ID: 1042871712

View in Genome Browser
Species Human (GRCh38)
Location 8:73405656-73405678
Sequence TTGGGGAAGGGGAAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042871712_1042871724 12 Left 1042871712 8:73405656-73405678 CCTTCCAGCTTCCCCTTCCCCAA No data
Right 1042871724 8:73405691-73405713 TTAAGGTAAATGCAGTAGTTTGG No data
1042871712_1042871730 21 Left 1042871712 8:73405656-73405678 CCTTCCAGCTTCCCCTTCCCCAA No data
Right 1042871730 8:73405700-73405722 ATGCAGTAGTTTGGGGTAGGGGG No data
1042871712_1042871726 14 Left 1042871712 8:73405656-73405678 CCTTCCAGCTTCCCCTTCCCCAA No data
Right 1042871726 8:73405693-73405715 AAGGTAAATGCAGTAGTTTGGGG No data
1042871712_1042871729 20 Left 1042871712 8:73405656-73405678 CCTTCCAGCTTCCCCTTCCCCAA No data
Right 1042871729 8:73405699-73405721 AATGCAGTAGTTTGGGGTAGGGG No data
1042871712_1042871731 24 Left 1042871712 8:73405656-73405678 CCTTCCAGCTTCCCCTTCCCCAA No data
Right 1042871731 8:73405703-73405725 CAGTAGTTTGGGGTAGGGGGTGG No data
1042871712_1042871720 -5 Left 1042871712 8:73405656-73405678 CCTTCCAGCTTCCCCTTCCCCAA No data
Right 1042871720 8:73405674-73405696 CCCAACAGTGGCAACCCTTAAGG No data
1042871712_1042871728 19 Left 1042871712 8:73405656-73405678 CCTTCCAGCTTCCCCTTCCCCAA No data
Right 1042871728 8:73405698-73405720 AAATGCAGTAGTTTGGGGTAGGG No data
1042871712_1042871725 13 Left 1042871712 8:73405656-73405678 CCTTCCAGCTTCCCCTTCCCCAA No data
Right 1042871725 8:73405692-73405714 TAAGGTAAATGCAGTAGTTTGGG No data
1042871712_1042871727 18 Left 1042871712 8:73405656-73405678 CCTTCCAGCTTCCCCTTCCCCAA No data
Right 1042871727 8:73405697-73405719 TAAATGCAGTAGTTTGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042871712 Original CRISPR TTGGGGAAGGGGAAGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr