ID: 1042880244

View in Genome Browser
Species Human (GRCh38)
Location 8:73479928-73479950
Sequence CAGGGAAACCAGTAGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 543}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042880244_1042880248 -1 Left 1042880244 8:73479928-73479950 CCGTCTTCCTACTGGTTTCCCTG 0: 1
1: 0
2: 1
3: 51
4: 543
Right 1042880248 8:73479950-73479972 GTCTCCAGTCTTTCCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042880244 Original CRISPR CAGGGAAACCAGTAGGAAGA CGG (reversed) Intronic
902224482 1:14988100-14988122 CAGGGAAACCAGTAGTGAGCAGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903728563 1:25471644-25471666 CAGGGAAAATACTAGGAAGCAGG + Intronic
904354576 1:29930760-29930782 CAGGGACAGCTGTAGGGAGAGGG - Intergenic
904849055 1:33443486-33443508 CAGGGAGAACAGCAGGTAGAGGG + Intergenic
905389686 1:37628480-37628502 CAGGGAAACATGAAGCAAGAGGG + Intronic
906364860 1:45199246-45199268 CAAGAAAACCACTAGGCAGAAGG + Intronic
906395357 1:45458889-45458911 CATGGAAAAAAGTAGAAAGAGGG - Intronic
907330124 1:53665278-53665300 CTGGGCAACTAGTAGGAACATGG + Intronic
907342666 1:53747991-53748013 CAGGGAGACCAATGGGAAGCTGG - Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908295365 1:62707398-62707420 CAGGGAAACTAGTAGGGGTAGGG + Intergenic
908427207 1:64018645-64018667 CAGGAAAAGCAGTATGGAGAGGG + Intronic
908469481 1:64429532-64429554 CAGGGAAGCAAGGAAGAAGAAGG - Intergenic
908805074 1:67922117-67922139 CAGGGAAACCAAGAGGTTGATGG + Intergenic
909127701 1:71695519-71695541 GAGGGAAAACAGTAGGAAAAAGG - Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
911012121 1:93291329-93291351 CAGTGAAAACAGTACTAAGAGGG + Intergenic
911196000 1:94996375-94996397 GAGGAAAAGCAGTGGGAAGAAGG + Intronic
911727845 1:101260987-101261009 CAAGGAAATCACAAGGAAGAAGG - Intergenic
911876972 1:103178871-103178893 CTGGTAAACCAGTAAGAAGAAGG + Intergenic
912794878 1:112686936-112686958 CAGGGAGACCAGTTAGAAGAAGG - Intronic
912872855 1:113326132-113326154 GAGGGAAACCAGAATGAAGCTGG - Intergenic
913223805 1:116680912-116680934 GAGGGAGAGCAGTAGGAAGTGGG + Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914814965 1:151056576-151056598 GAGGGAAATCAGGAGGAATAGGG - Intronic
915057894 1:153152656-153152678 CAGGGATGCCAGAAGGAACAGGG + Intergenic
915279178 1:154810603-154810625 TAGGGAAACCAGGAGAAGGAAGG + Intronic
915337066 1:155150745-155150767 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
915570382 1:156742252-156742274 TAGAGAGACCAGTAGGAAGAGGG + Intronic
916755956 1:167770561-167770583 ATAGGAAACCAGAAGGAAGAGGG + Intronic
916911428 1:169351418-169351440 CAGTGAAAGCAGTATTAAGAGGG + Intronic
917476363 1:175372660-175372682 CAGGGAAAGTGGTAGGGAGAAGG + Intronic
917562095 1:176168820-176168842 AAGGGAAGTCAGGAGGAAGAGGG + Intronic
918000624 1:180491468-180491490 TAGGGAATCCAGCAGGAAAAGGG - Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918906362 1:190500448-190500470 GAGGGAAACAGGTAGGGAGAAGG + Intergenic
918947367 1:191084794-191084816 CAGGAAAACCAGTAACAAAATGG + Intergenic
919429032 1:197470187-197470209 CAGGGAAACAATTGGGAACAAGG + Intronic
919495181 1:198256314-198256336 CAGGCAAACCTGCAGGAAAATGG - Intronic
919595378 1:199555271-199555293 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920096915 1:203492353-203492375 GAGGGCATCCAGTAGGCAGATGG - Intergenic
920864971 1:209744353-209744375 CAGGGAAACCAGGAAGGAGTTGG - Intergenic
921305766 1:213795149-213795171 CAGAGAAATCAATAGGTAGATGG - Intergenic
922876058 1:228940700-228940722 CAGGGGACCCAGTGGGACGAGGG - Intergenic
923515742 1:234696467-234696489 CATGGAAACCAGTTGAAAGAGGG - Intergenic
923575713 1:235157219-235157241 AAGGGAGACCAGTAAGGAGATGG + Intronic
923760562 1:236839341-236839363 CAGTCAACCCAGTAGGAAAATGG + Intronic
924258823 1:242209279-242209301 CAGGGAGTCCTGTGGGAAGACGG - Intronic
924630245 1:245731279-245731301 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG + Intronic
1063771353 10:9205833-9205855 CAGTGAAATGAGTATGAAGAAGG + Intergenic
1063872088 10:10428658-10428680 CAAGGAAAAGAGTGGGAAGAGGG - Intergenic
1064521293 10:16205037-16205059 CAGTGAAAGCAGTATTAAGAGGG - Intergenic
1065121189 10:22531819-22531841 CAGGGAAAGAATTAGGAAAATGG + Intergenic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065431235 10:25658987-25659009 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1065780217 10:29160370-29160392 AAGGCAAACCAGTTGGGAGATGG + Intergenic
1066239861 10:33523152-33523174 CAGGGAAAAAAGTGGGAAGCTGG + Intergenic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067480304 10:46592048-46592070 AATGGAAACAAGTAGTAAGATGG - Intronic
1067614433 10:47749752-47749774 AATGGAAACAAGTAGTAAGATGG + Intergenic
1068531716 10:58196204-58196226 CTTGGCAACCAGTGGGAAGATGG + Exonic
1068563149 10:58540114-58540136 CAGCAAAAGCAGTAGTAAGAGGG + Intronic
