ID: 1042875016

View in Genome Browser
Species Human (GRCh38)
Location 8:73433848-73433870
Sequence GCTTACTGAAACAGAGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042875008_1042875016 24 Left 1042875008 8:73433801-73433823 CCTATTTAATTATTTTTGATTCA No data
Right 1042875016 8:73433848-73433870 GCTTACTGAAACAGAGCTGCGGG No data
1042875013_1042875016 -9 Left 1042875013 8:73433834-73433856 CCCTTTGTCACGGGGCTTACTGA No data
Right 1042875016 8:73433848-73433870 GCTTACTGAAACAGAGCTGCGGG No data
1042875007_1042875016 29 Left 1042875007 8:73433796-73433818 CCTGGCCTATTTAATTATTTTTG No data
Right 1042875016 8:73433848-73433870 GCTTACTGAAACAGAGCTGCGGG No data
1042875012_1042875016 -8 Left 1042875012 8:73433833-73433855 CCCCTTTGTCACGGGGCTTACTG No data
Right 1042875016 8:73433848-73433870 GCTTACTGAAACAGAGCTGCGGG No data
1042875014_1042875016 -10 Left 1042875014 8:73433835-73433857 CCTTTGTCACGGGGCTTACTGAA No data
Right 1042875016 8:73433848-73433870 GCTTACTGAAACAGAGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042875016 Original CRISPR GCTTACTGAAACAGAGCTGC GGG Intronic