-1010841 TGCCGTGGCTGCCACAGTCCAGG - Exonic
1080677353 11:34439971-34439993 TGCAGCCGTGGGCACAGGCCAGG - Intronic
1096071992 12:48780574-48780596 TGGGGAGACGGGCACAGTCCTGG + Intronic
1097981443 12:65741452-65741474 TGCCGCGGCGGCCGGAGCCCGGG + Intergenic
1121124856 14:91399433-91399455 TGCTGCCGTGGCCACAGTCCAGG + Intronic
1121313125 14:92945842-92945864 TGCAGCGCCGGGCAGAGGCCTGG - Intronic
1123059162 14:105586654-105586676 TGCCAAGGCAGGCACAGCCCAGG - Intergenic
1123083491 14:105706885-105706907 TGCCAAGGCAGGCACAGCCCAGG - Intergenic
1125485605 15:40108813-40108835 GGCGGCGGCGGGCACAGGCCGGG + Exonic
1128358443 15:66944221-66944243 TGCCGGGGCGGGGACAAGCCAGG - Intergenic
1129872281 15:78948173-78948195 TGCAGCTGCTGGCACAGTCTTGG + Intronic
1132815901 16:1826474-1826496 GGCCGCGGCGGACGCAGGCCTGG + Intronic
1132904972 16:2277860-2277882 TGCCGGGGCCGGCACACACCTGG + Exonic
1132925014 16:2424764-2424786 TGCCGGGGCCGGCACACACCTGG - Intergenic
1132959607 16:2614503-2614525 GGCAGCAGCAGGCACAGTCCAGG - Intergenic
1132972668 16:2696478-2696500 GGCAGCAGCAGGCACAGTCCAGG - Intronic
1141531290 16:84648610-84648632 GGACGCGGCGGGGACAGCCCCGG - Exonic
1142409907 16:89910748-89910770 TGTGCCGGCTGGCACAGTCCTGG - Intronic
1146353148 17:32112666-32112688 TGCCGCGGCGGCCTCAGCGCTGG - Intergenic
1147743227 17:42680345-42680367 TGCCGCGAAGGGCAGAGTCAGGG + Exonic
1148771227 17:50068052-50068074 TGTAGCGGTGGGCACAGACCTGG - Exonic
1150314390 17:64156284-64156306 TGCCAGGGAGGACACAGTCCGGG - Intronic
1151120456 17:71787155-71787177 TGGCCCGGCAGGCACAGTCAGGG + Intergenic
1151725026 17:75878600-75878622 TGCCGCGGCGCGAACGGCCCGGG - Intergenic
1151939114 17:77281662-77281684 CCCCGCGGCGGGCACACTGCAGG + Intronic
1153925081 18:9828262-9828284 AGCCGAGGCGGGCACCATCCTGG - Intronic
1156448757 18:37254535-37254557 TGGCGGGGCGGGCAGAGGCCGGG - Intronic
1160297473 18:77651007-77651029 TGCCGCGGCGGGAGGAGACCCGG + Intergenic
1160732256 19:646635-646657 TGCCCTGGCGGCCACAGTCATGG + Intergenic
1160809987 19:1009134-1009156 TGCCCCGGCGGACACTGACCAGG + Intronic
1160915709 19:1495616-1495638 TGCCAGGGCGGGCACAGCCGTGG + Intronic
1161979437 19:7622895-7622917 TGCCGGGGCGGGCAGAGGCGAGG + Intronic
1162758486 19:12874435-12874457 TGGCGAGGCGGGCACACCCCTGG + Exonic
1163702047 19:18790924-18790946 TGCCGCCGCAGGCTCAGACCTGG - Exonic
1164590683 19:29505217-29505239 TGCCGCGGACTGCACAATCCTGG - Intergenic
1167159895 19:47760448-47760470 TGGAGCGTCGGGCACATTCCTGG + Intergenic
1167705651 19:51079494-51079516 TCCCGGGGCTGGCACAGGCCTGG + Exonic
1168722541 19:58562122-58562144 GGAAGCGGCGGCCACAGTCCTGG + Exonic
927484039 2:23476900-23476922 TGCCTCTGCAGGCACATTCCTGG - Intronic
933684865 2:85134263-85134285 TGCCGCGGCGCTGTCAGTCCCGG + Intronic
933899510 2:86839603-86839625 TGCCGAGGCGGGCTCAGCTCCGG - Intronic
934105576 2:88691826-88691848 TGCCGGGGCGTGCACAGTCTGGG + Exonic
934170560 2:89537995-89538017 GGTCACGGTGGGCACAGTCCTGG + Intergenic
934280862 2:91612315-91612337 GGTCACGGTGGGCACAGTCCTGG + Intergenic
934908604 2:98229308-98229330 TGCTGTGGGGGGCACAGTGCGGG + Intronic
935619731 2:105118280-105118302 TGCTGCGGCGTGGACAGACCTGG + Intergenic
935781051 2:106509623-106509645 TGCCGAGGCGGGCTCAGCTCCGG + Intergenic
941110779 2:161417157-161417179 TGCCGCGGCAGTCACAGCCTAGG - Intronic
942085446 2:172439086-172439108 TGCCTTGGATGGCACAGTCCTGG + Intronic
948461228 2:238130892-238130914 TGCCGCAGCCGGCCCAGACCTGG + Exonic