1069025095 10:63531135-63531157 CAGGGAAAACAGTAGCAATCAGG + Intronic
1069319895 10:67156428-67156450 CAGCAAAACCAGTACTAAGAGGG - Intronic
1069631717 10:69901326-69901348 CTGGAAAACCTGTAGGCAGATGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1070402776 10:76067977-76067999 CAGGGAAACCTGCAAGAAGGGGG + Intronic
1070837002 10:79454364-79454386 CAGGAAAGCCAGTAGCAGGAAGG - Intergenic
1071321424 10:84463323-84463345 TAGGGAACCTAGTAGGAAGCTGG - Intronic
1071520564 10:86329427-86329449 CATGGAAGCCAGGAGGAAGGGGG + Intronic
1072096058 10:92181479-92181501 AATGGCAACCAGAAGGAAGACGG + Intronic
1072402230 10:95116228-95116250 CAGCGAAAGCAGTACTAAGAGGG - Intergenic
1072719748 10:97773086-97773108 TAGGGAACACAGTGGGAAGAGGG + Intergenic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073482189 10:103793194-103793216 TAGGGATATCAGTAGGAGGAAGG - Intronic
1073556313 10:104455752-104455774 GAGGAAAACCAGTAAGAGGATGG + Intergenic
1073624002 10:105077395-105077417 TGGGGAAACCAGAAGGATGAAGG + Intronic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1078244233 11:9558925-9558947 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1078691892 11:13589801-13589823 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079339094 11:19597437-19597459 CAGGGAAGTCAGTAGTAAGATGG - Intronic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1079930050 11:26547119-26547141 AAGGGATGCTAGTAGGAAGATGG + Intronic
1080054954 11:27896948-27896970 CAAGATAACCAGTAGAAAGATGG + Intergenic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1081960484 11:47132871-47132893 CAAGGAAACAGCTAGGAAGAGGG - Intronic
1082182246 11:49133707-49133729 TAGGAAAACAAGAAGGAAGATGG - Intergenic
1083041670 11:59693856-59693878 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1083162164 11:60861275-60861297 CCAGGAAACCAGCAGGAAGCAGG - Intergenic
1084406464 11:68976803-68976825 GAGGGAACCCAGAAGGCAGAGGG + Intergenic
1084951731 11:72670146-72670168 GAGGGACAGCACTAGGAAGATGG - Intronic
1085046527 11:73356827-73356849 CAGGGAGACCTGCAGGTAGAGGG - Intronic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1086683262 11:89701239-89701261 TAGGAAAACAAGAAGGAAGATGG + Intergenic
1088318382 11:108530455-108530477 CAGGGAAGGCAATAGGAAGATGG + Intronic
1088511721 11:110582427-110582449 CAGGGAAACCTGTAAGAAAAAGG + Exonic
1088612881 11:111595275-111595297 CAGCAAAACCAGTACTAAGAGGG - Intergenic
1089634581 11:119804082-119804104 CAAGCAAGCCAGCAGGAAGATGG - Intergenic
1089761848 11:120732519-120732541 CAGTGAAAACAGTACTAAGAGGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090317993 11:125813961-125813983 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1090609080 11:128454027-128454049 AAGGGAAACCATAAGGAAGAAGG - Intergenic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091489543 12:921125-921147 CAGGGAAAGAAGTCGTAAGAGGG + Intronic
1091916414 12:4274003-4274025 CGGGGAAAGCAGGAGGGAGAGGG + Exonic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1093033413 12:14310410-14310432 CAGTGAAAGCAGTACTAAGATGG + Intergenic
1093046458 12:14451517-14451539 CAGTGAAAACAGTGGTAAGAAGG - Intronic
1093347686 12:18059436-18059458 CAGCAAAACCAGTTGTAAGAGGG + Intergenic
1093357213 12:18180295-18180317 TAGGGAAGCAAGTAGGAACAAGG + Intronic
1093419720 12:18961338-18961360 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1093538477 12:20251357-20251379 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1093620334 12:21281084-21281106 CAGTGAAAGCAGTACTAAGAAGG + Intronic
1094196283 12:27753235-27753257 AAGGGAAACCAGTAAGATGCAGG - Intronic
1094655410 12:32414932-32414954 CAGTGAAAGCAGTACTAAGAAGG - Intronic
1094795181 12:33963810-33963832 CAGGCAGACAAGTAGGCAGATGG + Intergenic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095107811 12:38256906-38256928 CAGGCAGACAAGTAGGCAGATGG + Intergenic
1095212937 12:39514552-39514574 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095716511 12:45351922-45351944 CAGGGAGACCACTAGGTAGGAGG + Intronic
1095801943 12:46278314-46278336 CTGGGAAACCATTAAGAACATGG - Intergenic
1095899238 12:47310706-47310728 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1097898220 12:64847528-64847550 CAGTGAAAGCAGTACTAAGAGGG - Intronic
1097994490 12:65872698-65872720 CAGGAAAACTAGTAGGAGGCTGG - Intronic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099970151 12:89491722-89491744 CAGACAAACAAGTAGGAAAATGG - Intronic
1100376628 12:94022432-94022454 CGGGGAGACCAGTGAGAAGATGG + Intergenic
1101034047 12:100687330-100687352 CAGGACAACCAGCAGGAAGGAGG - Intergenic
1101248811 12:102911148-102911170 CAGGGAACCCAGCAGTTAGAGGG + Intronic
1101964804 12:109275103-109275125 CAGGGAAAGGAATAAGAAGATGG - Intergenic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1104160688 12:126177336-126177358 CAGGGAAAAGGGTGGGAAGAGGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1105690750 13:22837148-22837170 CTTGGCAACCAGTGGGAAGATGG + Intergenic
