ID: 1042885956

View in Genome Browser
Species Human (GRCh38)
Location 8:73552055-73552077
Sequence GGTTGTACTGGAGAACAAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042885951_1042885956 -9 Left 1042885951 8:73552041-73552063 CCAGTTGTTTTGAAGGTTGTACT 0: 2
1: 0
2: 0
3: 15
4: 170
Right 1042885956 8:73552055-73552077 GGTTGTACTGGAGAACAAGGGGG 0: 2
1: 0
2: 1
3: 15
4: 148
1042885948_1042885956 13 Left 1042885948 8:73552019-73552041 CCTTGAATCCTTGCTAAATATTC 0: 2
1: 0
2: 1
3: 11
4: 208
Right 1042885956 8:73552055-73552077 GGTTGTACTGGAGAACAAGGGGG 0: 2
1: 0
2: 1
3: 15
4: 148
1042885947_1042885956 21 Left 1042885947 8:73552011-73552033 CCTGAAAGCCTTGAATCCTTGCT 0: 2
1: 0
2: 0
3: 19
4: 152
Right 1042885956 8:73552055-73552077 GGTTGTACTGGAGAACAAGGGGG 0: 2
1: 0
2: 1
3: 15
4: 148
1042885949_1042885956 5 Left 1042885949 8:73552027-73552049 CCTTGCTAAATATTCCAGTTGTT 0: 2
1: 0
2: 3
3: 20
4: 240
Right 1042885956 8:73552055-73552077 GGTTGTACTGGAGAACAAGGGGG 0: 2
1: 0
2: 1
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042885956 Original CRISPR GGTTGTACTGGAGAACAAGG GGG Exonic
902800406 1:18826128-18826150 GGTTGCACTGGAGAACAAAGAGG + Intergenic
906186976 1:43869738-43869760 GTTTATATTGGAGAACAAAGAGG - Intronic
908248300 1:62245169-62245191 GGTTGTCCTGGGGGAGAAGGAGG - Intronic
909675647 1:78236520-78236542 GGTTGTACTGAAGAAAAATCTGG + Intergenic
909796979 1:79752568-79752590 AGTTGTACTGAAGAACACTGAGG + Intergenic
909931452 1:81503692-81503714 GATTGTCCTGGAGAACTGGGTGG + Intronic
910819254 1:91328530-91328552 GGATGTGCTGCAGAACGAGGAGG + Intronic
912972697 1:114298961-114298983 GGTTGGAGTGGAGGTCAAGGAGG - Intergenic
916806313 1:168264906-168264928 GGTGGTACTGCAGAACTGGGTGG - Intergenic
923602927 1:235419519-235419541 AGTTGTGCTGGTGAAAAAGGAGG + Exonic
1062861408 10:813140-813162 GGTTGCAATGGGGAAGAAGGAGG + Exonic
1066332729 10:34442487-34442509 GGTTGTCCTGGCGCACAAGGAGG + Intronic
1067582530 10:47454531-47454553 GGTTGTGCTAAAGATCAAGGGGG + Intergenic
1069219164 10:65861720-65861742 GGTTGTACTTGAAAGCTAGGAGG - Intergenic
1069566071 10:69464351-69464373 GGTTGTGCTGAAAACCAAGGGGG + Intronic
1069659865 10:70116567-70116589 GAGGGTACTGGAGAGCAAGGAGG + Intronic
1071376422 10:85009800-85009822 GGTTGGACTGGAGAACACAGAGG - Intergenic
1074837176 10:117307642-117307664 GATTGTACTAGAGAAATAGGTGG - Intronic
1074945115 10:118274139-118274161 GGGTGTAATATAGAACAAGGTGG + Intergenic
1077048276 11:555592-555614 GGGCGTACTGGAGGACCAGGGGG + Intronic
1079870988 11:25797645-25797667 GATTGTAGTTGAGGACAAGGGGG - Intergenic
1084736581 11:71109205-71109227 GGTCCTACTGGAGAACCAAGAGG - Intronic
1085131260 11:74040816-74040838 TGTTGTCCTGGAGAATAAGGAGG + Intronic
1086630839 11:89017928-89017950 GGAGGTACTGGAGAAAGAGGTGG - Intronic
1089127375 11:116186214-116186236 GGTTGTCCTGGCGCACAAGGAGG + Intergenic
1089129985 11:116204055-116204077 GGTTGTACTTGGGAAATAGGTGG - Intergenic
1089249294 11:117145692-117145714 GGTTATTCTGAAGAAGAAGGCGG - Intronic
1089348309 11:117806066-117806088 GGATGGAGTGGTGAACAAGGTGG - Intronic
1089908920 11:122075792-122075814 GGTTGCACTGAAGAAGAAGGCGG + Intergenic
1090477697 11:127038373-127038395 GGTTGTTGTGGAGATCAAGTAGG + Intergenic
1093726272 12:22513346-22513368 GGTAGTGCTGGAAAAGAAGGGGG - Exonic
1094618896 12:32061228-32061250 GTTTGTACTGTAGAAAAAGTGGG + Intergenic
1096193424 12:49634226-49634248 GGCTGCCCTGGGGAACAAGGAGG + Intronic
1096872240 12:54600452-54600474 AGTGGCAGTGGAGAACAAGGAGG + Intergenic
1103879163 12:124152752-124152774 TGTTGTTCTGGAGAAAAATGTGG - Intronic
1107071647 13:36276624-36276646 GGGTGTAGTGGAGGACAAGGGGG + Intronic
1109476734 13:62888049-62888071 TGTTGGGCTGAAGAACAAGGAGG - Intergenic
1111507508 13:89213148-89213170 AGTTGTCCTGGCGCACAAGGAGG - Intergenic
1111604448 13:90519762-90519784 GGTTGTACTGGGGTTCAAGGTGG - Intergenic
1113699168 13:112371012-112371034 GGGTGTACAGGAGAATGAGGAGG + Intergenic
1118723559 14:68610501-68610523 GGTTGTACGGGAGGACAGGGAGG - Intronic
1119417181 14:74479795-74479817 GGTCTTACTGGACAAAAAGGAGG + Intronic
1119629844 14:76219734-76219756 GGTTTTACTGGGGAAAGAGGAGG + Intronic
1124070563 15:26388952-26388974 GGGTCTACTTAAGAACAAGGTGG - Intergenic
1129139593 15:73585253-73585275 GGTTGTACTTGAGAACAGAGAGG - Intronic
1129295115 15:74595997-74596019 GATTGTCCTGGAGAACTGGGTGG + Exonic
1130044343 15:80431964-80431986 GCTTGTCCTGGAGGAAAAGGAGG - Intronic
1130645375 15:85721124-85721146 GGTTGTACACAAGTACAAGGAGG - Intronic
1133383322 16:5348990-5349012 AGTTGTTCTGGAAAACAAGATGG - Intergenic
1138244630 16:55458314-55458336 GGTTGTATTGGAGGACGAGATGG + Intronic
1139474269 16:67194745-67194767 GGTTCTGCTGGTGAACAAGGAGG + Exonic
1140252024 16:73302613-73302635 AGTTGGCCTGGAGAAAAAGGAGG + Intergenic
1141960153 16:87400773-87400795 GGTTGTTCTGGTGCATAAGGAGG - Intronic
1147867593 17:43563448-43563470 GGTTTTCCTGGAGGGCAAGGGGG + Intronic
1148614890 17:48994819-48994841 TGTTATATTGGGGAACAAGGAGG - Intergenic
1151581021 17:74978935-74978957 GGGTGTTCAAGAGAACAAGGGGG + Intergenic
1153657603 18:7298123-7298145 AGTTTTACTAGAGAAAAAGGAGG - Intergenic
1156107671 18:33685320-33685342 GTGACTACTGGAGAACAAGGTGG - Intronic
1157276266 18:46313101-46313123 TGTTATCCTGGAGAGCAAGGTGG + Intergenic
1157284627 18:46369311-46369333 GGATTTACTGGAGAAGCAGGGGG + Intronic
1159842755 18:73418137-73418159 AGTTATACAGGAGAACAAGATGG + Intergenic
1160478445 18:79216146-79216168 AGTTGAACTGAAGAAAAAGGTGG - Intronic
1162338210 19:10074665-10074687 TGTTGTCCTGGTGCACAAGGAGG + Intergenic
1163805551 19:19394860-19394882 GGTGGGGCTGGAGAGCAAGGCGG + Intronic
1165365061 19:35360159-35360181 GGCTGCTCTGGAGAACAATGAGG + Exonic
1165366880 19:35372628-35372650 GGCTGCTCTGGAGAACAATGAGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1167541467 19:50090766-50090788 GGTTGTCCTGGCGCACAAGCTGG - Intergenic
1167628621 19:50608737-50608759 GGTTGTCCTGGCGCACAAGCTGG + Intergenic
1167949165 19:53012623-53012645 GGTTGTCCTGGGTCACAAGGAGG - Intergenic
929660607 2:43780497-43780519 GGTGGCACTGGGGAGCAAGGAGG + Intronic
929746659 2:44666536-44666558 AGTTGGACTGGAGAACGTGGTGG - Intronic
929923249 2:46188621-46188643 GTTTGTGCTGGAGAAAGAGGAGG - Intergenic
931046349 2:58358176-58358198 GGTTATACGGGAGAGAAAGGAGG - Intergenic
932047757 2:68366623-68366645 GTTGGTACTGGAGAATAAGTGGG + Intronic
