ID: 1042894994

View in Genome Browser
Species Human (GRCh38)
Location 8:73656893-73656915
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042894992_1042894994 29 Left 1042894992 8:73656841-73656863 CCAAATATACACTACATACAAGA 0: 1
1: 0
2: 3
3: 34
4: 391
Right 1042894994 8:73656893-73656915 TTGTACTAGCTTAATGAAAACGG No data
1042894991_1042894994 30 Left 1042894991 8:73656840-73656862 CCCAAATATACACTACATACAAG 0: 1
1: 0
2: 1
3: 26
4: 385
Right 1042894994 8:73656893-73656915 TTGTACTAGCTTAATGAAAACGG No data
1042894993_1042894994 2 Left 1042894993 8:73656868-73656890 CCAAAAACAGAGAAAAGCTAAAA 0: 1
1: 0
2: 6
3: 118
4: 1402
Right 1042894994 8:73656893-73656915 TTGTACTAGCTTAATGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr