ID: 1042874565

View in Genome Browser
Species Human (GRCh38)
Location 8:73429094-73429116
Sequence CAGGGTTATCAGTGAGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042874565_1042874571 28 Left 1042874565 8:73429094-73429116 CCCACATCTCACTGATAACCCTG 0: 1
1: 0
2: 0
3: 16
4: 146
Right 1042874571 8:73429145-73429167 ATTTCTTTTCAATTTATAAGAGG No data
1042874565_1042874569 4 Left 1042874565 8:73429094-73429116 CCCACATCTCACTGATAACCCTG 0: 1
1: 0
2: 0
3: 16
4: 146
Right 1042874569 8:73429121-73429143 CAATAGCTTATAAGTATGAGAGG No data
1042874565_1042874570 5 Left 1042874565 8:73429094-73429116 CCCACATCTCACTGATAACCCTG 0: 1
1: 0
2: 0
3: 16
4: 146
Right 1042874570 8:73429122-73429144 AATAGCTTATAAGTATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042874565 Original CRISPR CAGGGTTATCAGTGAGATGT GGG (reversed) Intronic
901991560 1:13118519-13118541 AAGGGGCATCAGTGAAATGTTGG - Intergenic
903156110 1:21444903-21444925 CAAGGTTAACATTGAGATTTGGG - Intronic
905741532 1:40375122-40375144 CTTGGTTATTAGTGAAATGTTGG + Intronic
907752682 1:57278355-57278377 AAGAGTTATCAGTGGAATGTGGG - Intronic
907875951 1:58488774-58488796 CAGGGGAAACAGTGAGAAGTGGG - Intronic
907909641 1:58815041-58815063 CAGGGCTAGGAGTGAGATCTTGG - Intergenic
909350371 1:74645538-74645560 CAGGGTGTTAAGTGAGATTTTGG + Intronic
910768986 1:90811808-90811830 ATGGGTTTTCAGTGAGATGCTGG - Intergenic
910781482 1:90940252-90940274 CTGGGTTATAAATTAGATGTTGG + Exonic
912592452 1:110838076-110838098 CGGGGTTAATAGAGAGATGTTGG - Intergenic
912856615 1:113174096-113174118 CAAGGTTATTATTGATATGTGGG - Intergenic
913993448 1:143635803-143635825 CAAGGTTAACATTGAGATTTGGG + Intergenic
914361906 1:146943246-146943268 CAAGGTTAACATTGAGATTTGGG - Intronic
914489719 1:148143709-148143731 CAAGGTTAACATTGAGATTTGGG + Intronic
915905485 1:159873770-159873792 CATTGTTATCAGGGAGAAGTAGG - Intronic
918790607 1:188822572-188822594 CAGGCTTATCAGTGAAAGCTGGG - Intergenic
920777674 1:208955960-208955982 CAGTGTTATCAGTGGTATGGCGG - Intergenic
921914670 1:220593957-220593979 CAGGGGTCTCAGGGAGGTGTGGG - Intronic
924043518 1:240006487-240006509 CAGGTTTATTAGTGAGATTACGG - Intergenic
924097419 1:240567182-240567204 AAAGATCATCAGTGAGATGTGGG + Intronic
1066574985 10:36815568-36815590 CAAGGTTATCAGTAAAATATAGG - Intergenic
1068075957 10:52254199-52254221 CAGAGTTAGGAGTAAGATGTAGG + Intronic
1070643221 10:78183827-78183849 CAGGGGTGTCAGAGAGATGTTGG + Intergenic
1071102415 10:82054473-82054495 CAGGATTCTCATTTAGATGTGGG + Intronic
1071511918 10:86267458-86267480 CTGGGTTGCCAGGGAGATGTAGG - Intronic
1073983162 10:109177819-109177841 CAAGGTTCTCAGGGAGATTTGGG + Intergenic
1077028384 11:451822-451844 CAGGGTCTTCCGTGAGGTGTGGG + Intronic
1081110671 11:39129733-39129755 CAGGGTGATCAGTCAGCTGGTGG + Intergenic
1081800383 11:45854921-45854943 CAAGGTTATCAATGGGATTTTGG - Intronic
1082723581 11:56708313-56708335 CAGTGTTAATATTGAGATGTGGG - Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1087791842 11:102414215-102414237 CAGGGATGCCAGTGAGTTGTAGG - Intronic