1105761436 13:23518775-23518797 AAGGTAAATCAGTAGAAAGAGGG - Intergenic
1106287890 13:28334110-28334132 CAGGCAAATCACTTGGAAGAGGG - Exonic
1106459869 13:29959350-29959372 CCTGGAAAACAGTAGGAAGAAGG + Intergenic
1107384528 13:39893802-39893824 CAGAGACACCAAGAGGAAGACGG - Intergenic
1107523775 13:41209930-41209952 CAGTGAAAACAGTACTAAGAGGG - Intergenic
1107887941 13:44890195-44890217 CAGGAAAACAGGCAGGAAGAAGG + Intergenic
1107908159 13:45081241-45081263 AAGGGAAATCAATAGGATGAAGG - Intergenic
1108067597 13:46594199-46594221 CAGGCAAAACAGTAAGAACATGG - Intronic
1110713105 13:78671587-78671609 CTGGGAATCCAGGAGGTAGAAGG + Intergenic
1110718707 13:78737532-78737554 CAGGGAAACCAGCAGGATCACGG + Intergenic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1112092567 13:96097161-96097183 CAAGGTAACCATCAGGAAGAAGG - Intronic
1113033357 13:106018953-106018975 CCGGGAAATGAGTAGGAAGGAGG + Intergenic
1113333364 13:109353797-109353819 CAGGTAAACCAGGAGAAAGGAGG + Intergenic
1113588183 13:111480012-111480034 CATGAAAACCACTGGGAAGAAGG + Intergenic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1114044356 14:18709271-18709293 CAGGGAAACCAATATGAAATGGG + Intergenic
1114048640 14:18899721-18899743 CAGGGAAACCAATATGAAATGGG + Intergenic
1114113874 14:19501925-19501947 CAGGGAAACCAATATGAAATGGG - Intergenic
1114115572 14:19619676-19619698 CAGGGAAACCAATATGAAATGGG - Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114751750 14:25211845-25211867 CAGGAAAAAAAGTTGGAAGAGGG - Intergenic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1115550310 14:34499169-34499191 CAAGAAAACCAGTTGGAAGATGG + Intergenic
1115673250 14:35640076-35640098 CAGTGAAAGCAGTACTAAGAGGG + Intronic
1116056208 14:39866657-39866679 GAGGGAGAGCAGGAGGAAGAAGG + Intergenic
1116268230 14:42724520-42724542 GAGAGAAGCCAGTAGGAAGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117530551 14:56656959-56656981 TGGGGAAACCAGTAGAAAGAGGG - Intronic
1117953887 14:61108041-61108063 CAGGGAACCCAGTAGGGAAATGG - Intergenic
1118538336 14:66793327-66793349 CAGGGAAAGCACAAAGAAGATGG + Intronic
1119194093 14:72704161-72704183 AAGGGATGCCAGTTGGAAGAAGG - Intronic
1119610771 14:76060066-76060088 CAGGGAAAACAGTACTAACAAGG + Intronic
1119950430 14:78738822-78738844 CAGGGAAATAAGAAGGCAGATGG + Intronic
1120548456 14:85839994-85840016 CATGGAAACCAGAAGAAAGCTGG + Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121006773 14:90495730-90495752 CAAGGAAAACAGTGGGATGATGG + Intergenic
1121049023 14:90807991-90808013 CAGTGAAACTAGTTGGAAGTGGG + Intronic
1122110120 14:99494121-99494143 CAGGGAAAGTGCTAGGAAGAAGG + Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1123503729 15:20916472-20916494 CAGGGAAACCAATATGAAATGGG + Intergenic
1123560974 15:21490144-21490166 CAGGGAAACCAATATGAAATGGG + Intergenic
1123597216 15:21927437-21927459 CAGGGAAACCAATATGAAATGGG + Intergenic
1123876968 15:24633283-24633305 CAGTTATACCAGTAGGAAGGTGG + Intergenic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1124702821 15:31931492-31931514 TAGGGAAACCACAAGGAATAGGG - Intergenic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1125860703 15:42996941-42996963 CAGTGAAATCAGTAGGGTGAAGG - Intronic
1126289207 15:47053698-47053720 CAGGCAACCCAATAGGAAAATGG + Intergenic
1126857023 15:52848469-52848491 CAGGAAAACCACTATGAGGAAGG - Intergenic
1129107987 15:73322415-73322437 CAGTTAAACCTGAAGGAAGAAGG + Exonic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129785139 15:78304760-78304782 CAGGATAACCAGTGGGCAGAGGG + Intergenic
1129987976 15:79935465-79935487 CAGGGCAACAAGTGGGGAGAAGG + Intergenic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1130146530 15:81278516-81278538 CAGGGAGACAAGGAGGAAGGAGG + Intronic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1132328534 15:100993834-100993856 CTAGGAAACCAGCAGGAATAAGG - Intronic
1202969321 15_KI270727v1_random:217310-217332 CAGGGAAACCAATATGAAATGGG + Intergenic
1133342933 16:5049039-5049061 AATGGAAACCAGAAGGAAGAAGG + Intronic
1134186310 16:12087825-12087847 CACGTCAACCAGGAGGAAGAGGG - Exonic
1136548368 16:30967913-30967935 CAGGCAAACTAGGAGGAAGGTGG - Intronic
1137457283 16:48627564-48627586 AAGGGAGTCCACTAGGAAGACGG - Intergenic
1138897331 16:61222621-61222643 GAGGAAAACCAGAAGGTAGAAGG - Intergenic
1140964741 16:79954460-79954482 CAGGGCAACAAGTAGAGAGATGG + Intergenic
1142057676 16:88009250-88009272 GAGGGAAAGCATTAGGAATATGG + Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142984859 17:3689534-3689556 CACGGAGCCCAGTCGGAAGATGG + Exonic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143807621 17:9442327-9442349 CAGGGAAACCAGTCAGGAGGTGG - Intronic
1144665348 17:17098587-17098609 GAGGGAATCCAGGAGAAAGAAGG + Intronic
