ID: 1042878922

View in Genome Browser
Species Human (GRCh38)
Location 8:73466404-73466426
Sequence CATCCTCTCTAATAAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042878922_1042878928 24 Left 1042878922 8:73466404-73466426 CCTCTGGCTTATTAGAGAGGATG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1042878928 8:73466451-73466473 AATAATCCAGGAAGGAAGCCAGG No data
1042878922_1042878926 12 Left 1042878922 8:73466404-73466426 CCTCTGGCTTATTAGAGAGGATG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1042878926 8:73466439-73466461 CAGGATGAAAGAAATAATCCAGG No data
1042878922_1042878927 16 Left 1042878922 8:73466404-73466426 CCTCTGGCTTATTAGAGAGGATG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1042878927 8:73466443-73466465 ATGAAAGAAATAATCCAGGAAGG No data
1042878922_1042878925 -7 Left 1042878922 8:73466404-73466426 CCTCTGGCTTATTAGAGAGGATG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1042878925 8:73466420-73466442 GAGGATGAAGGTTTCTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042878922 Original CRISPR CATCCTCTCTAATAAGCCAG AGG (reversed) Intronic
900748930 1:4381606-4381628 CCCCCACTCTAATAAGCCTGAGG + Intergenic
901954780 1:12776292-12776314 CATCCATCCCAATAAGCCAGCGG + Intronic
906469470 1:46116086-46116108 CATCCTCTCAAAAATGCCAAAGG - Intronic
907840477 1:58152330-58152352 CCTTCTCTCTGATAAGGCAGTGG - Intronic
908392203 1:63693675-63693697 CATCCTCACTGGGAAGCCAGTGG + Intergenic
908601566 1:65745133-65745155 CATCCTCTAAAATCAGGCAGAGG - Intergenic
908643098 1:66246904-66246926 CCTCCCATCTAATAACCCAGTGG + Intronic
909696389 1:78472707-78472729 CATACTCTCAAATTATCCAGTGG - Intronic
910416640 1:87007438-87007460 CATCCTCTATAATAACTTAGGGG - Intronic
910747882 1:90593073-90593095 CATCCTCTCTAATAAGATTAAGG - Intergenic
911676081 1:100659675-100659697 CATCTTCTCTCATCAGCCAAAGG + Intergenic
912726396 1:112062399-112062421 CATCCTCTCCAAGGAGCCAAGGG - Intergenic
916432522 1:164744856-164744878 CATCTTATCTAAGAAGACAGTGG + Intronic
916780470 1:168022071-168022093 CTTACTCTCTAATCAGCCTGGGG - Intronic
917914802 1:179690550-179690572 CATCTTCTCTGATTAGCCATTGG + Intronic
918983169 1:191589818-191589840 AATCCTCTCTGTTAAGCAAGAGG - Intergenic
920508184 1:206531703-206531725 GATCCTCTTGAATAAGTCAGTGG - Intronic
920563125 1:206953285-206953307 CAGCCCCTCTCATAAGCCACTGG + Intergenic
920658500 1:207894782-207894804 CATCATCTCTAGGCAGCCAGGGG - Intronic
920843682 1:209575970-209575992 CATGCTCACCCATAAGCCAGAGG - Intergenic
924352973 1:243136996-243137018 CAACCTCTGTAAAGAGCCAGAGG + Intronic
1065566430 10:27015781-27015803 CATCCTCTCTCATAAGCACAGGG + Intronic
1066749790 10:38642392-38642414 CATCATCTCTTAAAAGTCAGTGG - Intergenic
1066966858 10:42275384-42275406 CATCATCTCTTAAAAGTCAGTGG + Intergenic
1069662841 10:70135087-70135109 CATCATCCCTAAGGAGCCAGAGG + Intergenic
1069781277 10:70957283-70957305 CATCTTCTCTAGGAAGCCATTGG + Intergenic
1069831930 10:71286942-71286964 CATCCTCCCTACCAATCCAGGGG - Intronic
1070750113 10:78959100-78959122 CTTGCTGCCTAATAAGCCAGTGG + Intergenic
1071937429 10:90547274-90547296 CTTCCTCTATATTAAGCCAAAGG - Intergenic
1077242335 11:1517230-1517252 CATCCTCTCCAGTGAGCCTGGGG - Intergenic
1078024022 11:7677710-7677732 CTGCCTCTCTAATAACACAGAGG - Intergenic
1080047146 11:27821199-27821221 CATCATCTCCAATCAGGCAGTGG + Intergenic
1084517318 11:69643906-69643928 CTTCCTCTCCAAAATGCCAGAGG + Exonic
1093042869 12:14404824-14404846 CATCATATCAAATAAGCCAGTGG - Intronic
1097188672 12:57209249-57209271 CATCCTCCCTACTGAGCCAAAGG + Intronic
1100026114 12:90130152-90130174 TATCCCCTCAAATTAGCCAGTGG + Intergenic
1104261864 12:127191507-127191529 CTTCCATTCCAATAAGCCAGAGG + Intergenic
1105709120 13:22989192-22989214 CATACTTTCTAATAATTCAGCGG - Intergenic
1108049826 13:46422212-46422234 CCTCTTCTTTAAAAAGCCAGGGG + Intronic
1111360169 13:87165760-87165782 CATGCTTCCTAATAAGCCAGTGG + Intergenic
1112845734 13:103640885-103640907 CATCTTCTCTAATGACTCAGTGG - Intergenic
1114288744 14:21270370-21270392 CATCAGCTCTACTAAGCCAGCGG + Intergenic
1115442026 14:33446479-33446501 CATGCTTTCTAATAAGCAAGAGG + Intronic
1116288684 14:43005186-43005208 CATCCCCTCTAAAAAGGCTGAGG - Intergenic
1116660325 14:47701710-47701732 CCTCCCCTGCAATAAGCCAGGGG - Intergenic
1118528259 14:66670381-66670403 CATCCTCTCTGGAAAGCCATAGG + Intronic
1119507925 14:75188908-75188930 CATCCTCATTTCTAAGCCAGAGG + Intergenic
1121561137 14:94876413-94876435 CAAGCTCTCTAATAAGGCAGTGG + Intergenic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1125798208 15:42420016-42420038 CCTTCTCTCTATAAAGCCAGAGG + Intronic
1130906810 15:88246560-88246582 CAACTTCTCTATTAAGCCTGTGG + Intronic
1131810947 15:96172089-96172111 TTTCCTCTCTAAGAAGCAAGTGG - Intergenic
1136412388 16:30085023-30085045 CATCCCCTCCAAGAAGCCCGTGG + Exonic
1138195377 16:55048062-55048084 CATCCTATCCAGTGAGCCAGTGG - Intergenic
1141815465 16:86406516-86406538 AACCCTATCTGATAAGCCAGAGG + Intergenic
1142979721 17:3664548-3664570 CATGCTCTCTAAGAAGGCATCGG - Intronic
1147005236 17:37397900-37397922 CATCCTCTGAAAAAAGGCAGTGG + Intronic
1148006813 17:44438936-44438958 CACCCTCTTCAATAAGGCAGGGG + Intronic
1164442887 19:28292838-28292860 CATCCTTTCTAATGGGTCAGTGG + Intergenic
1167974632 19:53215095-53215117 AATCCTTTCCTATAAGCCAGTGG - Intergenic
928762118 2:34596607-34596629 CATCCACTATAATAAGCTATTGG - Intergenic
929866178 2:45719235-45719257 CATCATCTCCAAGAAGCCGGAGG - Intronic
930227828 2:48812333-48812355 CATCCTCTGAAATCAGGCAGAGG + Intergenic
930616780 2:53602194-53602216 CTTTCTCTCAAATATGCCAGGGG - Intronic
933134199 2:78711203-78711225 CATCATCTCTGGGAAGCCAGTGG - Intergenic
944684212 2:202103999-202104021 CAAACTCTCCAAGAAGCCAGTGG - Intronic
946509624 2:220340766-220340788 CAGCCTCTGTAATAACACAGTGG + Intergenic
946619842 2:221549047-221549069 CATCCTGTCCAAAATGCCAGTGG + Intronic
948119520 2:235518758-235518780 CTTTCTATCTCATAAGCCAGAGG + Intronic
1169274718 20:4225847-4225869 CATCCTGACTAATGCGCCAGTGG - Intronic
1170278858 20:14623685-14623707 CATCATCCCTGAAAAGCCAGTGG + Intronic
1172344364 20:34185733-34185755 CATCCTGTCTACTAAGCAAGAGG + Intergenic
1173035760 20:39408327-39408349 CACCCTCTCTAAGCAGCCCGCGG - Intergenic
1176927140 21:14764159-14764181 CATCCTCTATATTATGCAAGAGG + Intergenic
1178047457 21:28711450-28711472 CATCCTCTCACATCAGGCAGTGG - Intergenic
1178584047 21:33858218-33858240 CAGCTCCTCTAATAAGCCAGTGG - Intronic
1179310455 21:40191163-40191185 AAACCTCTCTAGTAAGCCATGGG - Intronic
949813332 3:8031897-8031919 CAACCTAGCTAATAAGGCAGTGG - Intergenic
950291074 3:11784959-11784981 AATGCTCTCAAATTAGCCAGGGG - Intergenic
951030829 3:17880091-17880113 CATCCAGTCTAATAACTCAGAGG + Intronic
954012805 3:47657454-47657476 CATCCTCTTAAAATAGCCAGTGG + Intronic
956060211 3:65341302-65341324 CATCCTCCCTATCAACCCAGTGG - Intergenic
959273735 3:104248767-104248789 CTTCCTCTTTAATCAGGCAGAGG + Intergenic
961150126 3:124630935-124630957 CATCCTCTCTAATTAGGCCATGG + Intronic
965985976 3:174753691-174753713 CCTCCTCTCTACCCAGCCAGTGG + Intronic
966191553 3:177276362-177276384 GATCCTCTCTAATAATCCTAAGG - Intergenic
966829781 3:183997614-183997636 CAAACTCTCTACTATGCCAGAGG - Intronic
968474929 4:799882-799904 GATCCTCTGTAATAAACCATAGG + Intronic
971154445 4:24066226-24066248 AAGCCTCTCTAAAAAGCAAGTGG + Intergenic
974283297 4:59827946-59827968 CATACTACTTAATAAGCCAGTGG + Intergenic
975024221 4:69529553-69529575 CTTCCTCTATATTAAACCAGGGG - Intergenic
976872598 4:89813195-89813217 GATCCTCTCTAATACTTCAGGGG - Intronic
977668173 4:99665121-99665143 CATCCTCTCTAAAAAGTCTCTGG - Intergenic
979248974 4:118543531-118543553 CAACCTCTGTAAAGAGCCAGAGG - Intergenic
979452133 4:120885195-120885217 GATCTCCTCTAATATGCCAGAGG - Intronic
979503598 4:121468030-121468052 TCCCCTCTCTAATAAGCCTGAGG + Intergenic
981616753 4:146650593-146650615 CATTCTAGCTAAAAAGCCAGGGG - Intergenic
983412554 4:167418670-167418692 CAGCTTCTTTAATAAGGCAGAGG - Intergenic
985062539 4:186093187-186093209 TAAGCCCTCTAATAAGCCAGAGG - Intergenic
988766152 5:34380232-34380254 CTTCCTCTCTATTAAACCAAGGG - Intergenic
988819696 5:34869393-34869415 CATTCTCTCTTGTCAGCCAGAGG - Intronic
990270891 5:54137546-54137568 CAGCTTCTCTAATAAACCTGGGG + Intronic
990669734 5:58114696-58114718 CATCCTCCCTAATGGGGCAGAGG - Intergenic
995015393 5:107303788-107303810 CATCCCCTCTAGTCAGCCAGAGG + Intergenic
995353404 5:111209369-111209391 CATACTCTCTGATAAGCCAGAGG + Intergenic
995728739 5:115212917-115212939 CATGTTCTCTAGTAAGCAAGAGG - Intronic
998614602 5:143726462-143726484 CATCCTCTCTAGTAAGAGTGGGG + Intergenic
999114769 5:149153053-149153075 CACTCTCTCTAATAAGCCCCAGG + Intronic
1001154449 5:169261116-169261138 CCTGCTCTCTACTATGCCAGAGG + Intronic
1001850104 5:174956350-174956372 TATCCTCTCTTATAAGCCACTGG - Intergenic
1006521156 6:34572044-34572066 CATGGTCTCTACTAGGCCAGGGG - Intergenic
1007297037 6:40832114-40832136 CAACCTCGCTAATGAGACAGGGG - Intergenic
1007626337 6:43248261-43248283 CACCCTCTCTAACACTCCAGGGG - Intronic
1017258590 6:152362398-152362420 CATCCACTCCAGTAAGCAAGGGG + Intronic
1017860726 6:158394872-158394894 CATCCTTCCTATTAAGCCTGTGG - Intronic
1018490803 6:164290733-164290755 CATCCACTTTAATAAGATAGAGG + Intergenic
1019423747 7:963535-963557 CATCCACTCTGAAGAGCCAGGGG - Intronic
1023329596 7:39100666-39100688 CAAACTCTCTTTTAAGCCAGTGG + Intronic
1024384400 7:48735061-48735083 CCTTCTCTCTAGTAAGCCATAGG + Intergenic
1024801549 7:53086022-53086044 TCCCCACTCTAATAAGCCAGAGG + Intergenic
1028726336 7:94091955-94091977 CATACACACTAATAAGCCACAGG - Intergenic
1031953772 7:127920876-127920898 CATTCTCTAGAATAAGCCAAGGG + Intronic
1037656686 8:20889593-20889615 CTTCCTCTATAAAAAGCCAGGGG - Intergenic
1040831880 8:51686084-51686106 CATTCTTTCTAATGAGCCATAGG + Intronic
1040986073 8:53295803-53295825 TGTCCTTTCTAATAAGCCAGTGG - Intergenic
1041940356 8:63380913-63380935 CATGCTTTCTATTAAGCCTGTGG + Intergenic
1042878922 8:73466404-73466426 CATCCTCTCTAATAAGCCAGAGG - Intronic
1044193092 8:89342767-89342789 CATCCTTTCTATCAAGGCAGAGG + Intergenic
1047790481 8:128198640-128198662 CATACTCTCTGAGGAGCCAGGGG - Intergenic
1049002590 8:139835542-139835564 CATCCTCACTAATAAACCTGGGG + Intronic
1052685206 9:31746449-31746471 TATCCTTTATAATAAACCAGTGG + Intergenic
1058652550 9:107190291-107190313 CATCACCTCTAATTAGCCACTGG - Intergenic
1060106541 9:120876649-120876671 CATCCTTTTTAAAAAGCCAACGG - Intronic
1187715825 X:22101622-22101644 CATCCTCTCTATTCAGCTGGAGG + Intronic
1188953517 X:36406609-36406631 CATCCTCAATAAAAAGCCACAGG + Intergenic
1191719517 X:64217732-64217754 CTTCCTCTATAATAAACCAAGGG + Intergenic
1197053258 X:122086612-122086634 CATGAGCTCTAATAAGGCAGAGG + Intergenic
1200326784 X:155248890-155248912 CATTCTCTACAAGAAGCCAGAGG + Intergenic
1201142691 Y:11041712-11041734 CACACTTTGTAATAAGCCAGGGG + Intergenic
1201458389 Y:14195612-14195634 CATCTTCTTTACTATGCCAGTGG - Intergenic