ID: 1042897029

View in Genome Browser
Species Human (GRCh38)
Location 8:73681702-73681724
Sequence GAAAACAGCAGATACTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1478
Summary {0: 10, 1: 130, 2: 297, 3: 433, 4: 608}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042897029_1042897036 25 Left 1042897029 8:73681702-73681724 CCAACCAAGTATCTGCTGTTTTC 0: 10
1: 130
2: 297
3: 433
4: 608
Right 1042897036 8:73681750-73681772 CTCACATAAACTGAAGGTAAAGG 0: 4
1: 327
2: 470
3: 415
4: 820
1042897029_1042897035 19 Left 1042897029 8:73681702-73681724 CCAACCAAGTATCTGCTGTTTTC 0: 10
1: 130
2: 297
3: 433
4: 608
Right 1042897035 8:73681744-73681766 TAAGGACTCACATAAACTGAAGG 0: 4
1: 293
2: 418
3: 321
4: 406
1042897029_1042897037 26 Left 1042897029 8:73681702-73681724 CCAACCAAGTATCTGCTGTTTTC 0: 10
1: 130
2: 297
3: 433
4: 608
Right 1042897037 8:73681751-73681773 TCACATAAACTGAAGGTAAAGGG 0: 5
1: 338
2: 491
3: 463
4: 993
1042897029_1042897038 27 Left 1042897029 8:73681702-73681724 CCAACCAAGTATCTGCTGTTTTC 0: 10
1: 130
2: 297
3: 433
4: 608
Right 1042897038 8:73681752-73681774 CACATAAACTGAAGGTAAAGGGG 0: 5
1: 279
2: 453
3: 421
4: 541
1042897029_1042897033 1 Left 1042897029 8:73681702-73681724 CCAACCAAGTATCTGCTGTTTTC 0: 10
1: 130
2: 297
3: 433
4: 608
Right 1042897033 8:73681726-73681748 AGGGACTCACCTAACACATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042897029 Original CRISPR GAAAACAGCAGATACTTGGT TGG (reversed) Intronic
900699539 1:4036191-4036213 GAAGACAGCAGAAAATTGGCTGG - Intergenic
902969386 1:20035633-20035655 GAAGACAGCAGATACTTGATTGG + Intronic
904297386 1:29528967-29528989 GAAAACAGCAGAGACTTTCTAGG + Intergenic
904572308 1:31475733-31475755 GAAGGCAGCAGATAGTTGGCTGG + Intergenic
905235186 1:36541703-36541725 GAAGACAGCAAATACTTGAATGG + Intergenic
905497604 1:38405489-38405511 GAAGGCAGCAGATACTTGGTTGG - Intergenic
905597811 1:39223634-39223656 TAAAATACCAGCTACTTGGTTGG - Intronic
906053776 1:42898189-42898211 GAAGGCAGCAGATAATTAGTCGG + Intergenic
906594699 1:47064775-47064797 GAAGACAGCAGAAATTTGGTTGG - Intergenic
906876982 1:49550192-49550214 GAAGGCAGCAGATAGTTGATTGG + Intronic
906914841 1:49997282-49997304 GAAGACAGCAGATACTTGGTTGG - Intronic
907001417 1:50862620-50862642 GAAGACAGCAGATATTTGGTTGG - Intronic
907666691 1:56439256-56439278 GTGCACAGCAGATACTGGGTAGG + Intergenic
907887204 1:58604163-58604185 GAAGACAGTGGATACTTGGTTGG + Intergenic
908139006 1:61163715-61163737 CAAAACAGAAAATACTTTGTTGG + Intronic
908294433 1:62699074-62699096 TAAAACAGCAAATACTAGGCTGG - Intergenic
908298757 1:62739999-62740021 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
908301273 1:62762655-62762677 GGACACAGCAGCTACTTGGGAGG + Intergenic
908803449 1:67905046-67905068 GAACACAGCAGATACTTGGTTGG + Intergenic
908890601 1:68843406-68843428 TGAAGCAGCAGATACTTGGTTGG + Intergenic
908981978 1:69969357-69969379 GAAGGCAGCACATAGTTGGTTGG - Intronic
909073925 1:71030016-71030038 CAAAACAGCAGATGCTTTGTAGG + Intronic
909235063 1:73142550-73142572 GAAGACAACAGATACTTGGTTGG + Intergenic
909623474 1:77690413-77690435 GTAAACAGCATATCCTAGGTAGG + Intergenic
909694113 1:78445885-78445907 GAAAAGAACAGATATTTGTTAGG + Intronic
909790957 1:79678043-79678065 GAAGATAGCAGAAACTAGGTTGG + Intergenic
909860264 1:80595919-80595941 GAAGACAACAGATACTTGGTTGG - Intergenic
910077797 1:83300780-83300802 GAAAGTAGCAGATAGTTGGTTGG - Intergenic
910232911 1:85004973-85004995 GAAGACAGCAGATACTTGGTTGG - Intronic
910919394 1:92327568-92327590 TTGAAAAGCAGATACTTGGTTGG + Intronic
911080906 1:93929452-93929474 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
911679102 1:100693502-100693524 GAAGACAGCAAATACTTGGTTGG + Intergenic
911743455 1:101412824-101412846 GAAGACAGCAGATACTTGGTTGG - Intergenic
911806003 1:102209345-102209367 GAAGACAGCAGAAACTTGGTTGG + Intergenic