1145069575 17:19792068-19792090 CAGTGAAAGCAGTACTAAGAGGG + Intronic
1146423518 17:32712979-32713001 CATGGATACCAGGAGGTAGAGGG + Intronic
1147162059 17:38574088-38574110 CAGGGAATCCAGTGGGAACAGGG - Intronic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147418665 17:40311223-40311245 GAGGGAAGCCAGTGGGAGGATGG + Intronic
1147549185 17:41426675-41426697 GAGGGAAACCAGAAGGACCATGG + Intergenic
1147590528 17:41680282-41680304 CAGGCAGCCCAGCAGGAAGAGGG + Intergenic
1148794287 17:50189714-50189736 CAGGGAAACCAGTAGCACCCTGG + Exonic
1148901663 17:50883216-50883238 CAGGGAAACCAGTAGGCGGCTGG - Intergenic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1151212178 17:72552880-72552902 CATGGAAACCCCTAGGAAAAGGG + Intergenic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1153698976 18:7673463-7673485 GAGAAAAACCATTAGGAAGAGGG + Intronic
1154145211 18:11861266-11861288 CAGGGACCCTAGAAGGAAGAAGG - Intronic
1155011419 18:21782459-21782481 CAGAAAAAGCAGTAGTAAGAGGG - Intronic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1156353626 18:36322472-36322494 CAGGTACACCAGTAGGGAGCTGG + Intronic
1156559636 18:38108158-38108180 TATCGAAACCAGTAGGAAGCAGG + Intergenic
1157379347 18:47197700-47197722 CAGGAAAAGCAGTACTAAGAGGG + Intergenic
1157415678 18:47500774-47500796 CAGGGAAACAAGGATGAAGGGGG + Intergenic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1160138204 18:76293237-76293259 CAGTGAAAACAGTACTAAGAGGG - Intergenic
1160444163 18:78914279-78914301 CAGGGAAGCCAGGTGGAAAATGG - Intergenic
1160556728 18:79730371-79730393 CCAGGAAACCAGGAGGGAGACGG - Intronic
1160683980 19:425001-425023 CAGGGAATCCCGTAGGGAGTGGG + Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1161362112 19:3856204-3856226 CGGGGAAGCCAGCAGGATGAAGG + Intronic
1161826550 19:6570484-6570506 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1162341647 19:10094860-10094882 CAGTGACACCAGTAGGATGCTGG - Exonic
1163219835 19:15910702-15910724 CTTGGCAACCAGTGGGAAGATGG + Intergenic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1164887524 19:31794981-31795003 CAGTAAAACCAATATGAAGATGG + Intergenic
1165298549 19:34949920-34949942 GAGAGAAACAAGGAGGAAGAGGG + Intergenic
1166599589 19:44082223-44082245 CAGGACAACCAGCAGGAAGGAGG - Intronic
1167214240 19:48153881-48153903 CAGAGAAGCCAAGAGGAAGAAGG - Exonic
1167888291 19:52519812-52519834 CAGGGCAACAGGTAGGGAGAAGG + Intergenic
1168559096 19:57368530-57368552 CAGGGGACCCTGAAGGAAGAGGG - Exonic
1168578168 19:57531056-57531078 CATGGGAATCTGTAGGAAGAGGG - Exonic
1168592896 19:57651775-57651797 AAGGGAAAGTGGTAGGAAGACGG - Intergenic
1168663641 19:58185928-58185950 CAGGGGCACCAGTAGGAAAAGGG + Intronic
925232626 2:2247878-2247900 CAGTGAAAGCAGTACTAAGAGGG + Intronic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925824321 2:7832569-7832591 CAGGGAGATCACTAAGAAGAGGG - Intergenic
926389279 2:12370932-12370954 CATAGAAAACAGTAGGTAGAGGG + Intergenic
926732921 2:16050725-16050747 CAGGGAAACCAGCAGACAAAAGG - Intergenic
927909892 2:26889903-26889925 CAGGGAAAGCTGTAAGAATAAGG + Intronic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
928851188 2:35749122-35749144 CAGGGAAATCAGGAAGGAGAAGG + Intergenic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929033560 2:37671307-37671329 CTGGGAAACCAGCAGGGAGTCGG - Intronic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
929307214 2:40377162-40377184 CAGGTAACCCATTAAGAAGAGGG + Intronic
929441834 2:41971034-41971056 GAGGGAAGCCAGTGGGAAGTGGG + Intergenic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
929702839 2:44179547-44179569 TAGGAAAACTAATAGGAAGATGG - Intronic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
930586244 2:53270302-53270324 CAGGGAAGGCAGTATTAAGAGGG + Intergenic
930595421 2:53381645-53381667 CAGGGGTAGCTGTAGGAAGAAGG - Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931824380 2:65984462-65984484 AAGAGATACCAGTGGGAAGAGGG - Intergenic
932000137 2:67877499-67877521 GAGGGAAACAATTAGGGAGAGGG + Intergenic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
932636861 2:73397128-73397150 CAGGGAAACCAGTCTTATGAAGG - Intronic
933068310 2:77826993-77827015 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
933078234 2:77955473-77955495 CAGGGAAAGCAATACTAAGAAGG + Intergenic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933628861 2:84633713-84633735 AAGGGAAGCCAGCAGGAAGAAGG - Intronic
936460720 2:112712245-112712267 CAGGGATGCCAGAAGGAAGGGGG - Intergenic
937484726 2:122303194-122303216 CAGCTAAAACAGTAGTAAGAAGG + Intergenic
937792941 2:125981656-125981678 CAGGGAAACCATTTGGAAGATGG - Intergenic
938416453 2:131106750-131106772 CAGGGAGATCAGTACGAATAGGG - Intronic
939206450 2:139110651-139110673 CAGCAAAATCAGTAGTAAGAGGG - Intergenic
939244530 2:139606624-139606646 CAGCAAAAACAGTAGTAAGAGGG - Intergenic
939577545 2:143914585-143914607 CTTGGAAAGCAGTATGAAGATGG + Intergenic
941780134 2:169434833-169434855 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
941845945 2:170133251-170133273 CAGCAAAAGCAGTATGAAGAGGG + Intergenic
942320687 2:174733063-174733085 CATGGAACCCAGAGGGAAGACGG - Intergenic
942343212 2:174972151-174972173 CAAGGAAACCAGTAGCAGCAAGG - Intronic
943484465 2:188462076-188462098 CAGCAAAAGCAGTACGAAGAGGG - Intronic
943591636 2:189804848-189804870 CAAGGAAAGCATTGGGAAGAAGG - Intronic
943913397 2:193597054-193597076 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
944078931 2:195763201-195763223 CAGTGAAAACAGTAGTAAGGTGG + Intronic
944291452 2:198011261-198011283 CAGTGAAAGCAGTAGTAAAAGGG - Intronic
944389564 2:199203521-199203543 CAGGGAAAGCAGTTGGGAGTGGG - Intergenic
945713714 2:213331872-213331894 CAGTGAAAGCAGTACTAAGAGGG + Intronic
947209181 2:227691261-227691283 CAGTGAAAGCAGTATTAAGAGGG + Intronic
947447913 2:230178868-230178890 CAGGGGAAGCAGTTGCAAGAGGG + Intronic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
947996838 2:234534996-234535018 GAGTGAAACCAGAAGGGAGAGGG - Intergenic
1168978200 20:1983666-1983688 CAGGGAGGCCAGCAGGGAGAGGG - Intronic
1169949889 20:11032224-11032246 CTGGGAAACCAGTGGGATGGTGG + Intergenic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1171057896 20:21925567-21925589 CAGACAACCCATTAGGAAGATGG - Intergenic
1171240687 20:23565138-23565160 CAGGTCAAGCAGTGGGAAGACGG + Intronic
1172512516 20:35510271-35510293 AAGGGAAAGGAATAGGAAGAGGG + Intronic
1173203927 20:40976621-40976643 CAGTGAAAGCAGTACCAAGAGGG - Intergenic
1173339304 20:42139404-42139426 CAGGAATACCAGTAGGAAAGGGG + Intronic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1175294679 20:57900241-57900263 GAGGGAAACGAGTGGGAGGAAGG - Intergenic
1175764276 20:61582023-61582045 CAGGGCAGCCTGTGGGAAGAGGG + Intronic
1177873746 21:26605864-26605886 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1179608801 21:42535654-42535676 CAGGGAAGCCAGTGGCAAGCGGG - Intronic
1179927616 21:44545749-44545771 CAGTGAAAGCAGTATGTAGAGGG + Intronic
1180467175 22:15622382-15622404 CAGGGAAACCAATATGAAATGGG + Intergenic
1181684250 22:24517449-24517471 TAGGGACCCCAGTGGGAAGATGG - Intronic
1181717693 22:24745209-24745231 CAGCGAAAGCAGTAATAAGAGGG + Intronic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183422960 22:37723057-37723079 CAGTGAGACCTGTAGGAGGAGGG + Intronic
1183758749 22:39796205-39796227 CAGCAAAAGCAGTAGTAAGAGGG - Intronic
1184683338 22:46084852-46084874 CAGGGATGCCCGTGGGAAGAAGG + Intronic
1185112292 22:48906967-48906989 CAGGGATAGCACTAGGAATAGGG - Intergenic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
950190713 3:10974399-10974421 CAGGGAAAGCAGGAAGGAGAAGG - Intergenic
950992394 3:17453155-17453177 CAGCAAAAGCAGTAGTAAGAGGG + Intronic
951259634 3:20492182-20492204 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
951309223 3:21103652-21103674 CAGCTAAACCAGTATTAAGAGGG - Intergenic
952012731 3:28919389-28919411 AAGGGAACCCAGTTGGTAGATGG + Intergenic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
952633879 3:35503956-35503978 AAGGGAAACCAGTAGTATGCTGG + Intergenic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953496648 3:43393418-43393440 TAAGTAAACCAGTAAGAAGATGG - Intronic
953767748 3:45756948-45756970 CAGGGCAACAGGTGGGAAGAAGG + Exonic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954493159 3:50926850-50926872 CAGGGAGACCAGTTAGAAGGTGG - Intronic
954757846 3:52851508-52851530 CAGGAAAACCAGTGAAAAGAGGG + Intronic
954970484 3:54647614-54647636 AAGGGAAAGCAGAAGGAAGTTGG + Intronic
955625866 3:60918619-60918641 AAAGGAAACCAGGAGGAAGAAGG + Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956985491 3:74694515-74694537 TAGAGATACCAGTAGGAAGTAGG + Intergenic
957140731 3:76352331-76352353 GAGGAAAACCAGTAGGAACGAGG - Intronic
957535558 3:81498240-81498262 GTGGGAAAACAGTAGAAAGATGG + Intronic
958736258 3:98012590-98012612 CAAAAAAACCAGTAGGAATATGG + Intronic
958904729 3:99929220-99929242 CAGGGCCACCACTAGGGAGAAGG - Intronic
960732490 3:120742504-120742526 CAGGGAAGGCAGTGGCAAGATGG - Exonic
961324711 3:126103334-126103356 CTGGGAAACAGGTGGGAAGACGG - Intergenic
961516886 3:127443630-127443652 CAGGCACACCAGCAGGGAGAGGG + Intergenic
961749265 3:129085948-129085970 CAGGGAAGCCAGGAGGCAGGGGG - Intergenic
961756132 3:129128337-129128359 CAGGGAAGCCAGGAGGCAGGGGG + Intronic
961783484 3:129335389-129335411 CAGGGAACCCACTGGGAAGTTGG + Intergenic
962249223 3:133824948-133824970 CAGGAAAACCAGGATGGAGAAGG - Exonic
962405238 3:135094659-135094681 GAGGGAAAGCAGGAGGGAGAAGG - Intronic
962777432 3:138675626-138675648 CAGGGAAGCCAGAAGAAAGTGGG + Intronic
964556213 3:157941852-157941874 AAGGTAAGCCAATAGGAAGAAGG + Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965537720 3:169841268-169841290 CAGGGCTGCCAGGAGGAAGAAGG - Intronic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
