ID: 1042864939

View in Genome Browser
Species Human (GRCh38)
Location 8:73348929-73348951
Sequence ACGGCTAGTAAGTTTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042864932_1042864939 25 Left 1042864932 8:73348881-73348903 CCTCTGAATCTGAAGGTCAGAGT No data
Right 1042864939 8:73348929-73348951 ACGGCTAGTAAGTTTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042864939 Original CRISPR ACGGCTAGTAAGTTTGGAGC TGG Intergenic
No off target data available for this crispr