1088728279 11:112658555-112658577 AAGGGTTTTCAATGAGGTGTTGG - Intergenic
1090158871 11:124470516-124470538 CAGTGTTGTCAGTGGGATGTAGG + Intergenic
1091415217 12:276895-276917 CTGGGTTCTCAGGGAGATGCTGG - Intergenic
1092708882 12:11312912-11312934 CAGGGTGATCATTGAAAAGTAGG + Intergenic
1097078821 12:56414329-56414351 GAGGGTAGTCAGTGAGAGGTGGG + Intergenic
1097393629 12:59046294-59046316 CTGGGTTTTCTGTGTGATGTGGG + Intergenic
1098308488 12:69124782-69124804 CAGGGTAAGCACTCAGATGTGGG - Intergenic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1104053369 12:125211145-125211167 CAGGGATATCTGTGAGGTTTTGG + Intronic
1104684159 12:130773539-130773561 CAGGGTTCTCGGTGAAGTGTTGG - Intergenic
1105982086 13:25527757-25527779 CATGGTTCTCAGGGATATGTAGG + Intronic
1111279658 13:86004498-86004520 CAGGGTAATCTTTGAAATGTTGG + Intergenic
1111591863 13:90358014-90358036 CAGGACTTTCAGTGTGATGTTGG - Intergenic
1111848258 13:93539261-93539283 CATGCTTCTCAGTGGGATGTGGG + Intronic
1113756650 13:112816503-112816525 ATGGGAAATCAGTGAGATGTGGG - Intronic
1113916446 13:113876748-113876770 CGTGGGTATCACTGAGATGTGGG + Intergenic
1118458505 14:65966687-65966709 CTGTGTTATCAGTGAGAGGCTGG - Intronic
1118694717 14:68373207-68373229 CAGGGTAATCAGTAAGCAGTGGG - Intronic
1118819257 14:69334429-69334451 CAGGGTTGCAAGTGAGATGGAGG + Intronic
1126598446 15:50404910-50404932 CGGGGAGATCAGTGAGAAGTGGG - Intergenic
1126888148 15:53174622-53174644 CAGGGATAACAGATAGATGTTGG + Intergenic
1128104340 15:65032113-65032135 CAGGGTTATCTGGGAGAACTCGG - Intergenic
1128233011 15:66048553-66048575 CTTGGTCATCAGTGAGCTGTCGG - Intronic
1128630477 15:69260969-69260991 CAGGGTTATCAGGAAGTTGTGGG - Intronic
1131583119 15:93664648-93664670 CAGGGTTAGCAGTTAGAGGAGGG - Intergenic
1133452924 16:5918625-5918647 CAGGGTAGACAGTGAGCTGTAGG + Intergenic
1137455560 16:48615232-48615254 CATGGTTGTCAGAGAGATGATGG - Intronic
1138447111 16:57071253-57071275 AAGGGTTGTGAGTGAGTTGTGGG + Intronic
1138460707 16:57146114-57146136 CGGGGTCATCAGTGACATGGAGG + Exonic
1140662701 16:77203060-77203082 CAGGGGAAGCAGTGAGATTTAGG + Intronic
1142279858 16:89142175-89142197 CAGGGCTATCACTGAGAAGCAGG + Intronic
1143863538 17:9908133-9908155 CAGTGTTACAAGTGAGAAGTGGG + Intergenic
1143892100 17:10110311-10110333 CAGTGTTCTCACTGATATGTAGG + Intronic
1150124771 17:62628733-62628755 CAGGGGTAACAGTGAAGTGTGGG + Intronic
1150431342 17:65120224-65120246 CAGGGTGGTCAGTGGGATGGAGG + Intergenic
1153508024 18:5823195-5823217 CAGGCTCATGAGTGAGATATCGG + Intergenic
1153535551 18:6098153-6098175 CAGGGCTCTCAGAGAGAAGTGGG - Intronic
1155001545 18:21692249-21692271 CAGGGTTAAGATTGAAATGTAGG - Intronic
1157642902 18:49235349-49235371 CAGGTGTATCAGTCAGATTTAGG - Intronic
1158058176 18:53306614-53306636 CAGAGTAATCAGTAAGCTGTTGG - Intronic
1158963546 18:62605335-62605357 CAGGGATGCCAGTGAGATGTGGG - Intergenic
1160094820 18:75861774-75861796 CAGGGTAATGAGTCAGAGGTGGG + Intergenic
1166871241 19:45872367-45872389 CATGGTGATGAGTGAGATATAGG - Exonic