966821636 3:183929495-183929517 CAGGTAAACCAAGAGAAAGAGGG - Intronic
967316836 3:188157780-188157802 CAGGGAAACCACTATAGAGAGGG + Intronic
967827820 3:193892886-193892908 GAGGGAACCCAGTAGAAAAATGG - Intergenic
968223972 3:196961025-196961047 CAGTCAAAGCAGCAGGAAGATGG - Intronic
968910237 4:3473729-3473751 CAGGGAACCGTGCAGGAAGATGG + Intronic
969158821 4:5237264-5237286 CAGGAAAAGCAGTAGGAATCTGG - Intronic
970049757 4:11900398-11900420 CAGGGAAAAAAATGGGAAGAAGG - Intergenic
970116595 4:12703392-12703414 CTGGGAAACTAATAGGGAGAAGG + Intergenic
970442828 4:16097705-16097727 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
970606205 4:17684363-17684385 TAGGGAACTCAGCAGGAAGAAGG + Intronic
971246397 4:24932768-24932790 CAGGGAAAACATTAGTCAGAGGG + Intronic
971430938 4:26566603-26566625 CAGGGAAGAATGTAGGAAGAAGG - Intergenic
971544852 4:27872463-27872485 AAGGGAAAGAAGTAGAAAGAAGG + Intergenic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
974290944 4:59929501-59929523 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
974333495 4:60509640-60509662 CAGTGAAAGCAGTAGTAAGTGGG + Intergenic
974469946 4:62305754-62305776 CAGGGAAAGCAGTACTAAGAGGG + Intergenic
974678896 4:65136211-65136233 CAGGAAAAGCAGTACTAAGAAGG + Intergenic
975630070 4:76391519-76391541 CAGTGAAAGCAGTACAAAGAGGG + Intronic
975662327 4:76700015-76700037 CAGGGAACCCATCAGGAAGCTGG + Intronic
976356267 4:84121025-84121047 CAGGGAGACCACAAGGTAGAAGG + Intergenic
976653062 4:87456566-87456588 CAGCCATACCAGTATGAAGAGGG - Intronic
977474685 4:97490589-97490611 CAGTGAAACCAGGAGGTACAGGG - Intronic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
977790438 4:101094067-101094089 TAGGAAAACGAGTAGGAAGAAGG - Intronic
977873309 4:102119911-102119933 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
978252273 4:106646488-106646510 CAGGAAAAGCAGTACTAAGAGGG - Intergenic
978729859 4:112013096-112013118 CTGGGACACCTGTAGGAAGAAGG + Intergenic
979508229 4:121522318-121522340 CAGGTAAACTAGTATGAACAGGG - Intergenic
979727580 4:123982731-123982753 CAGGGACCCCAGTACCAAGAGGG - Intergenic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
981285649 4:143016094-143016116 CAATAAAACCAGTAGTAAGAGGG - Intergenic
982063822 4:151632818-151632840 CAGTGAAAGCAGTACTAAGAGGG + Intronic
983697026 4:170545120-170545142 TAGGGAAGCCATGAGGAAGAGGG + Intergenic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984915252 4:184717866-184717888 CAGGAAAACAAGTGTGAAGAAGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986044320 5:4022800-4022822 CAGGGAGTCCAGCAGGGAGAAGG - Intergenic
987052696 5:14161340-14161362 AAGGGAAACCAGGAAGAAGAGGG - Intronic
987207392 5:15641443-15641465 CAGGGAAACCAAGAGGAATGGGG + Intronic
987595858 5:19998263-19998285 TAGAGAAACAAGTATGAAGACGG + Intronic
987751715 5:22047741-22047763 AATGGAAACCAGTAGGAAGTTGG - Intronic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988674830 5:33421635-33421657 CAGGGAAAGCAGAACAAAGATGG + Intergenic
989948646 5:50270857-50270879 CAGGGAAATCAGGCAGAAGAAGG + Intergenic
990025926 5:51188653-51188675 CAAGGAAATCAGTGGAAAGAGGG - Intergenic
990766101 5:59184679-59184701 CAGGGAAAGCATTTGAAAGATGG - Intronic
991544703 5:67768693-67768715 CAGAGAAACAAGTAGGCAGATGG + Intergenic
992047726 5:72912623-72912645 CAGGTAAACCTGTAGGCAAAAGG - Exonic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
993025245 5:82637922-82637944 CTAGGAAACCAGTAGCAAGAAGG + Intergenic
993329421 5:86579457-86579479 CTAGGAGACCAGTAGGAAGGGGG - Intergenic
993431277 5:87834670-87834692 AAGGGAAACCTGAAAGAAGAGGG + Intergenic
995276198 5:110280647-110280669 CAGGGAAATCAGGCAGAAGAAGG - Intergenic
995315014 5:110759814-110759836 CAGGGTCAGAAGTAGGAAGATGG + Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995511816 5:112918241-112918263 AAGAACAACCAGTAGGAAGAGGG + Intronic
996166005 5:120224866-120224888 CAGTGAAAGCAGTACTAAGATGG - Intergenic
996760854 5:126984461-126984483 TAGGGGAACCAGTAGGAAACAGG + Intronic
997104387 5:131002280-131002302 CAGGGAAACCACTGGGCTGATGG + Intergenic
997901258 5:137767327-137767349 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
998634343 5:143936082-143936104 CAGAGAAAGCAGTACTAAGAGGG + Intergenic
999849311 5:155521259-155521281 CAGTGAAAGCAGTACTAAGATGG - Intergenic
1000871907 5:166587769-166587791 CAGTCAAACAAGTAAGAAGAGGG + Intergenic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1002224045 5:177705340-177705362 TGGTGAAACCAGAAGGAAGAGGG - Intergenic
1003380954 6:5624342-5624364 CAGGGCAACAAGGAGGAACAAGG - Intronic
1004292673 6:14382729-14382751 CAGGCAACCCAGTGAGAAGAGGG - Intergenic
1005943061 6:30575536-30575558 CAGGGAAACAAGGATGGAGAGGG + Intronic
1006163455 6:32050849-32050871 CAGGGAAGCCAATAGGCAGTTGG - Intronic
1006164075 6:32054238-32054260 CAGGGAGGCCAGTAGGCAGTTGG - Intronic
1006630455 6:35426839-35426861 CTGGCAAACCAGTGTGAAGATGG - Exonic
1007727058 6:43922931-43922953 CAGGGCAACCAGCTGGGAGATGG + Intergenic
1008858310 6:56117924-56117946 CAGCAAAAACAGTAGTAAGATGG + Intronic
1009242053 6:61195815-61195837 CAGCTAAACCAGCAGCAAGAGGG - Intergenic
1009352876 6:62704630-62704652 CAGTGAAGGCAGTAGCAAGATGG - Intergenic
1009673626 6:66788347-66788369 CATGGAATCCAGTAGCAACAGGG - Intergenic
1009847071 6:69147293-69147315 CAGTGAAATCAGTACTAAGAGGG - Intronic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010276691 6:73976174-73976196 CAGCTAAAGCAGTATGAAGAGGG - Intergenic
1010758686 6:79697504-79697526 CTGGCATACCTGTAGGAAGAAGG + Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012571908 6:100740083-100740105 CAGTGAAAGCAGTATTAAGAGGG - Intronic
1013930002 6:115519081-115519103 CAGTTAAGGCAGTAGGAAGAGGG + Intergenic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1015587650 6:134792196-134792218 CAGCTAAAGCAGTAGTAAGAGGG + Intergenic
1016130189 6:140458473-140458495 AAGGGAAACCAGTAAGAAATGGG - Intergenic
1016327048 6:142914761-142914783 AAGGGAAACCAGCAAGAACATGG + Intronic
1016358368 6:143242103-143242125 GAGGAAAAGCAGTAGGGAGAAGG + Intronic
1017057913 6:150454458-150454480 CTGGAAAACCAGCAGGGAGAGGG + Intergenic
1017242988 6:152191894-152191916 CAGTGAAAGCAGTACTAAGATGG - Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018889077 6:167968760-167968782 CACCGAAGCCAGTAGGAACAGGG + Intronic
1019789848 7:3004114-3004136 CATGGTAACCAGCAGGAAGCTGG - Intronic
1019826028 7:3285114-3285136 GAGGGAAGGCAGCAGGAAGAGGG - Intergenic
1019943242 7:4307710-4307732 CAGGCAAATCAGTGGCAAGAAGG + Intergenic
1020499314 7:8895939-8895961 CAGGAAAACAAGTATGGAGAGGG - Intergenic
1020678448 7:11207485-11207507 CAGGAAAACAAACAGGAAGAAGG + Intergenic
1020940833 7:14535025-14535047 CAGCAAAAGCAGTATGAAGAGGG + Intronic
1020963012 7:14829471-14829493 CAGGGAAACTAGAAGGGAGGAGG + Intronic
1021175424 7:17444376-17444398 CAGGAAAACCTTCAGGAAGATGG - Intergenic
1021771995 7:24013284-24013306 CAGGAAAAGCAGTACTAAGAGGG + Intergenic
1022366678 7:29727549-29727571 CAGCGAAAGCAGTATTAAGAGGG - Intergenic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1023241241 7:38150109-38150131 CAGCGAAAGCAGTACTAAGAGGG + Intergenic
1023609197 7:41956985-41957007 AAGGGAAACCAGGAGCAAGAGGG + Intergenic
1023832875 7:44050304-44050326 CAGGGACACCAGGAGGTAGGAGG + Intronic
1024331504 7:48159988-48160010 CAGGAAGGCCAGCAGGAAGAAGG - Intergenic
1024681412 7:51693423-51693445 TGGGGAAACCAGGAGGAAGTGGG + Intergenic
1024860775 7:53837296-53837318 CAGTGAAAACAGCAGTAAGAGGG + Intergenic
1026052090 7:66955463-66955485 CAGGGAAACCAGTCAAAAAAGGG - Intronic
1028266250 7:88729930-88729952 CAGTAAAAGCAGTAGTAAGAGGG - Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029042375 7:97590647-97590669 CAGCAAAACCAGTACTAAGAGGG - Intergenic
1029366452 7:100119573-100119595 CAGGGAAACCCGTAGCAACGAGG + Intronic
1029825602 7:103189994-103190016 CAGCGAAAGCAGTATTAAGAGGG + Intergenic
1029937748 7:104445348-104445370 CAAGGATACAAGTAGTAAGAAGG - Intronic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1030880992 7:114879487-114879509 CAGGGAAAACAGTACTAAGAGGG - Intergenic
1033015964 7:137672054-137672076 CAGGGAACAGAGTAGGTAGATGG - Intronic
1034151956 7:148924059-148924081 CATGGTAACCTATAGGAAGAAGG - Intergenic
1034328708 7:150263086-150263108 TAGAGAAAACAGTAGGAAGTCGG + Intronic
1034764508 7:153706299-153706321 TAGAGAAAACAGTAGGAAGTCGG - Intergenic
1034914272 7:155023929-155023951 GAGGGACACCAGTAGGACAAAGG - Intergenic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1038012561 8:23486611-23486633 GAAGGAAACCAGTAGGAATGAGG - Intergenic
1039065644 8:33605232-33605254 CAGGTAAATCAGTAGGAAAATGG - Intergenic
1039407544 8:37326286-37326308 GAGGGAAGCCAGTGGGAGGAAGG - Intergenic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042678523 8:71351226-71351248 GAGGGAAAACAGTTGAAAGACGG + Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1042975326 8:74462717-74462739 CACAGAAACCACTAAGAAGAGGG + Intronic
1043015630 8:74937152-74937174 CAGTGAAAACAGTAATAAGAGGG - Intergenic
1043284414 8:78511887-78511909 TAGGGAAACCAGAAAGAAAAGGG - Intergenic
1043682852 8:83052552-83052574 CAGGGAGACCAACAGGAAGTAGG - Intergenic
1045146128 8:99346714-99346736 CAAGGATATCAGTAGGCAGAGGG - Intronic
1045673892 8:104588327-104588349 CAGGGAATCGAGTAGGACAAGGG + Intronic
1046190219 8:110785389-110785411 CTGGAAAACAAGTAGGAAAATGG - Intergenic
1046250460 8:111624234-111624256 TGGGGAAGCCAGAAGGAAGATGG + Intergenic
1046695639 8:117336249-117336271 CAGGGAAGGCAGCAAGAAGAAGG - Intergenic
1046940933 8:119930829-119930851 CAGGGCAACCATTAGAAAAAGGG + Intronic
1048439710 8:134450859-134450881 CAAGTAAACAAGTAGGAAGAAGG - Intergenic