912121388 1:106476152-106476174 GAAGACAGCAGATTTTTGGTTGG - Intergenic
912180914 1:107218366-107218388 GAAGACAGCAGATACTTGTTTGG + Intronic
912612265 1:111060270-111060292 GAAGACAGCAGATACTTACTTGG + Intergenic
912615959 1:111100355-111100377 GAAGGCAGCAGATGGTTGGTTGG + Intergenic
913236372 1:116787132-116787154 GAAGACAGCAGATACATGGCTGG - Intergenic
913339547 1:117745248-117745270 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
913350402 1:117851871-117851893 GAAAACAACAGATGCTTTATAGG + Intergenic
913368904 1:118074435-118074457 GAAAAAAGAAGATACTTAGAAGG - Intronic
913463936 1:119119152-119119174 GAAGACACTAGATACTTGGTTGG - Intronic
913493704 1:119406958-119406980 GAAGGCAGCAGATACTTGGCTGG - Intergenic
913588014 1:120295333-120295355 AAAGGCAGCAGATAGTTGGTCGG + Intergenic
913620171 1:120603036-120603058 AAAGGCAGCAGATAGTTGGTCGG - Intergenic
913972859 1:143428777-143428799 GAAGGCAGCAGATAGTTAGTTGG + Intergenic
914067243 1:144254385-144254407 GAAGGCAGCAGATAGTTAGTTGG + Intergenic
914111910 1:144711969-144711991 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
914346256 1:146801234-146801256 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
914570030 1:148907206-148907228 AAAGGCAGCAGATAGTTGGTCGG + Intronic
914602799 1:149223063-149223085 AAAGGCAGCAGATAGTTGGTCGG - Intergenic
914968159 1:152279773-152279795 GAAGGCTGCAGATAGTTGGTTGG - Intergenic
915999750 1:160604112-160604134 AAAGACAGCAGATACTTGGTTGG + Intergenic
916331510 1:163623056-163623078 GAGGACAGCAGATACCTGGTTGG + Intergenic
916580119 1:166099498-166099520 GAAGGCAGCAGATAGTTAGTTGG - Intronic
917057706 1:171002155-171002177 GAAGGCAGCAGATAGTTGGTTGG + Intronic
917096852 1:171406917-171406939 GAAGGCAGCTGATTCTTGGTTGG - Intergenic
917351394 1:174081844-174081866 GAAGACAGCAGACACTTGATTGG - Intergenic
917439865 1:175058020-175058042 GGAAACAGCAGATACTGGAGAGG + Intergenic
917746725 1:178016641-178016663 GAAGATAGCAAATATTTGGTTGG + Intergenic
917913463 1:179676266-179676288 GAAGGCAGCAGAAACTTGGTTGG + Intronic
918158548 1:181874508-181874530 GAAGACAGCAGATAGTTGGTTGG - Intergenic
918718467 1:187822308-187822330 GAAGACAGAAGATCCTTGGTTGG + Intergenic
918775791 1:188628471-188628493 GAAAACAACAGATACTGGAGAGG + Intergenic
918819565 1:189235315-189235337 GAAGACAGCAGAAACTTGGCTGG + Intergenic
918873671 1:190010117-190010139 GAAGGCAGCAGAGAGTTGGTTGG - Intergenic
918972313 1:191435146-191435168 GAAGACAGCAGATATTTGGTTGG - Intergenic
919214295 1:194532741-194532763 GAAGACAGCAGATACTTGGTTGG + Intergenic
919397773 1:197071839-197071861 AAAGGCAGCAGATAGTTGGTTGG - Intergenic
919407839 1:197207127-197207149 GAAGACAGCAAACACTTGGTTGG + Intergenic
919485491 1:198141489-198141511 GAAGACAGCAGATACTCGGTTGG + Intergenic
919520320 1:198580574-198580596 GAAGACAGCAGAAACTCGATTGG + Intergenic
919571732 1:199257276-199257298 GAAGGCAGGGGATACTTGGTTGG + Intergenic
920083672 1:203397627-203397649 TAAAACAGCAGTTACTGGGGTGG - Intergenic
920800121 1:209178831-209178853 GAAGACAGCAGAAACTTGGTTGG - Intergenic
920990009 1:210927786-210927808 GAAGACATCAGAAACTTGGTTGG - Intronic
921532700 1:216305425-216305447 GAGGACAGCAGATACTTGCTTGG + Intronic
921690394 1:218141936-218141958 GAAGAGAGCAGATACTTGGTTGG - Intergenic
921762708 1:218935499-218935521 GAAGACATCAGATACTTGGTTGG + Intergenic
921999982 1:221467255-221467277 GAAGATAGCAGATACTTGGTTGG + Intergenic
922673193 1:227530599-227530621 GAAGGCAGCAAATAGTTGGTTGG + Intergenic
922927171 1:229359328-229359350 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
923122445 1:231004713-231004735 GAAGACAGCAGATACTTGGTTGG - Intergenic
923174361 1:231448836-231448858 GAAGACAGCAGGTACTTGGTTGG - Intergenic
923495892 1:234524222-234524244 GAAAACAGAAGACATTAGGTGGG + Intergenic
923547270 1:234931982-234932004 GAAAATAGCAGAAACATGGCTGG + Intergenic
923550592 1:234959986-234960008 GAACATAGCATACACTTGGTGGG - Intergenic
