ID: 1042893751

View in Genome Browser
Species Human (GRCh38)
Location 8:73642880-73642902
Sequence CAGTGTGGCTGGAGTGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042893745_1042893751 20 Left 1042893745 8:73642837-73642859 CCTCTAAAATGGGAGTATACCTG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG No data
1042893747_1042893751 1 Left 1042893747 8:73642856-73642878 CCTGACTTGTTTGGAAACTGCAG 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042893751 Original CRISPR CAGTGTGGCTGGAGTGAAGT TGG Intronic
No off target data available for this crispr