ID: 1042893653

View in Genome Browser
Species Human (GRCh38)
Location 8:73642178-73642200
Sequence ATAGAGAAGCAGTAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 604}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042893653_1042893661 26 Left 1042893653 8:73642178-73642200 CCTTTCTCCTACTGCTTCTCTAT 0: 1
1: 0
2: 2
3: 60
4: 604
Right 1042893661 8:73642227-73642249 CAAAAACTTTCATCTTTGCCAGG No data
1042893653_1042893656 -8 Left 1042893653 8:73642178-73642200 CCTTTCTCCTACTGCTTCTCTAT 0: 1
1: 0
2: 2
3: 60
4: 604
Right 1042893656 8:73642193-73642215 TTCTCTATGCAAACATGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042893653 Original CRISPR ATAGAGAAGCAGTAGGAGAA AGG (reversed) Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901574679 1:10191358-10191380 ACAGAGAAACAGCAGGAGCAAGG + Intergenic
902778575 1:18690356-18690378 ATAGAGAAGAGGAAGCAGAAAGG - Intronic
902818834 1:18931250-18931272 AGACAGAAGCAGTGGGAGGAGGG - Intronic
903021645 1:20399367-20399389 AAAGACAAGTAGTAGGAGAAAGG - Intergenic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904632575 1:31853864-31853886 ATAGAGATGGAGGAGGAGAAAGG - Intergenic
904745859 1:32710450-32710472 AGAGAGAGGAAGCAGGAGAAAGG - Intergenic
905391835 1:37640890-37640912 ATAGAGAAGGAGGAAGACAAAGG - Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905944224 1:41888447-41888469 AGAGAGGAGAAGGAGGAGAAAGG + Intronic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906437300 1:45807213-45807235 TTAGAGAAGCAGTAACAGAATGG - Intronic
906534375 1:46543640-46543662 ATAGAGAGGGAGCAGGAGAAGGG - Intergenic
907687460 1:56626036-56626058 ATAAAGAAGCAGAAGGACAAAGG + Intronic
907859077 1:58333313-58333335 ATATAGGGGCAGTAGGGGAAAGG + Intronic
908447197 1:64210615-64210637 AGAGAGAAGAACTAGGAAAAAGG + Intronic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
908556472 1:65261697-65261719 GTAGAAAAGAAGTGGGAGAAGGG - Intronic
909310073 1:74134595-74134617 ATAGAGCAACAGTAGGGCAAAGG + Intronic
909461993 1:75927446-75927468 AAACAGTAGCAGTGGGAGAAAGG - Intronic
909539269 1:76772474-76772496 ATAGAGAAGTAGCTGGAGAAGGG - Intergenic
910275697 1:85446817-85446839 AGAGAGAAGGAGAAGAAGAAAGG - Intronic
910329399 1:86053055-86053077 AAAGCCAAGCAGTTGGAGAATGG + Intronic
910666815 1:89734501-89734523 ATAGAGAGGAAGGAGGGGAAGGG + Intronic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911981355 1:104571002-104571024 ATAGAAAAACAAAAGGAGAAAGG + Intergenic
912203830 1:107488696-107488718 ATAGAGATACAGTATGTGAAAGG + Intergenic
913596567 1:120384610-120384632 ATAGCCAAGCAGCAGGAGTAGGG - Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914090703 1:144494372-144494394 ATAGCCAAGCAGCAGGAGTAGGG + Intergenic
914169013 1:145202839-145202861 ATAGAGAAGCCGTTAGAAAAAGG - Intergenic
914307904 1:146439843-146439865 ATAGCCAAGCAGCAGGAGTAGGG - Intergenic
914436892 1:147668567-147668589 ATAGAGAAGAATTGGGGGAAGGG + Intronic
914524134 1:148446794-148446816 ATAGAGAAGCCGTTAGAAAAAGG - Intergenic
914594205 1:149133290-149133312 ATAGCCAAGCAGCAGGAGTAGGG + Intergenic
914599542 1:149189077-149189099 ATAGAGAAGCCGTTAGAAAAAGG + Intergenic
914642272 1:149620342-149620364 ATAGAGAAGCCGTTAGAAAAAGG + Intergenic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
915415484 1:155739139-155739161 TTAGAAAAGCACTGGGAGAAAGG - Intergenic
915584328 1:156836074-156836096 ACAGACACGCAGGAGGAGAAAGG - Intronic
916616257 1:166444168-166444190 AGAGAGAAGGAGAAGGAGAAAGG + Intergenic
916664166 1:166950399-166950421 AAAGAGAAGGAGAAGGAGAGAGG + Intronic
916666503 1:166972691-166972713 AAAGAGAAACAGGAGGAGAAGGG + Intronic
916678007 1:167080465-167080487 AGAGAGAAGCACTAGGAGGCAGG - Intronic
917143521 1:171862806-171862828 AAAGAGAAGCAGCAACAGAAGGG + Intronic
917439287 1:175052571-175052593 AGAGAGAAGGGGTAAGAGAAAGG + Intergenic
917815543 1:178706202-178706224 GTGGAGGAGCAGTAGGAGAATGG + Intergenic
918318537 1:183343410-183343432 ATAGAGAAGCAACTGGAGATGGG - Intronic
918692907 1:187504588-187504610 AAAGAGAAGCAATAACAGAAGGG - Intergenic
918937481 1:190942038-190942060 ATTGAGGAGCAGTAATAGAAAGG + Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919367536 1:196683029-196683051 ATAGAGAAGAAGTAGAAAAATGG + Intronic
922511906 1:226175660-226175682 TTAAAGCAGCAGTAGGAAAATGG + Intronic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923594647 1:235351508-235351530 ATAGAAAACGAGTAAGAGAATGG + Intergenic
924038526 1:239960063-239960085 AGAGAAAGGCAGGAGGAGAAAGG - Intergenic
924248403 1:242107148-242107170 AAATAGGAGCAGTAGGTGAATGG + Intronic
924404537 1:243729214-243729236 AAATAGAGGCAGTAGCAGAATGG + Intronic
924557454 1:245130071-245130093 AAAGAGAAGCAGAAAGAAAATGG + Intergenic
1063413661 10:5855985-5856007 AAAGAGAAAAAGTAGGAAAAGGG + Intergenic
1064250373 10:13702003-13702025 ATAAAGAATCAGGAGAAGAAAGG + Intronic
1064939411 10:20715889-20715911 GGAGAGAAGCAGTGAGAGAAGGG + Intergenic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065383375 10:25111687-25111709 AGAGAGAAGCAGGATGAGATGGG - Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1068098467 10:52521523-52521545 ATAAATATTCAGTAGGAGAAAGG - Intergenic
1068385638 10:56323376-56323398 ATGGAGTACCAGTGGGAGAAAGG - Intergenic
1068395726 10:56458727-56458749 AAAAAGAAGAAGTAGGAGGAGGG + Intergenic
1068588471 10:58827885-58827907 GTTGAGAAGGAGGAGGAGAAGGG - Intronic
1068743606 10:60502825-60502847 AGAAAGAAGGAGTAAGAGAAAGG + Intronic
1069267072 10:66473353-66473375 AGAGAGAAGCATGAGGAGCAAGG - Intronic
1069766850 10:70868512-70868534 GAAGAGAAGCAGCAGGAAAATGG - Intronic