1168772995 20:428021-428043 TGAAGCGGCGGGGACAGGCCTGG - Intronic
1170852424 20:20017312-20017334 TTCCGCGGCGGCCACGCTCCGGG + Exonic
1172873125 20:38147996-38148018 TGCTGCGGCGGGAGCAGTCACGG + Exonic
1174342485 20:49906528-49906550 TGCGGCGGCGGGCAGAGGGCCGG - Exonic
1175294060 20:57896613-57896635 TGCCAGGGCAGGCACAGGCCAGG + Intergenic
1175340882 20:58228437-58228459 TCCGGCCGCGGGCACAGGCCAGG + Exonic
1179430382 21:41317132-41317154 TGGGGCGGCGGGAACAGGCCTGG - Intronic
1182958140 22:34446562-34446584 TGCCGCAGCATGCACTGTCCTGG + Intergenic
954201010 3:49022998-49023020 TGCTGCGGGGAGCACAGGCCTGG + Intronic
968850114 4:3073375-3073397 GGCCGTGGCGGGCAGGGTCCTGG - Intergenic
968957180 4:3725382-3725404 TGCCTCAGGGGGCACATTCCGGG + Intergenic
970824038 4:20252426-20252448 TGACGCGGCGGCCGCAGTCCCGG - Intergenic
970913299 4:21304407-21304429 CGGCGCGGCGCGCAGAGTCCCGG - Intronic
977249280 4:94671238-94671260 TGCCGCTGTGGGCACAGGCCTGG + Intergenic
984928237 4:184825584-184825606 TGCGGCGGCGGGGACCGGCCCGG - Intronic
985673578 5:1218902-1218924 GGCCGTGGAGGGCACAGGCCTGG + Exonic
985894431 5:2740148-2740170 TGCCCCGGCGGCCCCAGACCCGG - Intergenic
996948200 5:129094826-129094848 GGCGCCGTCGGGCACAGTCCCGG + Exonic
1002541214 5:179907662-179907684 AGCCGCGGCGCCCACAGGCCCGG + Intronic
1002879943 6:1242411-1242433 TCCCGCAGTGGGAACAGTCCTGG - Intergenic
1007625408 6:43243687-43243709 AGCCGCAGCGGGCACAGAGCAGG + Exonic
1018025349 6:159801044-159801066 TGCCGCGGAGGCCATAGTGCCGG + Intronic
1019120007 6:169794731-169794753 TGCCACGGTGGCCACAGTGCAGG + Intergenic
1025023516 7:55497886-55497908 TGCTGAGGTGGGCACAGTCAGGG + Intronic
1025262446 7:57427719-57427741 GGCCCCGGCTGGCACAGTCTAGG + Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1028621425 7:92833328-92833350 CGCCGCGGCGGGCGGCGTCCAGG - Exonic
1029731139 7:102439034-102439056 AGCTGCGGCGGACCCAGTCCCGG - Exonic
1033044303 7:137947489-137947511 AGCCCCGGAGGGCACAGGCCAGG - Intronic
1036676606 8:10839434-10839456 GGCGGCGGCGGGGCCAGTCCCGG + Intronic
1039476451 8:37841625-37841647 TGCGGCGGCGGGCAGGGCCCGGG - Exonic
1042859050 8:73295054-73295076 TGCCGCGGCGGGCACAGTCCGGG + Exonic
1045638822 8:104223909-104223931 TGTCGCCCCCGGCACAGTCCCGG - Intronic
1049233525 8:141496425-141496447 TGTCCCTGCGGGCAGAGTCCTGG + Intergenic
1049593623 8:143473596-143473618 TGACACTGCAGGCACAGTCCTGG - Intronic
1049680608 8:143916308-143916330 TGCCGCGGCGGGAGCCGGCCCGG + Exonic
1049695578 8:143982946-143982968 TGCTGCTGCGGGCAGCGTCCAGG + Exonic
1051774766 9:20621831-20621853 GGGAGCTGCGGGCACAGTCCGGG - Intronic
1056242997 9:84668379-84668401 GGTCGCGGCGGGCACAGCGCTGG - Intergenic
1057900407 9:98943902-98943924 GGCGGCGGCGGGCAGAATCCCGG - Exonic
1058058676 9:100473689-100473711 GGCAGCGGCGGGGACTGTCCCGG + Exonic
1060770294 9:126327155-126327177 GCCCGCGGCGGGGACAGGCCCGG + Intronic
1060897397 9:127226139-127226161 GGCCGCGAAGGGCACAGTCACGG - Intronic
1060917119 9:127397922-127397944 TGCCGCGGCGGGGGGAGTGCTGG + Exonic
1060940824 9:127542011-127542033 GGCTGCGGCGGGCACAGGACGGG - Intronic
1061860987 9:133468714-133468736 TGCCTCAGCGTGGACAGTCCAGG - Exonic
1187900936 X:24025837-24025859 AGCTGCGTCGGGCCCAGTCCAGG - Intronic
1190024748 X:46912815-46912837 CGGCGCGGAGCGCACAGTCCCGG + Intronic
1192447917 X:71224349-71224371 GGGCTCGGCGGGCACAGGCCCGG - Exonic
1200163284 X:154019853-154019875 GGCCGCGGCGGGCGCGGGCCTGG + Exonic