1168659542 19:58155158-58155180 CGGGGTTTTCTGGGAGATGTAGG - Intergenic
927142072 2:20137375-20137397 CAGGGTTATCAGGGTGCTCTGGG + Intergenic
931324828 2:61209551-61209573 CAGCGTCATCAGAGACATGTGGG - Intronic
933161145 2:79026417-79026439 GAGGGTCAGCAATGAGATGTGGG + Intronic
935099117 2:99975723-99975745 AAAGGTAATGAGTGAGATGTTGG - Intronic
935437644 2:103053695-103053717 CAGTGTTATCATTGACAAGTAGG + Intergenic
940436980 2:153667150-153667172 CAGGGTTGCCAATGAGTTGTAGG - Intergenic
942433496 2:175943400-175943422 CAGAGTTATCAGAGTTATGTCGG - Intronic
1168850084 20:970363-970385 GAGGGTTATCAGCAGGATGTGGG - Intronic
1172411517 20:34727240-34727262 AAAGGTTAGCAGTGGGATGTGGG - Exonic
1173442363 20:43089503-43089525 CTGGGATATCAGTGAGTTTTGGG - Intronic
1176686307 21:9851308-9851330 AAGGGTGATAAGTGGGATGTAGG - Intergenic
1181143171 22:20822604-20822626 AAGGGTGATCAGTGAGGTATCGG - Intronic
1185089053 22:48755747-48755769 CCGGGTTATCAGTGAGCTCTGGG + Intronic
950156319 3:10724089-10724111 CAGTGTTACCTGTGTGATGTTGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951910794 3:27748412-27748434 CAGTGTTACCAGTGTGTTGTGGG - Intergenic
952296109 3:32063532-32063554 CTGGGCTATCAGGGAGATGTAGG + Intronic
956139230 3:66128648-66128670 CAGGGAAATAAGTGAGATATGGG + Intergenic
956237780 3:67094074-67094096 AATAGTTATCAGTGAGATGGAGG - Intergenic
957994510 3:87672130-87672152 CAGAGTAATCAGGGAGGTGTTGG + Intergenic
959439283 3:106357280-106357302 CAGGGACACCAGTGAGTTGTAGG + Intergenic
961935408 3:130577674-130577696 CAGTGTTAACTGTGAGATCTTGG + Intronic
962406603 3:135105996-135106018 CAGGTTTTTCAATGACATGTTGG - Intronic
962925795 3:139992345-139992367 CAGGGTTATCAAAGAGAAGGAGG - Intronic
963222492 3:142827179-142827201 CAGGGTCATCTCTGAGATGGCGG + Intronic
965517883 3:169641393-169641415 CAGGCTTATCAGTAAGGAGTTGG - Intronic
967120773 3:186380956-186380978 CAAGGTTATCAGTGACCTCTTGG - Intergenic
969413978 4:7046927-7046949 CAGGGTTAACAGTGACACCTGGG + Intronic
972484859 4:39531463-39531485 CTGGGTTAACAGCCAGATGTTGG - Intergenic
974113513 4:57552818-57552840 CAGGATTATTGGTGATATGTAGG - Intergenic
976027013 4:80700406-80700428 CAGTATTATCAGTGGGATGGTGG + Intronic
980349759 4:131669784-131669806 AAGGGTGATAAGTGGGATGTAGG - Intergenic
982035789 4:151344414-151344436 CAAGGTTATGGGTGAGATCTGGG + Intergenic
985898237 5:2763395-2763417 CAGTGTTAGCAGTGGGATGTGGG - Intergenic
990535618 5:56719146-56719168 CAGAGTCATCACTGAGCTGTTGG - Intergenic
991150286 5:63359993-63360015 CAGGTATACCAGTGAAATGTAGG + Intergenic
991417727 5:66409035-66409057 GAGAGATTTCAGTGAGATGTGGG + Intergenic
995651644 5:114376419-114376441 CAAGGTGATCAGTGTGATGGAGG + Intronic
997417173 5:133738021-133738043 CAGGGTTATCAGGTAGCTCTTGG + Intergenic
998003374 5:138641582-138641604 CAGGGCTATGAGTGTGTTGTCGG - Intronic
998192324 5:140037283-140037305 AAGGTTTATCACTGAGATTTAGG - Intronic
998257825 5:140602263-140602285 CTGGGTTTTGAGGGAGATGTAGG - Intergenic
998970400 5:147585031-147585053 CAGGGCTATCAGTGTAATGTAGG - Intergenic