1070674948 10:78406071-78406093 AAAGAGAAGGATTAGGAGCATGG - Intergenic
1070835806 10:79446113-79446135 AGAAAGAAGGAGTATGAGAAAGG - Intergenic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071154021 10:82669013-82669035 ATAAAGAAGAACGAGGAGAAGGG - Intronic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071883057 10:89920403-89920425 ATCAATAAGCAGTAGTAGAAAGG + Intergenic
1073053525 10:100684656-100684678 GAAGAGAAGCTGTGGGAGAAGGG + Intergenic
1073788750 10:106918593-106918615 ATAGAGGAGGAGAGGGAGAAAGG + Intronic
1074495391 10:113975814-113975836 AAAGAGAGGAAGTAGGGGAAGGG + Intergenic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1075197978 10:120377779-120377801 AGAGAGGAGCAGAAGGGGAAGGG - Intergenic
1075974951 10:126686838-126686860 ATAGAGAAGGAGCAGGAGAGGGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076809181 10:132877912-132877934 AAAGAGAAGGACAAGGAGAAGGG - Exonic
1077717717 11:4598635-4598657 CTTGAGAATCAGTAGTAGAAGGG - Intergenic
1077887560 11:6396849-6396871 ATAGAGAAGAGGTAGGAGAAAGG - Intronic
1078471161 11:11587881-11587903 AGAGAGAGGCAGGGGGAGAAAGG + Intronic
1079663040 11:23065797-23065819 ATATAGAAGCAGTAATAAAATGG - Intergenic
1079800965 11:24868171-24868193 ATTAAGAAGCAGTAGAGGAAGGG + Intronic
1079839064 11:25371522-25371544 ATAGAAAAGCAAAAGGAAAAGGG + Intergenic
1080218092 11:29868565-29868587 AAAGAACAGCAGTAGGGGAATGG - Intergenic
1081035660 11:38142160-38142182 AAAGAACAGCAGTAGCAGAAAGG + Intergenic
1081104513 11:39048409-39048431 ATAGAGAAGCCAGAGGTGAAGGG - Intergenic
1081613103 11:44575196-44575218 AAAGAGAAGGAGATGGAGAAAGG + Intronic
1082771053 11:57207596-57207618 GTAGAGAAGTAGCAGGAGGAAGG - Intergenic
1082879211 11:58021834-58021856 CTAGAGAAGCAGTGGGAGGCAGG + Intergenic
1082939385 11:58687933-58687955 ATAGAGCAGTAGAAAGAGAAGGG + Intronic
1082968563 11:58994341-58994363 AGTGAGAAAGAGTAGGAGAAAGG - Intronic
1084754990 11:71232518-71232540 AAAGAGGAGGAGGAGGAGAAGGG - Intronic
1084899073 11:72296055-72296077 ATAGAGAAGCAGTGAGATACAGG + Intronic
1085244484 11:75089048-75089070 GGAGAGAAGCACCAGGAGAAGGG + Exonic
1085249240 11:75131315-75131337 GGAGAGAAGCACCAGGAGAAGGG + Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086518274 11:87640022-87640044 AAAGAGAAAAAGGAGGAGAAAGG - Intergenic
1086583433 11:88425113-88425135 CGCGAGAAGCTGTAGGAGAAAGG + Intergenic
1086656236 11:89359731-89359753 ATAGAGAGGCAGTTAGGGAAGGG - Intronic
1086867975 11:92003252-92003274 AGAGAGAAGCAGAAGCAGAGAGG + Intergenic
1087383814 11:97443889-97443911 AAAGAGAAAGAGTGGGAGAATGG + Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088672182 11:112153023-112153045 GTAGAGTAGGAGTAGGAGACTGG - Intronic
1089028636 11:115298801-115298823 ATATAGAAGGATGAGGAGAATGG + Intronic
1089233564 11:117002750-117002772 ATAGAGAACATGTAGGAGGAAGG + Intronic
1089304242 11:117516756-117516778 AGAGAGGAGGAGGAGGAGAAGGG + Intronic
1089311897 11:117563739-117563761 ATAGAGAAGCAGTACAACACTGG - Intronic
1089597612 11:119591130-119591152 ACAGAGAAGAAGGAAGAGAATGG + Intergenic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090311675 11:125746707-125746729 ATAGATAAGTGGTATGAGAAGGG + Intronic
1090485563 11:127109161-127109183 AGAGAAAGGCAGAAGGAGAAAGG - Intergenic
1090883453 11:130855137-130855159 ATGGAGATTCATTAGGAGAAAGG - Intergenic
1091084812 11:132711190-132711212 AGACAAAAGCAGTAAGAGAAGGG - Intronic
1091920640 12:4302107-4302129 ATACAGAAGCAGTGTGAGCAGGG + Exonic
1093213552 12:16336048-16336070 ATTAAGAAGCAGTAGGAGCTGGG + Intergenic
1094129852 12:27063204-27063226 AAAGAGGAGGAGGAGGAGAAGGG - Intronic
1094250404 12:28353598-28353620 ATAGAGAGGCTCTAGGAGAGAGG + Intronic
1095290822 12:40478323-40478345 CTAGTGAAGCTCTAGGAGAATGG - Intronic
1095509252 12:42932002-42932024 AGAGAGGAGGAGTAGGAGAAAGG + Intergenic
1095824736 12:46519370-46519392 ATAGAGAAGAAAGAAGAGAAAGG - Intergenic
1096528840 12:52231030-52231052 ATGGAGAGGCAGGAGGAGACTGG + Intergenic
1096866509 12:54566984-54567006 ATGGTGAAGCAGTTGGAGAATGG + Exonic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1098249610 12:68555764-68555786 GTAGTGAAGCAGTGGGAGAGAGG + Intergenic
1098708005 12:73715872-73715894 AAAGAGAAGGAGAAGGAGAGAGG + Intergenic
1099081066 12:78181843-78181865 ATACAGAAGGAGAAGGAGAAGGG + Intronic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1101084841 12:101225562-101225584 ATAAAGAATCAGTAGGATACAGG - Intergenic
1101247777 12:102901202-102901224 ATAGAGGAGGAGGAGGAGACGGG - Intronic
1101293243 12:103393577-103393599 ATAGAGAAAAAGCAGGATAAGGG - Intronic
1101670006 12:106861062-106861084 ATAGAGAGGGAATAGGAGAAAGG - Intronic
1101883938 12:108645359-108645381 AAAGAGAAGCAGGAGGGCAAGGG - Exonic
1102739478 12:115194488-115194510 ACAAAGAAGGAGGAGGAGAATGG + Intergenic
1103375596 12:120453146-120453168 AAAGAAAAGCAGTGGGAGAACGG + Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1104231241 12:126886448-126886470 AAATAGAAGCAGTAGGACATGGG + Intergenic
1104268304 12:127259052-127259074 ATTGTGAAGCAAAAGGAGAAAGG + Intergenic
1104479802 12:129097555-129097577 ATAGAGAAATAACAGGAGAAGGG + Intronic
1104947486 12:132422778-132422800 AGAGAGAAGCAGATGGAGAGAGG - Intergenic
1105040923 12:132960583-132960605 AAAGAGATGCAGAAGCAGAAGGG - Intergenic
1105261790 13:18785152-18785174 ATACAGCAGGAGTAGGAGCAAGG + Intergenic
1105264147 13:18801741-18801763 ATACAGCAGGAGTAGGAGCAAGG + Intergenic
1105382368 13:19899515-19899537 ATAGAAAAGCAGTAGAGGAAAGG + Intergenic