923838930 1:237646171-237646193 GAAAAAAGCAGAGATTTGGCCGG - Intronic
923909961 1:238430638-238430660 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
924321219 1:242853051-242853073 GAAGGCAGCAGATAGTTGATTGG + Intergenic
924691730 1:246358041-246358063 GAAGACAGCAGAAATTTAGTTGG - Intronic
924804532 1:247351926-247351948 GAAAACTGCAAATGCTTTGTTGG - Intergenic
924829777 1:247581204-247581226 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1062761000 10:19016-19038 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
1063561107 10:7128738-7128760 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1063607969 10:7539635-7539657 GAGAAGAGCAGATAGATGGTGGG + Intergenic
1064557029 10:16557632-16557654 GAAGACAGCAGATACTTGGTTGG + Intergenic
1065089488 10:22217638-22217660 GACAAAAGCAGATACTACGTTGG + Intergenic
1065418358 10:25514429-25514451 GAAGACAGCAGTTACTTGGTTGG + Intronic
1065462577 10:25984339-25984361 GAAGACAACAGAAACTTGGTTGG - Intronic
1066322434 10:34317558-34317580 CAAAACAGCAGCTTCCTGGTGGG + Intronic
1066338730 10:34507562-34507584 CAAAAAAGGAGATACTTTGTGGG + Intronic
1066619383 10:37328122-37328144 GAAGACAGCAGATATGTGGTTGG - Intronic
1066651069 10:37655658-37655680 GAAGACAGCAGATACTTGACTGG - Intergenic
1066747279 10:38613511-38613533 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
1067234022 10:44432969-44432991 GAAGACAGCAGATACTTGGTTGG + Intergenic
1068122658 10:52799573-52799595 GAAGACAGCAGATACGTGATTGG + Intergenic
1068161827 10:53274154-53274176 GAAGGCAGCAGATACTTGGTTGG - Intergenic
1068172933 10:53419897-53419919 GAAGGCAGCAGATACTTGGTTGG + Intergenic
1068183984 10:53561920-53561942 GAAGACAGGAGATACTTGATTGG - Intergenic
1068808699 10:61229941-61229963 GAAGACAAAAGACACTTGGTTGG - Intergenic
1068924834 10:62525273-62525295 GAAGACAGCAGATACTTAGTTGG + Intronic
1069113078 10:64470367-64470389 GAAGACAGCAGATAGTTGGTTGG - Intergenic
1069146190 10:64894671-64894693 GAAGAGATCAGATACTTGGTTGG + Intergenic
1069199923 10:65600564-65600586 AAAGACAGCAGATACGTGGTTGG + Intergenic
1069325477 10:67226967-67226989 GAAGGCAGCAGATGGTTGGTTGG - Intronic
1069648313 10:70021457-70021479 GAAGACAGTAGATACTTGGGTGG - Intergenic
1070049286 10:72871218-72871240 GAAAACTGCAGATACTATTTAGG + Intronic
1070190233 10:74105504-74105526 GATAACTGCAGAGACTTGGATGG - Intronic
1070407014 10:76106041-76106063 TAAAACAGCACAAACTTGGCTGG - Intronic
1070620037 10:78002316-78002338 GAGAAAAGGAGATCCTTGGTGGG + Intronic
1071015690 10:80994993-80995015 GAAGACAGCAGATACTTGGTTGG + Intergenic
1071045783 10:81374740-81374762 GAATACAGCAGATACTTGGTTGG + Intergenic
1071058406 10:81539335-81539357 GAAAACAGCAGACACTTGGTTGG + Intergenic
1071062741 10:81592086-81592108 GAAGGCAGCAGATACTTGGTGGG - Intergenic
1071761476 10:88612456-88612478 GAAGACAGGAGAAATTTGGTTGG - Intergenic
1072164031 10:92794482-92794504 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1072381579 10:94877809-94877831 GAAGACAGTAGAAACTTGGTTGG + Intergenic
1072871909 10:99128874-99128896 GAAGACAGCAGATACTTGGTTGG - Intronic
1072885526 10:99269178-99269200 GAAGACAGCAGATACTCGATTGG - Intergenic
1072928214 10:99635696-99635718 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1073570512 10:104577126-104577148 GCACACAGCAGATATTCGGTAGG + Intergenic
1073923455 10:108485593-108485615 GAAGACACCAGAAACATGGTTGG + Intergenic
1074037189 10:109752095-109752117 GAAGACACCAGATACTTGGCTGG + Intergenic
1075157953 10:119995645-119995667 GAAGGCAGCAGATACTTGGTTGG + Intergenic
1076376112 10:129986518-129986540 GAAGACAGCAGATACTTGGTTGG - Intergenic
1076665406 10:132086773-132086795 GAAAGCAGCAGATACTTGGTTGG + Intergenic
1077834052 11:5908499-5908521 AAAGACAGCAGAGACTTGGTTGG + Intronic
1078186135 11:9053471-9053493 AAAAACAGGAGATACTTTGCCGG - Intronic
1078288788 11:9985178-9985200 GAAGGCAGCAGATAGTTGATTGG - Intronic
1078706771 11:13751231-13751253 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1078991381 11:16649860-16649882 GAAGACAGCAGGTACTTGATTGG - Intronic
1079248226 11:18768981-18769003 GACAACAGCAGCCACTTGCTGGG + Intronic
1079255766 11:18828331-18828353 GAAGGCAGCAGATACTTGATTGG + Intergenic
1079463994 11:20711294-20711316 TCAAACAGTGGATACTTGGTTGG + Intronic
1079523802 11:21360871-21360893 GAAGACAGCAGATACTTGTTTGG + Intronic
1079535413 11:21508983-21509005 GAAAACAGAAGCTACATGATTGG + Intronic
1079766705 11:24402930-24402952 AAAAACAGCAGATACTCGTATGG - Intergenic
1079805843 11:24930144-24930166 GAAGATAGTAGATACTTGGTTGG + Intronic
1079819701 11:25109938-25109960 GAAAACAGCAGATGCTGGTGAGG - Intergenic
1079956295 11:26869574-26869596 GAAAACAGCAGATACTTGGTTGG - Intergenic
1080152837 11:29074493-29074515 GAAGGCAGCAGACAGTTGGTTGG + Intergenic
1080488984 11:32742303-32742325 GAAAACAGCAGATGCTGGAGAGG - Intronic
1080519897 11:33059727-33059749 GAAAACAGCAGTCTCTGGGTTGG + Intronic
1080585682 11:33680760-33680782 GAAGGCAGCAGGTACTTGGTTGG + Intergenic
1080672353 11:34392966-34392988 GAAGGCAGCAGATTATTGGTTGG + Intergenic
1080838995 11:35967065-35967087 GAAAACACCAAATGCCTGGTAGG - Intronic
1080923561 11:36732887-36732909 AAAGACAGCAGATACTTGGTTGG - Intergenic
1080992651 11:37558069-37558091 GAAAACACAATGTACTTGGTTGG - Intergenic
1081090898 11:38865330-38865352 GAAGATGGCAGAAACTTGGTTGG + Intergenic
1081195441 11:40154439-40154461 GAAGGTAGCAGATAGTTGGTTGG - Intronic
1081326498 11:41752152-41752174 GAAGACAGCAGAAATTTAGTTGG + Intergenic
1081616143 11:44592465-44592487 AAACACAGCAGATCCGTGGTAGG + Intronic
1083005599 11:59342795-59342817 GAAGACCTCAGAAACTTGGTTGG + Intergenic
1083127025 11:60580078-60580100 GAAGGCAGCAGATACTTGGTTGG - Intergenic
1083537444 11:63482837-63482859 AGAGACAGCAGATACTTGGTTGG - Intronic
1084509846 11:69596779-69596801 GGAAACAACAGACACTTTGTTGG + Intergenic
1085240340 11:75048359-75048381 GAAGACAGTAGAAACTTGATTGG + Intergenic
1085526927 11:77169580-77169602 GAAAACAGCAAATACCAGGAAGG + Intronic
1085917350 11:80905230-80905252 GAAGGCAGCAGATAGTTGGCTGG - Intergenic
1085921014 11:80957214-80957236 GAAGATAACTGATACTTGGTGGG + Intergenic
1086297790 11:85390080-85390102 GAAGACAGCAGATACTTGGTTGG - Intronic
1086315502 11:85587608-85587630 GAAGAGAGCAGATACTTGGTGGG + Intronic
1086535623 11:87841528-87841550 GATACCAGCAGATAAGTGGTAGG - Intergenic
1086650895 11:89288645-89288667 AGCAACAGCAGATACTTGGGAGG + Intronic
1086844608 11:91732870-91732892 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1086864391 11:91961841-91961863 GAAGATAGCAGATACTTGGTTGG - Intergenic
1086869183 11:92016382-92016404 GAAGACAGTAGATACTTGGTTGG + Intergenic
1086997712 11:93377529-93377551 GAAGACAGCAGGTACTTGGTTGG + Intronic
1087395480 11:97591273-97591295 GGAGACAGCAAATACTTGGTTGG - Intergenic
1087602249 11:100331058-100331080 GAGGACAGCAGAAACTTAGTTGG - Intronic
1087610152 11:100424448-100424470 GAAGACAGCAGACACTTGGTTGG - Intergenic
1087616111 11:100488500-100488522 GAAGGCAGCAGATATTTGGTTGG - Intergenic
1087631033 11:100650386-100650408 GAAGACAGCAGATACTTGATTGG - Intergenic
1087688755 11:101295734-101295756 GAAGGCAGCAGGTAGTTGGTTGG + Intergenic
1087804510 11:102541083-102541105 GAAGACAGCAGAAATTTGGTTGG - Intergenic
1087817377 11:102674420-102674442 GAAGACAGCAGAAACTTGATTGG + Intergenic
1087866019 11:103228099-103228121 TTAGACAGCAGAAACTTGGTTGG + Intronic
1087907882 11:103720644-103720666 GAAGACAGCATATACTTGGTTGG - Intergenic
1088124495 11:106407485-106407507 GAAAACAGCAGAAAATCTGTGGG - Intergenic
1088137520 11:106576206-106576228 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1088179653 11:107094524-107094546 GAAGGTAGCAGATAGTTGGTTGG - Intergenic
1088387267 11:109273548-109273570 AAAGGCAGCAGATACTTGGTTGG + Intergenic
1088413322 11:109561032-109561054 GAAGTCACCAGATATTTGGTTGG + Intergenic
1088413603 11:109565262-109565284 GAAGACAGCAGATACTTGCTTGG + Intergenic
1088525791 11:110752740-110752762 GAAGACAGCAGATTCTTGGTTGG + Intergenic
1088580724 11:111313286-111313308 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1088800267 11:113299208-113299230 GAAGACAGCAGATATGTGGTTGG - Intergenic
1088951340 11:114573435-114573457 GAAGACAGCAGAAACTTGGCTGG - Intronic
1089107575 11:116025869-116025891 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1089837144 11:121380946-121380968 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1089952706 11:122544881-122544903 GAAGGCAGCAGAAAGTTGGTTGG + Intergenic
1090545437 11:127761289-127761311 GAAGATAGCAGATACTTGGTTGG - Intergenic
1090559300 11:127913427-127913449 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1090578051 11:128130289-128130311 GAAAACAGCAGGTAGGTGGCAGG + Intergenic
1090682867 11:129079829-129079851 GAAGACAGCAGATACTTGGTTGG - Intronic
1090688417 11:129150955-129150977 GAAGACAGCAAATAATCGGTTGG - Intronic
1090756897 11:129799997-129800019 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1090820271 11:130336021-130336043 GGAAACTGCAAATACTTTGTTGG - Intergenic
1090894821 11:130962620-130962642 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1091302365 11:134515629-134515651 GAAATAACCAGACACTTGGTGGG + Intergenic
1091353294 11:134914739-134914761 GACAACAGCCGATACTTGCTCGG - Intergenic
1091380975 12:59145-59167 GAAGACAGCAGATACTTGGTTGG - Intergenic
1091467144 12:694617-694639 GAGAACAGCAAATACTTTCTTGG - Intergenic
1092060244 12:5544705-5544727 GAAGACAGCAAATACTTGGTTGG - Intronic
1092303702 12:7277963-7277985 GAAGGCAGCAGATAGTTGGGTGG + Intergenic
1092602858 12:10085372-10085394 GAAGACAGCAGATACTTGATTGG - Intronic
1092700175 12:11219796-11219818 GAAGGCAGCAGATAATTGATTGG - Intergenic
1093001843 12:14006010-14006032 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1093135965 12:15451060-15451082 GAAGGCAGCAGATACTTGGTTGG - Intronic
1093277747 12:17150558-17150580 GAAGACAGCAGATACTTGGTTGG - Intergenic
1093290917 12:17320934-17320956 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1093409024 12:18843152-18843174 GAATGCAACAGATAGTTGGTTGG + Intergenic
1093468862 12:19479891-19479913 GAAGACAGCAGATACTTGGTTGG + Intronic
1093488518 12:19679552-19679574 GCAGGCAGCAGATAGTTGGTTGG + Intronic
1093608387 12:21123123-21123145 GAAGATAGCAGATGCTTGATTGG - Intronic
1093951723 12:25169904-25169926 GAAGGCAGCAGATAGTTGATTGG - Intronic
1093963946 12:25305259-25305281 GAAGACAGCGGAGACTTGGTTGG - Intergenic
1093991622 12:25594807-25594829 GAAGGCAGCAGATAGTTGTTTGG - Intronic
1093995155 12:25632896-25632918 GAAGGCAACAGATAGTTGGTTGG - Intronic
1094121234 12:26976913-26976935 GGGAAGAGCAGATAGTTGGTTGG - Intronic
1094297377 12:28922932-28922954 GAAGACAGTAGAAACTTGGTTGG - Intergenic
1094447170 12:30544416-30544438 AAAGGCAGCAGATAGTTGGTTGG + Intergenic
1094473820 12:30826171-30826193 TAAAACAGCAAATACTGGTTTGG - Intergenic
1094501506 12:31025114-31025136 GAAGGCAGCAGGTAGTTGGTTGG - Intergenic
1094808739 12:34116735-34116757 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
1095121034 12:38419349-38419371 GAAGATAGCAGAGACTTGATTGG - Intergenic
1095176511 12:39097994-39098016 AAAGACAGCAGATACTTGGTTGG - Intergenic
1095500857 12:42837324-42837346 GAAGACAGAAGATAGTTGGTTGG + Intergenic
1095665366 12:44790740-44790762 GAAGGCAGCAGAGAGTTGGTTGG - Intronic
1095725585 12:45448271-45448293 GAAGACAGCAGATACTTGGTTGG - Intergenic
1096348080 12:50868222-50868244 GAAGGCAGCAGATAGTTGGTTGG - Intronic
1096419996 12:51448906-51448928 GGAAACAGCAGAAGCTTGGGTGG + Intronic
1096730314 12:53606045-53606067 GACAAAAGCATAGACTTGGTTGG - Intronic
1096888398 12:54741893-54741915 CAAGGCAGCAGATAGTTGGTTGG + Intergenic
1097035157 12:56119057-56119079 GAAAAAAACAGAGACTTGGGTGG - Intronic