1001307371 5:170585325-170585347 CAGGGTCATCAGTGAGTTAGGGG + Intronic
1001749207 5:174115987-174116009 CAGTATTATTAGTGAAATGTTGG + Intronic
1005870093 6:29968591-29968613 CTGGGTTACCAGTGACATTTAGG - Intergenic
1006055168 6:31378740-31378762 CAGGGATGCCAGTGAGATGGGGG + Intergenic
1007273120 6:40653362-40653384 CATGGTCATCAGTGACATGTTGG + Intergenic
1009951605 6:70403232-70403254 CAGTTCTATCAGTGAGATGTGGG - Intergenic
1011721095 6:90157521-90157543 CGAGGATATCAGTGAGCTGTGGG - Intronic
1014269692 6:119322728-119322750 CAGTTTTATCAGTGAAATATGGG - Intronic
1014368991 6:120581464-120581486 CAGGGTTGTCAATCAGATGATGG + Intergenic
1015221850 6:130813270-130813292 CAGGGTCTTCAGGGAGATGAGGG - Intergenic
1016491344 6:144607509-144607531 CAAGATTATCAGTGAAATGTTGG - Intronic
1019403077 7:867489-867511 CAGTGTTGTCAGTGTGATGCTGG + Intronic
1019942305 7:4301168-4301190 GAGGGTTATCGGTGCAATGTTGG - Intergenic
1025063063 7:55827596-55827618 CACGTTCATCATTGAGATGTTGG + Intronic
1026294117 7:69036314-69036336 CATGATTATCAGTAAGATGCAGG + Intergenic
1028374066 7:90126840-90126862 AATGGTTATTAGTGAGCTGTAGG - Intergenic
1029629667 7:101742558-101742580 CAGGGATGTCTGTGAGCTGTGGG + Intergenic
1032444781 7:131972880-131972902 CAGAGTGATCACTAAGATGTGGG - Intergenic
1035834543 8:2734457-2734479 CAGGGTTTTCTGTGAAATGTCGG + Intergenic
1038180044 8:25218966-25218988 AAGGAGTATCAGTGAGATTTGGG - Intronic
1038973917 8:32670456-32670478 AAGGGTTATTAGTGATATTTTGG + Intronic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1040569209 8:48592881-48592903 CAGGGCTTGCTGTGAGATGTGGG + Intergenic
1040875027 8:52141968-52141990 AAGGGCTAGCAGTGAGATGAGGG + Intronic
1042492882 8:69421442-69421464 CAGCATTATCATTGATATGTTGG + Intergenic
1042874565 8:73429094-73429116 CAGGGTTATCAGTGAGATGTGGG - Intronic
1044266261 8:90185410-90185432 CAGGGTTATAAGGGTGGTGTTGG + Intergenic
1048144457 8:131826872-131826894 CATTGTTATCACTGAGTTGTGGG - Intergenic
1049364538 8:142230724-142230746 CTGGGTCATCAGTTAAATGTTGG + Intronic
1050041972 9:1505183-1505205 CCTGATTTTCAGTGAGATGTTGG - Intergenic
1051698204 9:19790918-19790940 CAGGGTCATCTCTGAGCTGTAGG - Intergenic
1060328921 9:122646337-122646359 CAGTGTTATTATTGATATGTGGG - Intergenic
1060776485 9:126378478-126378500 CTGGGTGAGGAGTGAGATGTGGG - Intronic
1185781044 X:2846911-2846933 TAGGGAAATCGGTGAGATGTTGG + Intronic
1188291790 X:28398514-28398536 CAGAGTTATCAGTGAGTCATGGG + Intergenic
1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG + Intergenic
1195494163 X:105510391-105510413 CAGTGTGCTCAGTGAGATGTTGG - Intronic
1195881711 X:109599949-109599971 CAGTGTTAACAGTTTGATGTGGG - Intergenic
1197917328 X:131550463-131550485 GAAGGTGATCAGTGAGATGGGGG - Intergenic
1198523680 X:137477859-137477881 CTGGGTTATTAGTGAGTAGTTGG + Intergenic
1200770733 Y:7122993-7123015 CAGGGTTAGCAGTGGGATTTAGG - Intergenic
1201250765 Y:12055291-12055313 CATGGTGATCTGTGAGATTTGGG + Intergenic
1201289040 Y:12404759-12404781 TAGGGAAATCAGTGAGATGTTGG - Intergenic
1201929023 Y:19320799-19320821 CAGCTTTATCAGTGAGATGGAGG - Intergenic