1107657211 13:42604024-42604046 ATAGAGAGGCAGGAGAAGAGAGG - Intronic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108440415 13:50447493-50447515 AGAGAGAAGCAGCTGGACAATGG - Intronic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109763597 13:66863841-66863863 ATAAACGAGCAGCAGGAGAACGG - Intronic
1110436980 13:75486244-75486266 ATAGAGAGGAAGCAGAAGAAGGG + Intergenic
1111767553 13:92551700-92551722 ATTGAGAAACAGTAGGAGGTAGG + Intronic
1111905708 13:94253334-94253356 ATAGAGAATCAACTGGAGAAGGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112548048 13:100390992-100391014 AAAAAGAAGAACTAGGAGAAGGG + Intronic
1112584511 13:100706311-100706333 AAAGAGAAGAAGAAAGAGAAGGG - Intergenic
1113041598 13:106109154-106109176 ATAGAGAGGAAGTAAGACAAAGG + Intergenic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113541572 13:111113973-111113995 ATAGGGCAGCAGTAGGAAACGGG + Intergenic
1114133835 14:19823998-19824020 ATAGGGAAGATGAAGGAGAAGGG - Intronic
1114248217 14:20934412-20934434 CTAGAGAAGTGGGAGGAGAAGGG - Intergenic
1114399494 14:22396282-22396304 AAAGAGATGAAGTAGGAGAGTGG + Intergenic
1114911427 14:27203821-27203843 ATAGGGAAGCAGTAAGAGCTGGG + Intergenic
1114975320 14:28089551-28089573 GTAGAAAATCAGAAGGAGAAAGG + Intergenic
1115315254 14:32018622-32018644 CTAGAGAAACAATAGGAGGAGGG - Exonic
1115488105 14:33932114-33932136 ATAGGGATGCAGTAGGTGCAAGG + Intronic
1115801487 14:36999130-36999152 ACTGGGAAGCAGTAGGTGAATGG + Intronic
1117581482 14:57155909-57155931 ATGGAGGAGCAGGAGGGGAAAGG + Intergenic
1118012481 14:61624057-61624079 AATGTAAAGCAGTAGGAGAAAGG - Intronic
1118058889 14:62114360-62114382 ACAGATAAGAAGTAGGAGACAGG + Intergenic
1118139426 14:63064336-63064358 AAAGAGAAGGGGAAGGAGAAAGG + Intronic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118171932 14:63396165-63396187 ATAGAGGAGGAGGAGGAGAGAGG + Intronic
1118510959 14:66472739-66472761 ATTGAAAAGCAAAAGGAGAATGG + Intergenic
1118668454 14:68096482-68096504 ATCGAAAAGGAGTAGGAGGAAGG - Intronic
1119042133 14:71284488-71284510 ATTGAGTAGTATTAGGAGAAGGG + Intergenic
1119091521 14:71786119-71786141 AAAGAGAACCAGTAGTAGATAGG - Intergenic
1120294525 14:82622979-82623001 AAAGAGGAGGAGGAGGAGAATGG + Intergenic
1120306763 14:82780824-82780846 AAAAAGAAGGAGGAGGAGAAGGG - Intergenic
1120691226 14:87595559-87595581 TTAGAGAAGTAGTAAGACAAAGG + Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1202926477 14_KI270724v1_random:30976-30998 AGAGAGAAGCCGTCAGAGAAGGG + Intergenic
1123576906 15:21679585-21679607 ATAGGGAAGATGAAGGAGAAGGG - Intergenic
1123613528 15:22122053-22122075 ATAGGGAAGATGAAGGAGAAGGG - Intergenic
1123875898 15:24623528-24623550 ATAAAGAAGAAGAAGAAGAAAGG - Intergenic
1123986762 15:25653153-25653175 ATGGAGAAGAACGAGGAGAACGG - Intergenic
1124013498 15:25858435-25858457 ACGGAGAAGGAGTAGGAGAGGGG + Intronic
1124548967 15:30659919-30659941 ATGGAGTAGCTGTAGGAGATGGG + Intronic
1124637328 15:31373555-31373577 AAGGAGAAGCAGGAGGAAAAGGG - Exonic
1125384780 15:39125704-39125726 ATAGAGAAGCCTTAGAATAAAGG - Intergenic
1125575498 15:40752660-40752682 TCAGAGAAGGACTAGGAGAAAGG + Intronic
1126138338 15:45414110-45414132 ATAGAGAGTGAGTAGGAGGAGGG + Intronic
1126493847 15:49268709-49268731 AAAGAGAGACAGTAGAAGAAGGG - Intronic
1126656422 15:50982459-50982481 ATATAGAAGGAATAGGAGTAGGG - Intronic
1126891979 15:53216147-53216169 ATAGAATAGCAGGAGGAGAGTGG - Intergenic
1127236638 15:57059892-57059914 AAAGGGAAGAAGTAGGAGAGAGG + Intronic
1127811614 15:62570009-62570031 ATAGAGAAGAAGGAAGAGAGAGG - Intronic
1127876203 15:63113718-63113740 ATAGAGATGGAGTAGGAGGGAGG + Intergenic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128565088 15:68695804-68695826 AGAGAGAAGAAACAGGAGAAGGG + Intronic
1130456265 15:84112766-84112788 ATAAACAGGCAGTGGGAGAAAGG - Intergenic
1130714416 15:86317393-86317415 ATAAAGAAGCAATGAGAGAAAGG + Intronic
1131610742 15:93959626-93959648 ATAGAAAATCAGTAGGTGTATGG - Intergenic
1131986172 15:98044470-98044492 ATAGAGAAGCAAGAGCAGAGAGG - Intergenic
1132013520 15:98296479-98296501 AAAGAGAGACAGCAGGAGAAAGG - Intergenic
1202985774 15_KI270727v1_random:413830-413852 ATAGGGAAGATGAAGGAGAAGGG - Intergenic
1133821373 16:9239704-9239726 AAAGAAATGCAGGAGGAGAAGGG - Intergenic
1134306046 16:13033452-13033474 TTAGAGAAGCAGAAAAAGAAAGG - Intronic
1134506220 16:14809425-14809447 AGAGAGAGGCAGTAGAGGAAAGG + Intronic
1134574332 16:15319339-15319361 AGAGAGAGGCAGTAGAGGAAAGG - Intergenic
1134728085 16:16436959-16436981 AGAGAGAGGCAGTAGAGGAAAGG + Intergenic
1134939351 16:18274867-18274889 AGAGAGAGGCAGTAGAGGAAAGG - Intergenic
1135066528 16:19314865-19314887 AGAGAGAAGGAGGAGGAGAGGGG + Intronic
1135304414 16:21356088-21356110 TGAGAGATGCAGTAGGAGCATGG + Intergenic
1135630699 16:24033911-24033933 AGAGAGACACAGTTGGAGAAAGG + Intronic
1135887937 16:26329429-26329451 AGAGAGAAGCAGTTGGACATTGG - Intergenic
1136301156 16:29335218-29335240 TGAGAGACGCAGTAGGAGCATGG + Intergenic
1136387322 16:29937195-29937217 ATAAAAAAGCAGAAGAAGAAAGG + Intergenic
1136477807 16:30524416-30524438 GTGGAGAAGCCGCAGGAGAATGG - Exonic
1136927885 16:34391404-34391426 ATATAAAAGCATTAAGAGAAAGG - Intergenic
1136976689 16:35020402-35020424 ATATAAAAGCATTAAGAGAAAGG + Intergenic
1137605220 16:49782673-49782695 AGGGAGAGGCAGTAGGAGAAGGG - Intronic
1138241575 16:55431570-55431592 ATAGAGAAGCAGTAGGGCACAGG - Intronic
1138732950 16:59216244-59216266 ATAGAAAACCAGTAGAAAAATGG - Intergenic
1139893524 16:70269842-70269864 ATTGAGGAGCATTAGCAGAAAGG + Intronic
1139918815 16:70445909-70445931 AAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1140151922 16:72376183-72376205 TGAGAGAAGAAGGAGGAGAAAGG + Intergenic
1140189862 16:72806164-72806186 ATACAGAAGCAGTTTTAGAAAGG - Intronic
1140258061 16:73353747-73353769 AAAAAGAGGCAGGAGGAGAAAGG + Intergenic
1140690590 16:77479564-77479586 ATAGAGAATGAATAGGAGTAGGG - Intergenic
1140917318 16:79505967-79505989 ATAGAGAAGGAGCAAAAGAAGGG + Intergenic
1141315645 16:82960214-82960236 GATGAGAAGCAGTAGGATAAGGG + Intronic
1141322968 16:83029023-83029045 ATCTAGAAACTGTAGGAGAAGGG + Intronic
1141775574 16:86120914-86120936 CTAGAGGAGGAGGAGGAGAAGGG - Intergenic
1141874836 16:86816854-86816876 ATACAGAAGGAGGAGGAGAGAGG - Intergenic
1142485921 17:247660-247682 AGAGAGAAGCAGGAGGACATGGG - Intronic
1143275688 17:5708005-5708027 AGAGAGAAGAAGTGGGAGACAGG - Intergenic
1143830798 17:9648836-9648858 AAAGAGAAACAGAAAGAGAAAGG - Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144387709 17:14765116-14765138 ATAGAGAAGTAAAAAGAGAAAGG + Intergenic
1144768972 17:17748646-17748668 ATAGAAAAGGTGTAGGAGGATGG + Intronic
1144995614 17:19266077-19266099 ATCAAGCAGCAGTGGGAGAAAGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1146637284 17:34515733-34515755 AAAGAGAAGCTGAAAGAGAAAGG - Intergenic
1146714047 17:35068789-35068811 ATGGAGGAGGAGGAGGAGAAAGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146946226 17:36875581-36875603 AGAGAGAAGCAGAAGTGGAAAGG + Intergenic
1146953155 17:36920561-36920583 ATGGAAAAGCAAGAGGAGAAAGG - Intergenic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1149002968 17:51775896-51775918 ACAGAGAAACAGAAGGGGAATGG + Intronic
1149235658 17:54587707-54587729 ATAGAGATTCAGTAGAAGGATGG + Intergenic
1149381445 17:56098059-56098081 AGAGAGAAGCAGAAGGAGATTGG + Intergenic
1149436923 17:56640854-56640876 ATGGAGAGTCAGTAGGTGAACGG + Intergenic
1149467744 17:56893125-56893147 ACACAGATGCAGCAGGAGAAGGG + Intronic
1150634463 17:66903291-66903313 ATGGAGATGCAGTTGGAGCAGGG + Intergenic
1150883614 17:69059410-69059432 AGAGTGAGGCAGTAGAAGAAGGG + Intronic
1152820736 17:82436448-82436470 GTAGAGCAGCAGTGGGAGCATGG + Intronic
1154071563 18:11156925-11156947 AGAGAGAGGCCGTAGAAGAAAGG - Intergenic
1154196565 18:12271540-12271562 TTACAGCAGCAGTAGGAGATGGG + Intronic
1154431925 18:14314902-14314924 ATACAGCAGGAGTAGGAGCAAGG - Intergenic
1154946232 18:21164135-21164157 ACAGAGAAGCAGAAGTAAAATGG + Intergenic
1155365836 18:25048157-25048179 ATAGAGGAGCTGGAGGAGGATGG + Intergenic
1155855799 18:30832953-30832975 AAAGAGAGGAAGTAGGAAAAGGG + Intergenic
1155924234 18:31637291-31637313 AGAGAGAACCAGGTGGAGAATGG - Intronic
1156103701 18:33630494-33630516 ATAAAGAAGGAGGAGGAGAGAGG + Intronic
1156636446 18:39036319-39036341 ATAATAAAGCAGTAGGAAAATGG + Intergenic
1157400426 18:47382423-47382445 AGAGAGAAGCTGCAGCAGAAAGG - Intergenic
1158610156 18:58932462-58932484 AAAGAGAAGCAGCAGGGGAGGGG + Intronic
1158669935 18:59465327-59465349 AGAGAGAAGAAGAAAGAGAAAGG - Intronic
1158942842 18:62421641-62421663 ATAGATAAGAAGAAGGAGAGGGG - Intergenic
1159913890 18:74172024-74172046 ACAGAGAAGCAGGAGAAAAAGGG - Intergenic
1161850208 19:6734097-6734119 ATAGAGGGGCAGTGGGAAAACGG + Intronic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1164234942 19:23323623-23323645 GAAGAGAAGGAGGAGGAGAAAGG - Intronic
1164718454 19:30412667-30412689 AAAGAGGAGAAGAAGGAGAAGGG - Intronic
1165757933 19:38304902-38304924 AAAGTGAAGAAGAAGGAGAAGGG + Exonic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166635995 19:44452402-44452424 AGAGAGGAGCAGGAGGAGCACGG + Intergenic
1166774946 19:45306787-45306809 ATGGAGAAGAAGTTGGAGAAAGG - Exonic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1168092790 19:54096637-54096659 AGAAAGAGGCAGAAGGAGAAAGG - Intronic
1168434723 19:56307961-56307983 TTAGAGAAGCAGGAGGAGCTTGG - Intronic
925605265 2:5653972-5653994 ATAGCCAAGCAGCAGGAGTAGGG - Intergenic
926243809 2:11107399-11107421 AAAAAGAAGGAGGAGGAGAAAGG + Intergenic
927228871 2:20799991-20800013 ATTGCAAGGCAGTAGGAGAAAGG + Intronic
927537067 2:23871789-23871811 GTAGAGAAGGAGTAGGAGGTGGG - Intronic
927766180 2:25810540-25810562 AGCGAGAAGCTGAAGGAGAAAGG - Intronic
928399656 2:30968801-30968823 TTAGATAAGCAGTAGAAAAAGGG + Intronic
930109488 2:47666425-47666447 AGAAAAAAGCAGAAGGAGAAAGG + Intergenic
930639481 2:53840509-53840531 AAAGAAAAGGAGAAGGAGAAAGG + Intergenic
931290169 2:60865703-60865725 CTTTAGAAGCAGTATGAGAACGG + Intergenic
931638819 2:64363624-64363646 ACAGAGAAGGAGGAGGTGAAAGG - Intergenic
932885391 2:75544473-75544495 CAAGAGAAGCAGTAATAGAATGG - Intronic
933775748 2:85770290-85770312 ACAGGGAAGCAGTAGGAGCTGGG - Intronic
933933123 2:87175678-87175700 CTAGAAAAGCAGTAGCAGAATGG - Intergenic
934018654 2:87919681-87919703 ATAGAGAAGTAGTGTGGGAAAGG + Intergenic
934475569 2:94591286-94591308 GCAGAGAAGCTGTGGGAGAATGG - Intronic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936359990 2:111789769-111789791 CTAGAAAAGCAGTAGCAGAATGG + Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
936929218 2:117769880-117769902 ATAAAGAAGAAGAAGAAGAAGGG + Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937269187 2:120637026-120637048 TTAGAGTAGCAGTAGGAAATTGG + Intergenic
938760889 2:134424853-134424875 AGAGAGAAGCCATAGGATAATGG - Intronic
939389849 2:141552986-141553008 ATGGAGAGGTAGTGGGAGAAGGG + Intronic
939876057 2:147579388-147579410 TTAGAGAAAGAGTAAGAGAATGG - Intergenic
940455434 2:153892259-153892281 ATATTGATGCAGTAGGATAAAGG + Intronic
941087396 2:161133843-161133865 AAAGAGAAGGAGAAGGTGAAAGG - Intergenic
942422420 2:175821595-175821617 ATAGGGGAGCAGTGGGAGACTGG - Intergenic
942791356 2:179765114-179765136 AAGCAGAACCAGTAGGAGAAAGG - Intronic
942984089 2:182118854-182118876 ACAGAGAAGGAGAGGGAGAAGGG - Intronic
943102643 2:183507347-183507369 ATAAGGAGGCAGGAGGAGAATGG - Intergenic
943228676 2:185215413-185215435 AAAGGGAAGCAGTAGGAAAGAGG - Intergenic
943269667 2:185782950-185782972 ATAGATAAGGAGAAGGAGAAAGG - Intronic
943357111 2:186870442-186870464 AAAGAGAAGGAGGAGGAGAAAGG - Intergenic
943379987 2:187132900-187132922 AAAGAGAGGTAGTAGGAGAGAGG + Intergenic
943617919 2:190115210-190115232 AGAGAGAAGGAGAAGTAGAAAGG + Intronic
944324893 2:198392578-198392600 ATAGGGAAGAAGTAATAGAAAGG - Intronic
944579981 2:201124080-201124102 CTAGAGAAGCAGTAGAAAGAAGG + Intronic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945898496 2:215512216-215512238 AGAGTGAAGCAGTAACAGAAGGG + Intergenic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946312569 2:218890972-218890994 ATAAAAAAGCAGCAGAAGAAAGG + Intronic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946749995 2:222884619-222884641 ATAGAGAGGCAGAAGGAGATTGG - Intronic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
1169181435 20:3571919-3571941 ACACACAAGCAGTAGAAGAATGG - Intronic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1169525989 20:6426259-6426281 AGAGAGAAGAAGAAAGAGAAGGG - Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170711968 20:18799349-18799371 ATAGGGAAGGAGGAGGAGCAAGG - Intergenic
1171271529 20:23822112-23822134 ATAGAAAGCCAGGAGGAGAATGG - Intergenic
1172068674 20:32239990-32240012 ATAAAGAAGAAAGAGGAGAAAGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172824049 20:37765166-37765188 ATAGCGAAGCAAAAGGAGAGAGG - Intronic
1173215433 20:41077606-41077628 ATAAAGAAGGAGAAGGAAAATGG + Exonic
1173963645 20:47094130-47094152 ATGGTGAGGTAGTAGGAGAAAGG + Intronic
1174663027 20:52231583-52231605 AAAGAGAAGGAGGAGGAGAAGGG - Intergenic
1176387602 21:6146572-6146594 AAACAGAAGCAGTAGGAGACGGG + Intergenic
1176845117 21:13870860-13870882 ATACAGCAGGAGTAGGAGCAAGG + Intergenic
1176847845 21:13890417-13890439 ATACAGAAGGAGTAGGAGCAAGG + Intergenic
1176849218 21:13900176-13900198 ATACAGAAGGAGTAGGAGCAAGG + Intergenic
1176931728 21:14820297-14820319 TTAGACACGCAGTAGGAAAATGG - Intergenic
1176979694 21:15366926-15366948 ATAGATAATCAGGAGAAGAAAGG - Intergenic
1177271736 21:18857579-18857601 ATAAAAAAGCAGTATCAGAAGGG + Intergenic
1177854562 21:26386598-26386620 ACTGAGAAGTAGTAGGGGAAAGG - Intergenic
1178150823 21:29791483-29791505 ACAAAGAAGAAGAAGGAGAAGGG + Intronic
1179173360 21:38990194-38990216 ACAAAGAAGTAGAAGGAGAAGGG + Intergenic
1179228373 21:39476711-39476733 ATTGAGAAGTAGTAGGAATACGG - Intronic
1179735870 21:43391676-43391698 AAACAGAAGCAGTAGGAGACGGG - Intergenic
1179971232 21:44837505-44837527 AGAGAGAAGGAGAGGGAGAAAGG + Intergenic
1180109507 21:45641614-45641636 TTAGAAAAGGAGGAGGAGAAGGG - Intergenic
1180593898 22:16961608-16961630 ATACAGGAGCAGAAGGTGAAGGG - Intergenic
1181329089 22:22075196-22075218 AGAGAGAAACAGCAGGAGAGGGG - Intergenic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181741234 22:24923481-24923503 ATGGAGAAGGAAGAGGAGAAAGG - Intronic
1181989050 22:26822715-26822737 ATAAGGAAGCAGCAGGAGAGGGG - Intergenic
1182057588 22:27371998-27372020 AGAGAGAAGTGGTAAGAGAAGGG + Intergenic
1182389055 22:29975048-29975070 ATAGATTAGCACTAGGAGAATGG + Intronic
1182512936 22:30832007-30832029 AAAGAGGAGCAGGAGGAGAAAGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1183385404 22:37511373-37511395 AAAAAGAAGAAGAAGGAGAAGGG + Intronic
1184159638 22:42690417-42690439 AGAAAGAAGCGGGAGGAGAATGG + Intergenic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
951128625 3:19014351-19014373 AAAGAGATGGAGGAGGAGAATGG - Intergenic
951704048 3:25526058-25526080 ATAGAGAATAAGTAGGGGAAGGG + Intronic
952226446 3:31381733-31381755 ATTGGGAGGCAGTAGAAGAAGGG + Intergenic
953063550 3:39448620-39448642 ATAGAGAAGCAGCAAAAGAGTGG + Intergenic
953311326 3:41882775-41882797 ATGGAGTAGCTGTAGGAGATGGG - Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
955208226 3:56916751-56916773 ATAAAGCATCACTAGGAGAAGGG + Intronic
955301671 3:57785967-57785989 CTAGAAAAGTAGTAGTAGAAGGG - Intronic
955796071 3:62638509-62638531 ATAGAGAAGCTGAATCAGAAAGG + Intronic
956451397 3:69378606-69378628 ATAGGGAAGCAGTAAGGCAAGGG - Intronic
956484007 3:69702293-69702315 ATAAAGAAGTGGTATGAGAAAGG + Intergenic
956665157 3:71635462-71635484 ATTGGGAAGCAGTGGGAGGAGGG - Intergenic
957290397 3:78271019-78271041 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
957462875 3:80545119-80545141 ATAGGGAAGTAGAAAGAGAAGGG + Intergenic
957841157 3:85671598-85671620 TTAGAGAAGGGGAAGGAGAAGGG - Intronic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958047928 3:88307793-88307815 AGAGAGAATCAGTGGGAAAAGGG - Intergenic
958862544 3:99462475-99462497 ATAGAGAATAAATAGGAGGATGG + Intergenic
958867667 3:99519722-99519744 AAAAAGAAAGAGTAGGAGAAGGG + Intergenic
959404358 3:105942161-105942183 ATAGAGAAACAGTAGTGTAAGGG - Intergenic
959918131 3:111841328-111841350 ATTGAGTAGGAGTAGGAGGAGGG + Intronic
959966501 3:112361605-112361627 AGAGAAAAGCAGGAGGAAAAGGG + Exonic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG + Intronic
960289073 3:115861924-115861946 ATAAAAATGAAGTAGGAGAATGG - Intronic
960912772 3:122665938-122665960 AAAGAGAAGCAGTAGGGGCCTGG + Intergenic
961134972 3:124501890-124501912 ATAGAAAACCAGAAGGAGAAAGG + Intronic
961791802 3:129381611-129381633 ATAGAGAAGCAATCTTAGAAAGG - Intergenic
961805827 3:129488570-129488592 ATAGAGAAGCAATCTTAGAAAGG - Intronic
962014774 3:131428555-131428577 ACAGAGAGACAGTGGGAGAATGG + Intergenic
962024730 3:131536008-131536030 ATAGAGAAGGGGTAGGGGAATGG + Intronic
962957120 3:140276424-140276446 AAAGAGAAGGAGTAGAGGAAAGG + Intronic
963021829 3:140879171-140879193 ATAGAAAAGGAGCAGGAAAAGGG + Intergenic
963267852 3:143256694-143256716 ATAGAGAAGGGGCAGGAGACTGG + Intergenic
963465182 3:145670438-145670460 ATAGAGAAGCAGAACCAGTAGGG - Intergenic
963928714 3:150979190-150979212 GGAGAGAAGCAGAAGGAGTAGGG + Intergenic
964236997 3:154543125-154543147 AAAGAGAAGCTGTAGAAGAGGGG + Intergenic
964484246 3:157171277-157171299 AAAGAGAACCAGCTGGAGAATGG + Intergenic
964649732 3:158996963-158996985 ATAGAGAAGCAGCAAGATAAAGG - Intronic
964778124 3:160303042-160303064 ATAGAAAACCAGAAGAAGAATGG - Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
964892710 3:161556115-161556137 ATTGATTAGCAGTATGAGAAGGG - Intergenic
965263071 3:166507850-166507872 AGAAAGAAGTAGAAGGAGAAAGG - Intergenic
965614899 3:170584590-170584612 CTAGAGAAACAGGAGAAGAAGGG - Intronic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
965962341 3:174443009-174443031 ATAGAGGAGAAGTAGGATATGGG + Intronic
966271249 3:178109226-178109248 ATAGAAAACCAGTAGCAAAATGG + Intergenic
966559173 3:181300003-181300025 AATGAGAAGGAGGAGGAGAAGGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
967234740 3:187373239-187373261 ATAGAGAAGGGCAAGGAGAATGG + Intergenic
967311437 3:188110095-188110117 ATTGAGTGGCAGTAGGGGAAGGG + Intergenic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967381017 3:188858096-188858118 TTAGTGAAACAGTAGGAAAAAGG - Intronic
967616070 3:191568320-191568342 AGAAAGAGGCAGGAGGAGAAAGG + Intergenic
968391398 4:195982-196004 AAAGAGAAGCAGAGAGAGAAAGG - Intergenic
968738073 4:2309227-2309249 GCAGAGAAGCAGGAGGGGAAGGG - Intronic
969664976 4:8552203-8552225 ATTGCAATGCAGTAGGAGAAGGG + Intergenic
970107832 4:12605009-12605031 ATAGGGAAGCAGGAGAAGGAAGG - Intergenic
970119237 4:12734035-12734057 ACAGAGAAGCAGTTGGAAAGAGG - Intergenic
971055949 4:22912548-22912570 AAAGTGAAGCAGGAGGATAAAGG - Intergenic
971136348 4:23872542-23872564 AAAGACAATAAGTAGGAGAAGGG + Intronic
971221080 4:24706475-24706497 AGAGAGAAGAAGAAGGAGAAGGG - Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971320380 4:25600694-25600716 ATAGAGAGGCTGGAGAAGAAGGG + Intergenic
971648748 4:29243262-29243284 AAAAAGAAGGAGGAGGAGAAGGG + Intergenic
971719349 4:30225724-30225746 ATAGAGAACAAGATGGAGAATGG - Intergenic
972336179 4:38108800-38108822 AAAGATGAGAAGTAGGAGAACGG + Intronic
973739578 4:53906433-53906455 AAAGATAAGCTGTGGGAGAAAGG - Intronic
973849600 4:54948053-54948075 AGGAAGAAGCAGTAGGAGATAGG + Intergenic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
974404409 4:61447250-61447272 ATAGAGAAACAGTAACACAAAGG - Intronic
974639279 4:64608237-64608259 ATGGAGAAATAGTAGGTGAAGGG + Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
975206769 4:71652795-71652817 AAAGAGAAGCAGTAGCTAAAGGG + Intergenic
975375554 4:73640051-73640073 ATGGAGATGGAGTAGAAGAAGGG - Intergenic
975769792 4:77708656-77708678 GAAGAGAAGCCGTAGGTGAATGG - Intergenic
976022540 4:80646750-80646772 AAAGAGAAGCAACAGGAGAAGGG - Intronic
976327119 4:83784353-83784375 ATAGAGAAGTAGGAGGAGTCAGG + Intergenic
976777162 4:88719484-88719506 AAAGAGGAGGAGGAGGAGAAGGG - Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977371415 4:96141829-96141851 ATATAGATGTAGAAGGAGAAAGG - Intergenic
977481438 4:97582124-97582146 ATAGAGCAGAAGTAGGAGATGGG - Intronic
977760381 4:100728740-100728762 ATAGATAAGTAGTTGTAGAAGGG + Intronic
979233721 4:118375661-118375683 ATAGGAAAGAAGAAGGAGAATGG - Intergenic
979507714 4:121516595-121516617 ATTAAAAAGCAGTAGGAAAATGG + Intergenic
979803063 4:124936023-124936045 ATAGAGAAACACTGGTAGAATGG + Intergenic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
980669683 4:135988022-135988044 ATGAAGTAGTAGTAGGAGAAAGG - Intergenic
981589633 4:146345461-146345483 ATAGAGAGCCAGGTGGAGAATGG - Intronic
981798422 4:148627112-148627134 ACATAGAAGCAGGAGTAGAATGG + Intergenic
982599323 4:157425835-157425857 AAAGAGAATCAGTAGAAGAGAGG + Intergenic
982862003 4:160463944-160463966 AAAGAGAAGCAGCTGGACAATGG - Intergenic
984488165 4:180398956-180398978 ATAAAAAAGCAGTAGGAAAATGG - Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985104836 4:186490142-186490164 AAAGAAAAACAGTAGGAAAATGG - Intronic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986247449 5:6023242-6023264 ATGGAGAAGCAGCAGGGAAAAGG + Intergenic
988161110 5:27519173-27519195 CTAGAGAACCAGTATGGGAATGG - Intergenic
988950668 5:36256341-36256363 AGAGAAAAGCAGATGGAGAAAGG + Intronic
989984357 5:50679985-50680007 ATAGAGAAGCCGTTAGAAAAAGG + Intronic
991287438 5:64993571-64993593 ATAGAGAAAGAGGAGGAGAGTGG + Intronic
992132977 5:73713264-73713286 AGAGAGAAGACCTAGGAGAATGG - Intronic
992301750 5:75389160-75389182 ATAAAGGTGCAGTAAGAGAAGGG + Intronic
992754230 5:79889171-79889193 AAGGAGAAGCTGTAGCAGAATGG + Intergenic
992794122 5:80240270-80240292 GTTGAGAAGCAGTGGGAGGAAGG - Intronic
993630984 5:90285748-90285770 ATAGAAAACCAGTATGACAATGG + Intergenic
993748406 5:91631242-91631264 ATAGAGGAGGGGTAGGAGCAGGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995173036 5:109139453-109139475 AAGGAGAAGTAGCAGGAGAATGG - Intronic
995293891 5:110494994-110495016 CTATGAAAGCAGTAGGAGAATGG + Intronic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995603745 5:113827939-113827961 ATAGAGCAACACTTGGAGAATGG - Intergenic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
998191849 5:140031964-140031986 AAGGAGAAACATTAGGAGAAAGG + Intronic
998765100 5:145477838-145477860 AAAGAGAAGGAGGAGGAGAAAGG + Intronic
998994788 5:147859686-147859708 ACAGAATAGAAGTAGGAGAATGG - Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
1000670810 5:164060857-164060879 ATAGAGAACCAGAAGCAGATGGG - Intergenic
1000815027 5:165910076-165910098 ATTGAGAAGTAATAGGGGAAAGG + Intergenic
1000850429 5:166333294-166333316 AAAGAGAAGCAGCAGGAGCCAGG + Intergenic
1001150957 5:169226732-169226754 ATAGAGACAGAGTAAGAGAAGGG - Intronic
1001778444 5:174346868-174346890 ATAGAGAAGGAGGAAGAGCATGG - Intergenic
1002600320 5:180350821-180350843 TGAGAGAAGCAGCAGGATAAAGG + Intronic
1002797678 6:488028-488050 TTAGAGAAGCAGCAAGAAAAAGG + Intronic
1002824344 6:759513-759535 ATTGAAGAGCAGTAAGAGAAAGG - Intergenic
1002842458 6:917973-917995 ATAGAGTAGCAGTTGGAGGGAGG + Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1004280679 6:14276998-14277020 AAAGATGAGCAGGAGGAGAAGGG - Intergenic
1004431718 6:15551082-15551104 TTAGAGAAGCAGTAAGGGAGAGG - Intronic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004814437 6:19297565-19297587 AAAGAAACGCAGTAGGAAAAGGG + Intergenic
1005020118 6:21409834-21409856 ATAGGGAATCAATAGCAGAATGG - Intergenic
1005695798 6:28351622-28351644 AAAGGGAAGGAGGAGGAGAAGGG - Intronic
1006599069 6:35213901-35213923 AAAGAGGAGGAGGAGGAGAAAGG + Intergenic
1007723939 6:43902837-43902859 ACAGAGAAGGAGTAGGAAAGGGG + Intergenic
1008571441 6:52820970-52820992 ACAGGACAGCAGTAGGAGAATGG + Intergenic
1009271523 6:61621052-61621074 ATATAGAAGCAGTTCGAGAAAGG + Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010690451 6:78905426-78905448 ATAGAGAAGCAGTAATTGCATGG - Intronic
1010908006 6:81516842-81516864 ATAGAGAAGGAAAAGGAGAATGG + Intronic
1011083683 6:83515803-83515825 AAAGAGAAGTAGTAGTAGTAGGG - Intronic
1011187153 6:84690071-84690093 GTAGAGAAGGAATAAGAGAAGGG + Intronic
1011361628 6:86531700-86531722 AAAGAGAAGGAGGAGGAGAGAGG - Intergenic
1011534680 6:88363488-88363510 TGAGACAAGGAGTAGGAGAATGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1013918627 6:115371948-115371970 ACAGTGAAGCATTAGGGGAAAGG + Intergenic
1014472492 6:121833793-121833815 TCAGAGAAGTAGGAGGAGAATGG - Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015793979 6:136992304-136992326 ATAGAGAGGCAGGAGGAGCCTGG - Intergenic
1016354979 6:143208982-143209004 ATAGAGGACAAGCAGGAGAAAGG + Intronic
1016653723 6:146493678-146493700 ATAGAGTGGCATTGGGAGAAAGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017339618 6:153305375-153305397 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1018285267 6:162231128-162231150 AGAGAGAAGGAGAGGGAGAAAGG - Intronic
1018307922 6:162477788-162477810 TTAGAGATGCTGTAGGGGAAAGG - Intronic
1019201929 6:170324058-170324080 AGAGAGAAGGAGTAGGATACTGG + Intronic
1020571623 7:9870774-9870796 GGAGAGAAGCATCAGGAGAAAGG + Intergenic
1020731064 7:11881264-11881286 CCTCAGAAGCAGTAGGAGAATGG + Intergenic
1022052103 7:26686340-26686362 AGAGAGAAGGAGGAAGAGAAAGG + Intronic
1022988071 7:35679822-35679844 ATAGGGAAGAAGTAAGAGGAAGG - Intronic
1023215559 7:37858961-37858983 AGAGAGAAGGAGTGAGAGAAAGG - Intronic
1023321714 7:39005405-39005427 ACACAAAAGCAGTAGGAAAACGG + Intronic
1024086800 7:45900093-45900115 CCAAAGAAGCAGTAAGAGAAAGG - Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1026404871 7:70054909-70054931 AGAGATAAGGAGGAGGAGAAGGG - Intronic
1027453958 7:78364032-78364054 ATAGAGAAGAAGGAGGAGGGAGG - Intronic
1027970825 7:85078846-85078868 CTAGAGAGGAAGAAGGAGAAAGG + Intronic
1028089186 7:86676420-86676442 GTAGAAAAGCAGCAGGATAATGG + Intronic
1028246673 7:88487374-88487396 AAAGAGGAGGAGAAGGAGAAGGG + Intergenic
1028384419 7:90238622-90238644 GAAGTGAGGCAGTAGGAGAAGGG - Intergenic
1029422096 7:100477178-100477200 ATGGAGAAGGAGGAGGAGAGGGG + Intronic
1029530194 7:101120366-101120388 GAAGAGAAGGAGAAGGAGAAGGG + Intergenic
1030093729 7:105879017-105879039 ATAGGGAAGCAGAAGGGAAAGGG - Intronic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1030639728 7:111990692-111990714 AGTGAGAAGCAATAGAAGAATGG - Intronic
1031990751 7:128197436-128197458 ATAGTGAGGCAGAAGGAGAGGGG + Intergenic
1032404129 7:131643561-131643583 ATAGAGAACCAGTAGGGAGAGGG - Intergenic
1032523393 7:132562467-132562489 GAAGAGAAGGAGGAGGAGAAAGG - Intronic
1032523660 7:132563594-132563616 GAAGAGAAGGAGGAGGAGAAAGG - Intronic
1032716098 7:134510580-134510602 ACACACAAGCAGGAGGAGAAGGG - Intergenic
1032953147 7:136939137-136939159 ATGAGGAAGCAGTAGCAGAAGGG + Intronic
1033133645 7:138766925-138766947 ACAGATAAGCAGTGGGAAAAGGG - Intronic
1033250686 7:139755881-139755903 ATACAGAAGCAGTATCTGAAGGG - Intronic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1033890458 7:146006492-146006514 GAAGAGGAGCAGGAGGAGAAAGG - Intergenic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036995392 8:13649316-13649338 ATATGGAAGACGTAGGAGAAAGG + Intergenic
1037071102 8:14650223-14650245 ATGGATCAGGAGTAGGAGAAAGG + Intronic
1037218213 8:16484051-16484073 AAAGAGAAGGAGAAGAAGAAAGG + Intronic
1037571839 8:20164690-20164712 TCAGAGAAGCAGTCTGAGAAAGG - Intronic
1037745711 8:21642567-21642589 AGAGAAAAGCAGGAGGTGAAAGG + Intergenic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1038703159 8:29870194-29870216 GTAGCGAAACACTAGGAGAAGGG + Intergenic
1038794749 8:30699951-30699973 AAAGAGAAGCTGTAAGAGGAGGG + Intronic
1039392311 8:37191259-37191281 ATTGACAAGCAGCAGGACAAGGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041258855 8:56002659-56002681 AAAGAGAACCAGTAGAAAAATGG + Intronic
1042279121 8:67036109-67036131 ACAGTGAAGGAGTGGGAGAATGG + Intronic
1042701876 8:71624540-71624562 TCAGAGAAGCTGTAGGAGGAAGG - Intergenic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1044236331 8:89835014-89835036 ATACAGAATGAGGAGGAGAAAGG + Intergenic
1044390059 8:91639461-91639483 ATAGAAAAAGAGTAGGAGATGGG - Intergenic
1044392356 8:91666320-91666342 ATAGAGAATGAGTAGAAGGAGGG - Intergenic
1044758666 8:95493601-95493623 ATCGAGAAGAAAAAGGAGAAAGG + Intergenic
1044916035 8:97113305-97113327 AGAGAGCAGCAGCAGGAGAAGGG + Intronic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045688363 8:104735028-104735050 ATAGGGAAGCAGTAGAGGACTGG + Intronic
1046365594 8:113226794-113226816 ATAAGGAAGCAGTTGCAGAAAGG - Intronic
1046402669 8:113725786-113725808 ATAGAGAAGGAGCTGGATAAGGG + Intergenic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1047642205 8:126832830-126832852 AGAGAGCAGCAGTAAGAAAAGGG - Intergenic
1047727544 8:127696951-127696973 AGAGAAAAGAAGTAGAAGAAAGG + Intergenic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049101102 8:140579712-140579734 ATAGAGACTGAGAAGGAGAACGG + Intronic
1050272897 9:3965154-3965176 ATAGAAAAGAAGTAGGGTAAAGG - Intronic
1050358544 9:4805384-4805406 AAAAAGAAGAAGAAGGAGAAGGG + Intronic
1050652214 9:7787572-7787594 ATAGGGAAACAGTCGGGGAAGGG - Intergenic
1050831361 9:10018198-10018220 AGAGAGAAGGAGTAGGAGGAAGG + Intronic
1050839063 9:10123508-10123530 ATAGAGAATAATTAGGAGAGAGG - Intronic
1051751849 9:20350939-20350961 ATAGAGAAGCAGTTAAAGTAAGG - Intronic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052293350 9:26869895-26869917 ATAGAGAAAGAGTAGAAAAAAGG + Intronic
1052854493 9:33398630-33398652 GCAGAGAAGCTGTGGGAGAATGG + Intronic
1052976794 9:34417063-34417085 AAAAAGAAGAAGAAGGAGAAGGG - Intronic
1054763471 9:69023712-69023734 ATAGAGGAACAGAAGGAAAAAGG + Intergenic
1054936695 9:70695906-70695928 GCAGATAAGCAGTAGGAGAATGG - Intronic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056543723 9:87595760-87595782 AAAGAGATGCAGAAAGAGAAGGG - Intronic
1056662107 9:88551649-88551671 AGAGAGAAGCAACAGGGGAAGGG - Intronic
1056741856 9:89263516-89263538 ATACAGAAGAAGAAGAAGAAAGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057640067 9:96811023-96811045 ATACAGAAAAAGTAGGAGTAAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058674641 9:107389857-107389879 AGAGAGAAGAAGGAGGAGAGGGG - Intergenic
1058872320 9:109213280-109213302 ATACAGAAGGAGAAGGAGACAGG - Intronic
1058976344 9:110128371-110128393 AAAGAGAGGCAGGATGAGAAGGG + Intronic
1059085683 9:111300171-111300193 AGAGAGAAGGAGGAAGAGAATGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059954157 9:119498576-119498598 ATAGAGAGGCAGTACTAGAAGGG + Intronic
1059974015 9:119696743-119696765 AGAAAGAAGAAGTGGGAGAAGGG + Intergenic
1060762657 9:126268996-126269018 AAACAGACGCAGTAGGAGAAAGG - Intergenic
1062530475 9:136997325-136997347 AAAAAGAAGCAGCAGGAGAGGGG + Intergenic
1185681765 X:1894183-1894205 AGAGAGAAGCAGTAGGAGAGGGG - Intergenic
1186095834 X:6100897-6100919 ATTGAGAAGGATGAGGAGAAAGG - Intronic
1186117340 X:6318719-6318741 ATAGAGAAGCTGTGAAAGAAAGG - Intergenic
1186376122 X:9003497-9003519 GCAGAGAAGCAGAAGGAGACAGG + Intergenic
1186447035 X:9639685-9639707 TTAGAGGAGCCGGAGGAGAAAGG + Intronic
1186459959 X:9740075-9740097 AGAGGGCAGCAGTGGGAGAAGGG + Intronic
1186471161 X:9823081-9823103 AGGGAGAAGGAGGAGGAGAAGGG - Intronic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1187267941 X:17753910-17753932 ATAGAGAAATAATAGCAGAAAGG - Exonic
1189224413 X:39400664-39400686 AGAGAGAAAGAGAAGGAGAAGGG - Intergenic
1189241397 X:39527322-39527344 AGAGAGAAGCAGTTGGAGACTGG - Intergenic
1190454109 X:50608839-50608861 CTAGAGAGGCAATAGGGGAATGG - Intronic
1191019124 X:55841523-55841545 CTAGAGAGGCAGTGGTAGAAGGG + Intergenic
1192353157 X:70373289-70373311 ACAGAGAAGGAGGGGGAGAACGG + Intronic
1193792705 X:85835086-85835108 ATAGAGAAGAAGAAGCAAAAAGG - Intergenic
1193803236 X:85962756-85962778 ATAGAAAATCAGTAAGATAAAGG - Intronic
1194143022 X:90228621-90228643 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1194182617 X:90732794-90732816 ATAGACATGCAGAGGGAGAATGG - Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1194700687 X:97110223-97110245 ATAGAGAAAAAAAAGGAGAAAGG - Intronic
1195644516 X:107213727-107213749 ATAGTTAAGAAATAGGAGAATGG - Intronic
1196936741 X:120737813-120737835 AAAGAGAAGCAAAAGGTGAAGGG + Intergenic
1197213758 X:123849219-123849241 TTAGTGAAGCAGTAGGGCAAGGG - Intergenic
1197300557 X:124774918-124774940 ATGGAGAGGGAGCAGGAGAAGGG - Intronic
1197705050 X:129628921-129628943 AGAGAGCAGGAGTAGGAGGATGG + Intergenic
1197792502 X:130269697-130269719 TCAGAGAAGGAGGAGGAGAAAGG - Intergenic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198218004 X:134574409-134574431 CTAGAGAAGGAGTGGGGGAAGGG - Intronic
1199125877 X:144119457-144119479 ATAGAGAAGTAGTGTGGGAAAGG - Intergenic
1200316797 X:155141967-155141989 ATAGAGAAAAAGGAGAAGAAAGG - Intronic
1200488775 Y:3797940-3797962 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1200529242 Y:4314747-4314769 ATAGACATGCAGAGGGAGAATGG - Intergenic
1200971021 Y:9152524-9152546 ATAAATAAGCTATAGGAGAAAGG - Intergenic
1201453001 Y:14136300-14136322 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1201474280 Y:14364074-14364096 AAAGAGAAGGAGGAGAAGAAAGG + Intergenic
1201502842 Y:14664015-14664037 ATTGAGAAGGATGAGGAGAAAGG + Intronic
1201739707 Y:17310945-17310967 GAAGAGAAGGAGGAGGAGAAGGG - Intergenic
1201972427 Y:19812208-19812230 TTGGAGTTGCAGTAGGAGAAGGG + Intergenic