ID: 1042872365

View in Genome Browser
Species Human (GRCh38)
Location 8:73410540-73410562
Sequence TCAGCTCCAAACTCACCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042872365_1042872368 10 Left 1042872365 8:73410540-73410562 CCCGGCGGTGAGTTTGGAGCTGA No data
Right 1042872368 8:73410573-73410595 CTGACCACAGTGCCTACGTGTGG No data
1042872365_1042872371 29 Left 1042872365 8:73410540-73410562 CCCGGCGGTGAGTTTGGAGCTGA No data
Right 1042872371 8:73410592-73410614 GTGGCCTCTTCGTGTGCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042872365 Original CRISPR TCAGCTCCAAACTCACCGCC GGG (reversed) Intergenic
No off target data available for this crispr