ID: 1042889413

View in Genome Browser
Species Human (GRCh38)
Location 8:73590663-73590685
Sequence GTGTGCTTGGTAAGGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042889413_1042889420 30 Left 1042889413 8:73590663-73590685 CCTGGACACCTTACCAAGCACAC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 1042889420 8:73590716-73590738 GTGTGGCTTCCCCCTGAAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 119
1042889413_1042889416 2 Left 1042889413 8:73590663-73590685 CCTGGACACCTTACCAAGCACAC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 1042889416 8:73590688-73590710 AGCTTGTGTAAGACATCATCTGG 0: 1
1: 0
2: 1
3: 3
4: 101
1042889413_1042889419 13 Left 1042889413 8:73590663-73590685 CCTGGACACCTTACCAAGCACAC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 1042889419 8:73590699-73590721 GACATCATCTGGGAGGTGTGTGG 0: 1
1: 0
2: 6
3: 44
4: 287
1042889413_1042889417 3 Left 1042889413 8:73590663-73590685 CCTGGACACCTTACCAAGCACAC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 1042889417 8:73590689-73590711 GCTTGTGTAAGACATCATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 96
1042889413_1042889418 6 Left 1042889413 8:73590663-73590685 CCTGGACACCTTACCAAGCACAC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 1042889418 8:73590692-73590714 TGTGTAAGACATCATCTGGGAGG 0: 1
1: 0
2: 2
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042889413 Original CRISPR GTGTGCTTGGTAAGGTGTCC AGG (reversed) Intronic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
900306245 1:2010024-2010046 GTGTGCTTGGGAGGGTGCCCAGG + Intergenic
900390859 1:2433203-2433225 GTGTACGTGCTCAGGTGTCCGGG + Intronic
900575130 1:3379199-3379221 GTGTGCTGGGAGAGGTGTGCTGG - Intronic
901118983 1:6874835-6874857 TTACGCTTGGTAAGGTGTCTAGG + Intronic
902657335 1:17878313-17878335 GGGTGCATGGTAGGATGTCCAGG + Intergenic
910004351 1:82377746-82377768 ATGTGCTTAGTGAGGTGTCATGG + Intergenic
911039201 1:93578844-93578866 GTGGGCTAGGCAAGGTGCCCTGG + Intronic
914747761 1:150512166-150512188 GTGGGCTTGGGAAGGTGGACGGG - Intronic
1063239066 10:4149621-4149643 GTCTACTTACTAAGGTGTCCCGG + Intergenic
1063891959 10:10639795-10639817 GTTTGCTTGGTAAGGTGACAGGG - Intergenic
1065613124 10:27491881-27491903 GTGAGCTTGGTAATTAGTCCAGG - Intergenic
1070659018 10:78291565-78291587 GTGTGCTTGGTAGGGTCTGGTGG - Intergenic
1073448082 10:103592833-103592855 GTGTGGTGGGGAAGGTGCCCTGG + Intergenic
1073762807 10:106648879-106648901 GTCTGCTTGCTAGGGTGTCAGGG - Intronic
1075963903 10:126593812-126593834 TTGTGCTTGGTGAGGAGTCAGGG + Intronic
1079691133 11:23418432-23418454 GTGTGCATGTGAATGTGTCCTGG - Intergenic
1083246856 11:61435452-61435474 ATGTGCTTGGTAACTTGTACTGG + Intronic
1083613121 11:64013839-64013861 GAGTGCTGGGAAGGGTGTCCCGG - Intronic
1084022207 11:66424491-66424513 GTGTGCTTGGAATGCTGTGCTGG - Exonic
1090563627 11:127962008-127962030 GTGTGTTTGGTAAGGGCTCAGGG + Intergenic
1090646588 11:128771349-128771371 GTCTGCTTTGTAAAGTGCCCAGG - Intronic
1095092933 12:38123783-38123805 GTCTCCATGGTAAGGTCTCCGGG + Intergenic
1100739297 12:97573389-97573411 GTGGGCTTGGAAAGGCTTCCAGG - Intergenic
1103241947 12:119420899-119420921 GTGTGCAAGCTAAGGTCTCCGGG + Intronic
1105005487 12:132718437-132718459 GTGTGCTGGGTGGGGGGTCCTGG + Intronic
1107533724 13:41308560-41308582 GTGTGCTTGCTCAGTTCTCCGGG + Intergenic
1110560265 13:76904014-76904036 GTATGCTTGGTAAAATGTACCGG + Intergenic
1111139796 13:84101499-84101521 TTGTGCTTGGCAAGGTGTTGTGG + Intergenic
1119995188 14:79245908-79245930 GCGTGTTTGGTAAGGTGTCAAGG + Intronic
1121584898 14:95056625-95056647 GTCTGCTGGGTCAGGTGACCTGG - Intergenic
1123049080 14:105532007-105532029 GTGTGCAGGGTAAGGTTGCCTGG - Intergenic
1124612123 15:31215926-31215948 TTGTGCTTGGAAAGGGGCCCGGG - Intergenic
1127392069 15:58513817-58513839 ATGTGCATGGTGAGGAGTCCTGG - Intronic
1127398686 15:58564266-58564288 GTGGGCTTGGGAAGGGGTCCAGG + Intronic
1128072725 15:64807626-64807648 CTGTGCTTGGTAAACTGTGCAGG - Intergenic
1129413027 15:75360257-75360279 GAGGGCTTTGGAAGGTGTCCTGG - Intronic
1129918328 15:79294550-79294572 ATGTGCTAGGTACAGTGTCCAGG - Exonic
1131244595 15:90779925-90779947 GTTTGCTTTGTTTGGTGTCCTGG + Intronic
1132025566 15:98401873-98401895 CTGTGCTTGGGGAGGTGGCCAGG - Intergenic
1132044793 15:98554529-98554551 GACTGCATGGCAAGGTGTCCAGG + Intergenic
1132104819 15:99055700-99055722 GTGTACTTGGTAGGGTGTAGTGG + Intergenic
1132829889 16:1922854-1922876 GTCTGGTTGCTCAGGTGTCCTGG - Intergenic
1136656352 16:31711551-31711573 GTGTGCTGGGTAAGGGGCCTAGG + Intergenic
1138149084 16:54638440-54638462 GTGTTCTTGGTAAAGTGTGTGGG - Intergenic
1139239858 16:65379681-65379703 GTGGGCTTCTTAGGGTGTCCAGG + Intergenic
1139303208 16:65962515-65962537 GTGTGCTTGGTCAGGTCTCTCGG - Intergenic
1141071957 16:80965140-80965162 GTGTGATTGCTAAGGAGTACAGG + Intergenic
1141642713 16:85350571-85350593 GTGTGCTGGGGAAGGCGTCTTGG - Intergenic
1142351318 16:89581943-89581965 GTGTACATAGAAAGGTGTCCAGG - Intronic
1143777740 17:9210345-9210367 GTGTGCATGGTAAGGTGGCTGGG - Intronic
1149217131 17:54370413-54370435 GTGTGCCTGCTAAGGTCTCTTGG + Intergenic
1159813631 18:73046749-73046771 GTGTGTTGGGTAAGGGGTGCAGG - Intergenic
1165900868 19:39168706-39168728 CTGTGCTTGGTACTGTGTCAAGG + Exonic
1166189960 19:41169936-41169958 GTGTGTTTGGTCAGACGTCCGGG - Intergenic
1166377142 19:42333971-42333993 GTGTGCTGGGTAAGGTGGGCAGG - Intronic
1167699576 19:51034571-51034593 GTGTTCTTGGTGAGTTCTCCCGG - Exonic
1167905455 19:52656912-52656934 GTGTGATTTGCAATGTGTCCAGG - Intronic
1168169043 19:54574297-54574319 GTGGGCTTGGGGAGGTGCCCTGG - Exonic
1168176544 19:54631496-54631518 GTGGGCTTGGGGAGGTGCCCTGG - Exonic
925363088 2:3293254-3293276 GCCTGCTAGGAAAGGTGTCCTGG - Intronic
925906836 2:8544805-8544827 GGCTGCTTGGGATGGTGTCCTGG - Intergenic
928900204 2:36309453-36309475 GTAGGCTTGGTAAGTTCTCCTGG - Intergenic
930370526 2:50495503-50495525 CTTTCCTTGGTAAGGTTTCCTGG - Intronic
940717984 2:157249452-157249474 GGGTGTTTGGAAAGGTGTCCTGG - Intergenic
941657352 2:168158410-168158432 GTGTCCCTGGTAAGGTTTCAGGG - Intronic
942298185 2:174537231-174537253 GTGTGTTTTATAAGCTGTCCTGG - Intergenic
946759203 2:222976538-222976560 TTGTTCTTGGTAAGATGTGCAGG - Intergenic
948614188 2:239187778-239187800 GTGTGCTTGTTAAAGTGGACAGG + Intronic
1168794522 20:602711-602733 GGGTGCTTGGAAAGCTCTCCTGG + Intergenic
1169838986 20:9913148-9913170 GTGTTCTTTGTTAGTTGTCCAGG - Intergenic
1175593324 20:60211165-60211187 GTGTGCTGGGGAAGGGGTGCTGG + Intergenic
1178627125 21:34227500-34227522 GTGTGTTTGGGAGGGTCTCCAGG + Intergenic
1179896428 21:44366105-44366127 GTGTACTTGGGAGGGTCTCCTGG + Intronic
1181361198 22:22338144-22338166 TTGTATCTGGTAAGGTGTCCAGG + Intergenic
1182360253 22:29742306-29742328 GTGGGCTTGGGATGGTGGCCCGG + Intronic
1184748940 22:46473240-46473262 ATGTGCCTGGTAAGGTGACTCGG + Intronic
1185410538 22:50679221-50679243 GTGTGCTGGGTTGGGGGTCCTGG + Intergenic
954704713 3:52473276-52473298 GTGTGCTTGGGCAGGTGGCTTGG + Intronic
959038111 3:101388148-101388170 GTGGGCTTGCTCAGGTGTCATGG - Intronic
969044615 4:4327822-4327844 GTGTGCTTGGTCAGCTGCCCAGG - Intergenic
970341260 4:15109267-15109289 ATGTTATTGGTAAGGTTTCCAGG - Intergenic
970697599 4:18696417-18696439 GTGTGCCTGCTAGGGTCTCCGGG + Intergenic
975481849 4:74889637-74889659 GTGGGCTTGGTGAGGTGCACAGG + Intergenic
979033418 4:115680388-115680410 GTGTGCTTGTCAAGGTGTTATGG + Intergenic
982743568 4:159083113-159083135 GTGTGCTTGGCAGGGTGCGCTGG + Intergenic
986595663 5:9419229-9419251 GTGTCCTTGGTATGATTTCCAGG + Intronic
996116426 5:119625123-119625145 GTGTTCTTGCTATGTTGTCCAGG + Intronic
1000013524 5:157256726-157256748 GAGGGCTTGGGAAGGTGGCCTGG + Intergenic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1003490752 6:6619556-6619578 CTGTGGCTGGTAAGGTCTCCTGG + Intronic
1004799869 6:19134621-19134643 GTGTGCCTGCTAAGGTCTCATGG - Intergenic
1005677718 6:28172871-28172893 CTGTGCATGCTGAGGTGTCCTGG + Intergenic
