ID: 1042886171

View in Genome Browser
Species Human (GRCh38)
Location 8:73554478-73554500
Sequence CCTTCTAGGCAGAAAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042886162_1042886171 21 Left 1042886162 8:73554434-73554456 CCCCAGAAAAGCTAAGGCATTGG 0: 1
1: 0
2: 5
3: 32
4: 185
Right 1042886171 8:73554478-73554500 CCTTCTAGGCAGAAAGAAGCTGG No data
1042886164_1042886171 20 Left 1042886164 8:73554435-73554457 CCCAGAAAAGCTAAGGCATTGGA 0: 1
1: 0
2: 1
3: 39
4: 272
Right 1042886171 8:73554478-73554500 CCTTCTAGGCAGAAAGAAGCTGG No data
1042886165_1042886171 19 Left 1042886165 8:73554436-73554458 CCAGAAAAGCTAAGGCATTGGAT 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1042886171 8:73554478-73554500 CCTTCTAGGCAGAAAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042886171 Original CRISPR CCTTCTAGGCAGAAAGAAGC TGG Intronic
No off target data available for this crispr