1048852811 8:138660451-138660473 CAGGAAATCCAGGAGAAAGAGGG - Exonic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049701173 8:144013510-144013532 CAGGGAACCCAGTGGGTAGGGGG - Intronic
1049777004 8:144411034-144411056 CAGGGCAACAAGTGGGGAGAAGG - Intronic
1050248466 9:3717029-3717051 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1051907038 9:22107117-22107139 CAGGGAGATCAGTTAGAAGATGG + Intergenic
1052183308 9:25558516-25558538 CAGGCAAACCAGTATGGACAAGG + Intergenic
1054854499 9:69884040-69884062 CAGTGAAAGCAGTACTAAGAGGG - Intronic
1054954157 9:70888941-70888963 CAAGGACACCAGTATGGAGAAGG + Intronic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1058768096 9:108202085-108202107 CAGCAAAACCAGTACGAAGAGGG + Intergenic
1058976933 9:110133633-110133655 GTGGGAAATCAGTAGGAAGCTGG - Intronic
1059333964 9:113556929-113556951 CATGGACAGGAGTAGGAAGAGGG - Intronic
1059937486 9:119325638-119325660 CAAGACGACCAGTAGGAAGATGG - Intronic
1060414757 9:123422331-123422353 CTAGGAAACCTGTAGGTAGAGGG - Intronic
1060799424 9:126534318-126534340 CAGTGACAGAAGTAGGAAGAAGG + Intergenic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061895613 9:133645705-133645727 AAAGGAAACAAGTAGGGAGATGG + Intronic
1062534107 9:137014080-137014102 GAGGGCAGCCAGTAGGGAGAGGG - Intronic
1186101663 X:6163925-6163947 CAAGGAAACCAGAAGGAACCAGG + Intronic
1186490822 X:9970602-9970624 CAGAGATTCCTGTAGGAAGAAGG - Intergenic
1186601842 X:11046936-11046958 GAGCAAAACCAGTAGTAAGAGGG - Intergenic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187594145 X:20752973-20752995 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1188915654 X:35906815-35906837 CAGGGAAAGCAGTACTAAGAGGG - Intergenic
1188993289 X:36850959-36850981 AAGGGAAATTAGTAGGTAGATGG - Intergenic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1189885189 X:45536229-45536251 CAGCAAAACCAGTACTAAGATGG + Intergenic
1190596601 X:52058465-52058487 CAGGGAAAGCAGTGTTAAGAGGG - Intergenic
1190612223 X:52195608-52195630 CAGGGAAAGCAGTGTTAAGAGGG + Intergenic
1190762445 X:53447854-53447876 AAGGGAATGCAGGAGGAAGAGGG - Intergenic
1191050912 X:56190808-56190830 CAGCAAAACCAGTATGAAGAAGG + Intergenic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1192417489 X:70995672-70995694 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1192463431 X:71337535-71337557 CAGTGAAAGCAGTGGGAACAGGG - Intergenic
1192845866 X:74906642-74906664 CCTGGAAACCAGTAGGAATTTGG - Intronic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1192959777 X:76115804-76115826 CAGTGAAAGCAGTACAAAGAGGG + Intergenic
1193192593 X:78589696-78589718 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1193650642 X:84126837-84126859 CAGTGAAAGCAGTACTAAGATGG + Intronic
1193673819 X:84422365-84422387 CAGGAAAAGCAGTATTAAGAGGG + Intronic
1193781414 X:85706726-85706748 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1193877600 X:86880743-86880765 CAGGAAAAGCAGTACTAAGAAGG - Intergenic
1194431751 X:93816262-93816284 CAGGGAAAGCAGTACTAAGAGGG + Intergenic
1194839536 X:98723770-98723792 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1194892294 X:99394957-99394979 CAGTGAAAGCAGCAGTAAGAGGG - Intergenic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1195251051 X:103048035-103048057 CAGTGAAAGCAGTATTAAGAGGG - Intergenic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1195592419 X:106645402-106645424 CAGCAAAAGCAGTAGTAAGAGGG - Intronic
1195662643 X:107395998-107396020 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196233203 X:113249664-113249686 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1196815912 X:119665511-119665533 TAGGGAAACCAGTAGGGGAAAGG + Intronic
1196989048 X:121307521-121307543 CATGGAAACCAGTTAGAGGAAGG + Intergenic
1197290372 X:124649037-124649059 GAGGGACTCCAGGAGGAAGATGG + Intronic
1197360833 X:125501473-125501495 CAGCAAAAGCAGTAGCAAGAGGG - Intergenic
1197413800 X:126150551-126150573 GAGGGAAACCCCTAGGAGGAGGG - Intergenic
1197623257 X:128775772-128775794 CAGTGAAATCAGTACTAAGAGGG - Intergenic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1197816878 X:130506847-130506869 CAGGAAAACAGGTAGGCAGATGG - Intergenic
1197926113 X:131648072-131648094 TAGAGAGACCACTAGGAAGAGGG - Intergenic
1198483650 X:137064862-137064884 AAGGTTAAGCAGTAGGAAGAGGG - Intergenic
1198696930 X:139351654-139351676 CAGCGAAAGCAGTACTAAGAGGG - Intergenic
1198795610 X:140391042-140391064 CAGGCAACCCCGCAGGAAGAAGG - Intergenic
1199327586 X:146517646-146517668 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1199459200 X:148064738-148064760 CAGTGAAAGCAGTACTAAGAAGG - Intergenic
1199485423 X:148341995-148342017 CAGGAAAACCAGTACTAAGAGGG + Intergenic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic
1201298708 Y:12487793-12487815 CAGAGAAGCCAGTGGGAAAATGG + Intergenic