936740016 2:115493837-115493859 GGCTGTTATGGAGAACAAGGTGG + Intronic
938115627 2:128601487-128601509 GGCAGTACTGCAGACCAAGGAGG + Intergenic
939610355 2:144302336-144302358 GATTACACTGGAGAACAAGTGGG + Intronic
940801553 2:158138257-158138279 GATTCTACTGGGGAAGAAGGAGG - Intergenic
946359785 2:219212360-219212382 GGTTGCTCTGGAGAAGACGGTGG - Intronic
947335650 2:229080058-229080080 GGGTGGACTGGAGAACAGGGAGG - Intronic
948678784 2:239616710-239616732 CGTTCTACTGGAGAGAAAGGGGG - Intergenic
1172810729 20:37646090-37646112 GGTGGTCTTGGAGCACAAGGGGG + Intergenic
1173884452 20:46445319-46445341 GCTGGTACTGGGGAACAAAGTGG + Intergenic
1173968902 20:47135408-47135430 TGTTGTACAGGTGAAGAAGGTGG - Intronic
1174619806 20:51865341-51865363 GGTTGTACTTGAGAATCAGCAGG + Intergenic
1175889578 20:62310323-62310345 GGTTGTGATGGAGAAGAAAGGGG + Intronic
1177958212 21:27627586-27627608 AGTTGTAGTGGAAAACAAAGTGG - Intergenic
1179647764 21:42785597-42785619 GATTGTGCTGGGGGACAAGGGGG + Intergenic
1180075262 21:45458696-45458718 GCTTGCAGTGGAGGACAAGGTGG - Intronic
1182775960 22:32831111-32831133 GGTTGAAGTTGAGATCAAGGTGG + Intronic
1185388054 22:50545557-50545579 GTTTGTACTGGGGCACAGGGAGG - Intergenic
949788952 3:7771939-7771961 GGTTGGGCTGGAGAGCAGGGGGG - Intergenic
949928154 3:9058182-9058204 TGATGTACTGGAGCACATGGGGG + Intronic
952480606 3:33757428-33757450 AGTTGGATTGGAGAACAAGATGG - Intergenic
953191403 3:40691189-40691211 AGTTCATCTGGAGAACAAGGGGG - Intergenic
954956662 3:54527223-54527245 GGTTGTAGTGGAAAACAATTGGG - Intronic
954999330 3:54912475-54912497 GGTGTGACTGAAGAACAAGGAGG - Intronic
957941126 3:87005350-87005372 GGATATAATGGAGAAAAAGGTGG + Intergenic
960265515 3:115616601-115616623 GGTTGTCATGGAGAAGGAGGAGG + Intergenic
960556388 3:119034942-119034964 GGTTGCCCTGGAGACCAAGCGGG - Intronic
960714889 3:120565081-120565103 TGTTGTAGTTGAGAACACGGGGG + Intergenic
961820930 3:129575338-129575360 GTGTGTGCTGGAGAACAATGGGG + Intronic
965729252 3:171753414-171753436 GGCTGCACTGGAAAGCAAGGTGG - Intronic
966007749 3:175037195-175037217 TGTTGTCCTGGAGGACAAGTGGG - Intronic
966547874 3:181171272-181171294 GGTTTGACTGAGGAACAAGGAGG + Intergenic
967126853 3:186431791-186431813 TGTTGTAGTGGGGAAAAAGGTGG + Intergenic
968441520 4:626811-626833 GGCGGGACTGGAGAACAAGAGGG + Intronic
970023498 4:11595398-11595420 CTTTGTTCTGGAGAACAGGGAGG - Intergenic
970682239 4:18523400-18523422 TGTTGTACCGGAAAAGAAGGTGG - Intergenic
971126286 4:23758862-23758884 GGTTGTATTAGAGCACCAGGGGG - Intronic
976849734 4:89531209-89531231 AGCTGTAATAGAGAACAAGGAGG + Intergenic
980708673 4:136535041-136535063 GATTTTACTGGAGAACAATTAGG + Intergenic
983067815 4:163231781-163231803 GTTCCTACTGTAGAACAAGGAGG + Intergenic
983273199 4:165587541-165587563 GGCTGAATAGGAGAACAAGGGGG - Intergenic
983445243 4:167842310-167842332 AATTGTTCTGGAGAACAAGAGGG + Intergenic
984317235 4:178142464-178142486 GGTGGTACTGCAGAACCAGATGG + Intergenic
984820761 4:183879820-183879842 GGGTGTACTTGAGAAGAACGTGG + Intronic
985930377 5:3052352-3052374 AGCTGTCCTGGAGAACAAGCTGG + Intergenic
986305329 5:6509917-6509939 GGGTGTCCTGGAGAAACAGGAGG + Intergenic
986535020 5:8777832-8777854 TGTTTTCCTGGAGAACAAGTTGG + Intergenic
986703547 5:10435319-10435341 GGTTGTCCTGGCACACAAGGAGG + Exonic
986741816 5:10711385-10711407 GGTGGGACTGGAGACAAAGGTGG + Intronic
987393498 5:17398897-17398919 TGATGGACTGGAGAACAAAGAGG + Intergenic
992149967 5:73893195-73893217 AGTTGTCCTGAAGAAAAAGGGGG + Exonic
992741230 5:79775277-79775299 GGTTTTACTGTACAACTAGGAGG - Intronic
993018567 5:82563971-82563993 GGTTGTACTGGAGTCCCAGGTGG - Intergenic
993371336 5:87096536-87096558 GGTTGTTTGGGAGAATAAGGAGG - Intergenic
1003592302 6:7446271-7446293 TGGTGTCCTGGAGAACAAGTTGG + Intergenic
1005987991 6:30885940-30885962 GGTTGTAATGGAGTGGAAGGGGG + Intronic
1007704116 6:43780840-43780862 GGTTGTACTGGGGGCCAGGGAGG - Exonic
1007723036 6:43897148-43897170 GGTTGTGATGGAGAAGAAGCAGG - Intergenic
1007942870 6:45798617-45798639 GGTTTTACTGGAAATCAAGAGGG + Intergenic
1007998958 6:46338625-46338647 GGTGGTACTGAATAAGAAGGTGG - Intronic
1010639305 6:78303649-78303671 AGTTGTCCTGGAGCATAAGGAGG + Intergenic
1011413028 6:87085581-87085603 GATTGTACTGTAGGATAAGGAGG + Exonic
1014175592 6:118327763-118327785 GGTGAGGCTGGAGAACAAGGTGG - Intergenic
1015711401 6:136145367-136145389 TGTTATACTAGAGAATAAGGGGG - Intronic
1016271369 6:142293962-142293984 TGATGTTCTGGAGAAGAAGGAGG - Intergenic
1017862391 6:158411067-158411089 GGTTGTCCTGGCGTACAAGGAGG + Intronic
1018326496 6:162675373-162675395 GGTAGCTCTGGAAAACAAGGAGG + Intronic
1022496733 7:30857753-30857775 GGCTGTACTTGTTAACAAGGTGG - Intronic
1023725895 7:43142421-43142443 GGTAGCACTGGAGACCAAGCTGG + Intronic
1024026623 7:45414630-45414652 GGTTGCACAGGACAAGAAGGAGG + Intergenic
1028690271 7:93642684-93642706 CTTTGAACTGGAGAAAAAGGTGG - Intronic
1031762365 7:125729850-125729872 GGATGTACTAGAGAACAGAGAGG - Intergenic
1034333903 7:150308138-150308160 GGTTGTACTTGCCACCAAGGTGG - Intronic
1036645179 8:10608133-10608155 GGTTGAAGTGGAGACCCAGGAGG - Exonic
1042885956 8:73552055-73552077 GGTTGTACTGGAGAACAAGGGGG + Exonic
1043079265 8:75745309-75745331 GGTTGGACCAGAGAACATGGAGG - Intergenic
1045349584 8:101326083-101326105 TGTTGTATTGGTGAATAAGGTGG - Intergenic
1048204649 8:132405578-132405600 GGCTGTGCTGGGGAACAAGGTGG + Intronic
1052071950 9:24092640-24092662 GAATGTTCTGGAAAACAAGGTGG - Intergenic
1052677628 9:31647456-31647478 GGTTGTACTGAAAGACAAAGAGG + Intergenic
1056605762 9:88083492-88083514 GAGTGTTCTGGGGAACAAGGGGG + Intergenic
1059667552 9:116463137-116463159 AGTTGCAATGGAGAAAAAGGCGG - Intronic
1059882930 9:118711918-118711940 GGTTGATCTGGAGAAGAAGATGG + Intergenic
1060840003 9:126785605-126785627 GGGTGAAGTGGAGAACCAGGAGG + Intergenic
1061619616 9:131803395-131803417 AGTTGTTCTTGAGATCAAGGTGG + Intergenic
1062460429 9:136660497-136660519 GGTTGCAGTGAAGAACAAGTTGG + Intronic
1062460635 9:136661268-136661290 GGTTGCAGTGAAGAACAAGTTGG - Intronic
1185644660 X:1608475-1608497 GGCTGTGCAGGAGAGCAAGGCGG - Intergenic
1188442467 X:30226176-30226198 GGTTGTATTCCAGAAGAAGGTGG + Intergenic
1194127572 X:90039261-90039283 GGTTGTACTGGAGAACAAGGGGG + Intergenic
1195467033 X:105190888-105190910 GGTTGTACTGAAGAGGAAGTAGG + Intronic
1199790852 X:151153737-151153759 ATTTCTACTGGAGAACAGGGCGG + Intergenic