1006408833 6:33860293-33860315 GTGTGGTGGGTATGGTGTGCTGG + Intergenic
1007003680 6:38338670-38338692 TTGTGCTTCCTAAGGTCTCCTGG - Intronic
1007244267 6:40448858-40448880 GTGGGCTGGGAAAGGGGTCCTGG + Intronic
1007659348 6:43473748-43473770 ATGTGCTTGGTGTGGAGTCCGGG - Intergenic
1017980103 6:159393978-159394000 GTGTGCCTGCTAGGGTGTCAGGG - Intergenic
1018468164 6:164071264-164071286 GTGGGCTGGGTCAGGAGTCCAGG + Intergenic
1022445138 7:30464251-30464273 GGCTGCTGGGCAAGGTGTCCAGG - Intronic
1022620435 7:31978455-31978477 GTGTGCTTGCTAAGTAGGCCAGG + Intronic
1024636360 7:51293850-51293872 CTATGCTTGGTAAGGGGTCCTGG + Intronic
1029737221 7:102471669-102471691 GTCTGCTTGGAGAAGTGTCCCGG - Intronic
1031201829 7:118698190-118698212 GGATGCATGGGAAGGTGTCCAGG - Intergenic
1032015693 7:128379172-128379194 GGGTGCTGGGAAAGGTGTTCTGG - Intergenic
1034487901 7:151377527-151377549 GGGTCCTGGGGAAGGTGTCCAGG + Exonic
1035337451 7:158138943-158138965 GTGTGCTGGGCAGGGTGTCCTGG - Intronic
1035337455 7:158138957-158138979 GTGTGCTGGGCAGGGTGTGCTGG - Intronic
1035337459 7:158138971-158138993 GTGTGCTGGGCAGGGTGTGCTGG - Intronic
1035495936 7:159326210-159326232 GTATGCTTTGTAAGGTATACAGG - Intergenic
1038752274 8:30306364-30306386 GTGTGCCTGGCAAAGTCTCCTGG + Intergenic
1040637800 8:49295883-49295905 GTCTGTTTGGCAAGGTTTCCAGG + Intergenic
1042042591 8:64608677-64608699 GTGTGCTCTGGAAGGTGTCATGG + Intronic
1042889413 8:73590663-73590685 GTGTGCTTGGTAAGGTGTCCAGG - Intronic
1047669128 8:127125419-127125441 GATTGCTTGGTAATTTGTCCCGG - Intergenic
1047746087 8:127846060-127846082 GTGTGCTTGGGAAAGGCTCCAGG - Intergenic
1047925475 8:129678768-129678790 GTGTTCCTGGCAGGGTGTCCTGG + Intergenic
1055326572 9:75136728-75136750 GTGTGCTTGGTGAGGCCTGCTGG + Intronic
1056735301 9:89204625-89204647 GTGTGCCTGGAAAGGTGTTTCGG + Intergenic
1058542081 9:106021982-106022004 GTGTGCTAAGTAAGGTTTCCAGG + Intergenic
1062401838 9:136376220-136376242 GTGTGCTGGGTTAGGTGGGCAGG - Intronic
1062479649 9:136745397-136745419 GTGTGCTTGGAGGGGTCTCCTGG - Intronic
1062679699 9:137772207-137772229 TTGTGCTTGGAGAGGTGTGCTGG - Intronic
1186672438 X:11781171-11781193 TAGTGCTTGGAAAGGTGGCCAGG - Intergenic
1187084772 X:16030577-16030599 TGGTGTTTGGTAAGGTGGCCAGG + Intergenic
1188240223 X:27777596-27777618 ATGAGCTTGGAAAGGAGTCCAGG + Intergenic
1190632722 X:52403667-52403689 GTGTTCTTGCTAAGTTGCCCAGG - Intergenic
1195081483 X:101375597-101375619 GTGTGCTTGGTAAGGTGTAGAGG + Intronic
1196820445 X:119696412-119696434 CTGTTCTTGGGAAGGTGACCCGG - Intergenic
1198280155 X:135133703-135133725 GTGTGCCAGGTATGTTGTCCAGG - Intergenic
1198290803 X:135238811-135238833 GTGTGCCAGGTATGTTGTCCAGG + Intergenic