1097295693 12:57959990-57960012 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1097537191 12:60887419-60887441 GAAGACAGCTGATACTTGGTTGG + Intergenic
1097547716 12:61024820-61024842 GAAGGCAGCAGATACTTGGTTGG + Intergenic
1097603836 12:61728642-61728664 GAAGACAGCAGATACTTGGTTGG + Intronic
1097607313 12:61770971-61770993 GAAGACTGCAGATACTTGGTTGG - Intronic
1097906784 12:64928593-64928615 GAAAATAGCAGATACTTGGTTGG + Intergenic
1098211943 12:68175709-68175731 GCAAAGAGCAGTAACTTGGTGGG + Intergenic
1098518808 12:71411433-71411455 GAAGACAGGAGATACTTGGTGGG - Intronic
1098786265 12:74760292-74760314 GAAGACAGTAGATACTTGGTTGG + Intergenic
1098852434 12:75612833-75612855 GAAGACAGCAGATACTTGGTTGG - Intergenic
1098960679 12:76737067-76737089 GAAGGCAGCAGATGGTTGGTTGG + Intergenic
1098982487 12:76972466-76972488 GAAAGCAGCAGATAGTCTGTTGG + Intergenic
1099000578 12:77174034-77174056 GGAAACAGCAGATACTGGAGAGG - Intergenic
1099382535 12:81972605-81972627 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1099392229 12:82096041-82096063 GAAGACAGCAAATACTTGGTTGG + Intergenic
1099451786 12:82816633-82816655 AAAAACAGCAGGTTTTTGGTGGG - Intronic
1099476967 12:83120046-83120068 GAAGACAGCAGATAGTTGGCTGG + Intronic
1099777238 12:87149556-87149578 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1100024888 12:90115975-90115997 CAAAACAACAGATACTGGTTAGG - Intergenic
1100087952 12:90934814-90934836 GAAGGCAACAGATAGTTGGTGGG + Intronic
1100203397 12:92323638-92323660 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1100662282 12:96713030-96713052 GAAAACAGCAGATGCTGGTGAGG + Intronic
1100697053 12:97106214-97106236 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1101281123 12:103256775-103256797 TAAAACAGAAGATTCTTGGTTGG + Intronic
1101290578 12:103363572-103363594 GAAGGCAGCAGATACTTGGTTGG - Intronic
1101409144 12:104455074-104455096 GAAAACAGCAAAGACTTCTTGGG + Intergenic
1102916535 12:116758234-116758256 GAAGGCAGCAGATGGTTGGTTGG + Intronic
1103682398 12:122704822-122704844 GAAAATATCACATACTTAGTGGG - Intergenic
1104120939 12:125799443-125799465 GCACTCAGCACATACTTGGTGGG + Intergenic
1104524479 12:129505937-129505959 GAAGGCAGCAGATAGTTGGTTGG + Intronic
1105314682 13:19246452-19246474 GAAGGCAGCAAATAGTTGGTTGG - Intergenic
1105930949 13:25051279-25051301 GAAGGCAGCAGGTAGTTGGTTGG - Intergenic
1105990206 13:25613037-25613059 AAAGACAGCAGATACTTGGTTGG + Intronic
1106060159 13:26282791-26282813 GAAGACAGCAGATACTTAGTTGG - Intronic
1106325785 13:28688005-28688027 GAAGACATCAAATATTTGGTTGG + Intergenic
1106378069 13:29209338-29209360 GAAGAGAGCAGATACTCGGTTGG + Intronic
1106424739 13:29615782-29615804 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1106894430 13:34283288-34283310 AAAGACAGCAGATACTTGGTTGG + Intergenic
1106977960 13:35245210-35245232 AAAGGCAGCAGATACTTGTTTGG + Intronic
1107185022 13:37507608-37507630 GAAGGCAGCAGTTAGTTGGTTGG - Intergenic
1107253127 13:38390318-38390340 GAAGACAGCAGATACTTGGTTGG + Intergenic
1107256478 13:38433533-38433555 GAAAACAACAGATGCTGGGGAGG - Intergenic
1107361389 13:39621155-39621177 GAAGACAACAGATACTTGGTTGG - Intergenic
1107510551 13:41079566-41079588 GAAAACAACAGATACTGGCAAGG + Intronic
1108017522 13:46091647-46091669 TTAAAAAGCAGACACTTGGTTGG + Intronic
1108134535 13:47340999-47341021 GAAGAAAGCAGATACTTGGTTGG - Intergenic
1108298540 13:49051061-49051083 GAAGACAGCAGAAACTTGGTTGG + Intronic
1108902264 13:55426055-55426077 GAAGACAGCAGTTACTTGGTTGG - Intergenic
1109058136 13:57579266-57579288 GAAGACAGCAGATACTTGGTTGG + Intergenic
1109201162 13:59433093-59433115 GAAGACAGCAGATACTTGGTTGG + Intergenic
1109213390 13:59561284-59561306 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1109484742 13:63003781-63003803 GAAGATAGCAGATATTTGGTTGG - Intergenic
1109822445 13:67675686-67675708 GAAGTCAGCAGATAGTTGGTTGG + Intergenic
1109824409 13:67698689-67698711 GAAGACAGCAGATACTTGCTTGG - Intergenic
1109975827 13:69830174-69830196 GAAGATAGCAGATACTTGGTTGG - Intronic
1110340742 13:74387157-74387179 GAAGACAGCAGAAAATTGATTGG + Intergenic
1110504909 13:76273982-76274004 GAAGACAGCAGATACTTGGTTGG - Intergenic
1110748259 13:79081300-79081322 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1110755929 13:79173873-79173895 GAAGACAGCAGATCATTGGTTGG - Intergenic
1110881740 13:80579900-80579922 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
1111283213 13:86053771-86053793 GAAGATAGTAGATACTTGATTGG - Intergenic
1111472610 13:88704424-88704446 GAAAACAGCTGATGATTGCTGGG - Intergenic
1111661367 13:91216467-91216489 GAAAACAACAGTTGCTAGGTTGG + Intergenic
1112747503 13:102543302-102543324 AAAGGCAGCAGATAGTTGGTTGG - Intergenic
1113240483 13:108331051-108331073 GAAGACAGCGGATACTTGGTTGG - Intergenic
1113269757 13:108660689-108660711 GAAGGCAGCAGATAGCTGGTTGG + Intronic
1113534847 13:111057735-111057757 GAAGACAGCAGATACTTGGTTGG + Intergenic
1113637966 13:111934752-111934774 GAAGACTGCAGATAGTTGGCTGG + Intergenic
1113823584 13:113232686-113232708 GAAAGCAGCAAACATTTGGTAGG + Intronic
1114030603 14:18576269-18576291 GAAGGCAGCAGATAGTTAGTTGG + Intergenic
1114337135 14:21701710-21701732 GAAGACAGTAGATACTTGGCTGG - Intergenic
1114391604 14:22314810-22314832 GAAAACAGCAAAAACTTCGGAGG + Intergenic
1114691989 14:24592187-24592209 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1114756498 14:25266184-25266206 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1115262724 14:31470203-31470225 CCAAACAGCAGATACTAGCTGGG - Intergenic
1115299453 14:31867396-31867418 GAAGGCAGCAGATGGTTGGTTGG - Intergenic
1115350447 14:32389256-32389278 GAAGGCAGCAGATTGTTGGTTGG + Intronic
1115393033 14:32875556-32875578 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1115680507 14:35732483-35732505 GAAAGCAGCAGATGGTTGGTTGG - Intronic
1115775980 14:36715795-36715817 TAAAAAAGCAGATCCTTGGCTGG + Intronic
1115937925 14:38576112-38576134 GAAGACAGCAGAAACTTGATTGG + Intergenic
1115958877 14:38811975-38811997 GAAGGCAGCAGATGGTTGGTTGG - Intergenic
1115970037 14:38934618-38934640 GAAAGCAGCAGATGGTTGGTTGG - Intergenic
1115997238 14:39206779-39206801 AAAGGCAGCAGATAGTTGGTTGG - Intergenic
1116048850 14:39779386-39779408 GAATGCAGCAGATAGTTGGTTGG + Intergenic
1116088810 14:40277610-40277632 GAATGCAGAAGATAGTTGGTTGG + Intergenic
1116324607 14:43516270-43516292 GAAGACAGTAGGTACTTGGCTGG - Intergenic
1116335695 14:43653357-43653379 GAAGCCAGCAGATAGTTGGTTGG - Intergenic
1116406269 14:44569888-44569910 GAAAACAGCAGATACTTGGTTGG - Intergenic
1116668856 14:47815571-47815593 GAAGACAGCAGATACTTGGTTGG + Intergenic
1117112957 14:52477399-52477421 GAAGGTAGCAGATAGTTGGTTGG - Intronic
1117182400 14:53204408-53204430 GAAGACAGAAGATGCTTGATTGG - Intergenic
1117240905 14:53831424-53831446 GAATCCAGCAGATGCTTGGTTGG - Intergenic
1117509939 14:56440990-56441012 GAAGGCAGCAGATAGTTAGTTGG + Intergenic
1117548820 14:56813548-56813570 GAAAACCTTAGATGCTTGGTGGG + Intergenic
1117614967 14:57525379-57525401 GAAGACAGCAGATTCTTGATGGG + Intergenic
1117655234 14:57949443-57949465 GAAGACAGCAGATACTTGGTTGG + Intronic
1117768720 14:59109906-59109928 GAAGGCAGCTGATAGTTGGTTGG - Intergenic
1118140007 14:63070536-63070558 GAAGACAGCCAATACTTGGTTGG + Intronic
1118165777 14:63334360-63334382 AAAAGCAGCAGATAGTTGGTTGG - Intergenic
1120400155 14:84021184-84021206 GAAAACAGCAGAAACTTAGTTGG + Intergenic
1120545577 14:85807558-85807580 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1120736169 14:88055662-88055684 GAAGACAGAAGAAACTTTGTTGG + Intergenic
1120785464 14:88530512-88530534 GAACACAGCAGATACTTGGTTGG - Intronic
1121060874 14:90908474-90908496 GAAAACAGAAGATATGTGGAAGG + Intronic
1121145157 14:91576528-91576550 GAATTCAGGTGATACTTGGTTGG - Intergenic
1121503280 14:94456935-94456957 GAAGGCAGCAGATACTTGGTTGG + Intergenic
1121575633 14:94983420-94983442 AAAGACAGCAGATACTTGATTGG - Intergenic
1121725653 14:96147295-96147317 GAAGACAGCAGATACTTGGTTGG + Intergenic
1121848251 14:97194653-97194675 GAAAACACCAGAAACTTGATTGG + Intergenic
1121848651 14:97198309-97198331 GAAAACCGCAGGTAATTGGGTGG - Intergenic
1124380921 15:29164414-29164436 GAAGGCAGCAGATAGTTGGTTGG - Intronic
1124505306 15:30267442-30267464 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1124738246 15:32271189-32271211 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1125247282 15:37654924-37654946 GAATATAGGAGAAACTTGGTGGG - Intergenic
1125456714 15:39867592-39867614 GAAATCAGCAGATGCGGGGTGGG + Intronic
1126190748 15:45875539-45875561 GAAGACAGTAGAAACTTGGTCGG - Intergenic
1126244758 15:46491300-46491322 GAAGATAGCACATACTTGGTTGG - Intergenic
1126460581 15:48911478-48911500 AAAGGCAGCAGATATTTGGTTGG + Intronic
1126488415 15:49209069-49209091 GAAGGCAGCAGATAGTTGGTTGG + Intronic
1126572921 15:50170784-50170806 GAAAGCAGCAGATAGTTGATTGG - Intronic
1126997243 15:54458812-54458834 AAAGACAGCAGATACTTGATTGG + Intronic
1127014688 15:54670565-54670587 GAAGACAGCAAATATTTGGATGG - Intergenic
1127036311 15:54922035-54922057 GAAGACAGCAGATAATTGGTTGG + Intergenic
1127694480 15:61431674-61431696 GAAGACAGCAGATACTTGTTTGG + Intergenic
1128523408 15:68390472-68390494 GGAAACAGCGGATCCTTGGGGGG + Intronic
1129097402 15:73223692-73223714 GAAGGCAGCAGATTGTTGGTTGG + Intronic
1129793671 15:78360207-78360229 GAAAACAGTAGCTACCTAGTTGG - Intergenic
1130831886 15:87609382-87609404 GAAAACAACACAGACTTGGGGGG - Intergenic
1132045937 15:98562820-98562842 GAAAACAGCACATCCTAGGAAGG - Intergenic
1132253903 15:100357337-100357359 GAGGATAGCAGAAACTTGGTTGG - Intergenic
1132268063 15:100495322-100495344 AAAAACAGCAGATTCTTGGAAGG - Intronic
1132343194 15:101090959-101090981 GAAAAGAGCAGAATGTTGGTTGG - Intergenic
1132427681 15:101732850-101732872 GAAAACACTGGATACTTAGTTGG + Intergenic
1134805823 16:17124048-17124070 GAAGACAGCAGACACTTGGTTGG + Intronic
1135203041 16:20455877-20455899 GAAAGCAGTAGATACTTGGTTGG - Intronic
1135216058 16:20571984-20572006 GAAAGCAGTAGATACTTGGTTGG + Intronic
1136030737 16:27501005-27501027 GAAAAGAGCAAAAACTTGCTAGG - Intronic
1136735783 16:32466132-32466154 GAAGGCAGCAGATAGTTAGTTGG + Intergenic
1138192308 16:55024035-55024057 GAAGACAGCAGAAATTTGGCTGG - Intergenic
1138953074 16:61937563-61937585 GTAAACAGCAGACACTTTATAGG + Intronic
1139080457 16:63512100-63512122 CAAAACAGCTGAATCTTGGTAGG - Intergenic
1139987724 16:70914034-70914056 GAAGGCAGCAGATAGTTGGTTGG + Intronic
1140548120 16:75832061-75832083 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1141510806 16:84510894-84510916 AAAAACAGCAGCTACATGGAAGG + Intronic
1141619648 16:85230155-85230177 GAAAACTGAAGCTAATTGGTTGG + Intergenic
1203017292 16_KI270728v1_random:363442-363464 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
1203035627 16_KI270728v1_random:636600-636622 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
1142940136 17:3373708-3373730 GAAGACAGAAGATACTTTTTTGG + Intergenic
1143152388 17:4815697-4815719 GAAAACAGGAGGTACTGGGAGGG - Intronic
1143991017 17:10961664-10961686 GAAGGCAGCAGATATTTGGTTGG - Intergenic
1144394909 17:14834596-14834618 GCAAACAGCGGTAACTTGGTTGG + Intergenic
1144616270 17:16776933-16776955 GAAGACAGCAGCAACTTGGTTGG - Intronic
1144896433 17:18538726-18538748 GAAGACAGCAGCAACTTGGTTGG + Intergenic
1145135784 17:20405491-20405513 GAAGACAGCAGCAACTTGGTTGG - Intergenic
1146244295 17:31265614-31265636 GAAAACAAAAGATTCTTTGTGGG - Intronic
1146659569 17:34656039-34656061 GTAAACAGCAGATACTGTATTGG - Intergenic
1147462998 17:40587320-40587342 GAGGGCAGCAGATAGTTGGTTGG + Intergenic
1148132224 17:45268965-45268987 GAAAAAAGCAGAAAGTTGGTGGG - Intronic
1148400394 17:47354784-47354806 GAAGACAGCAGATACTTGGTTGG + Intronic
1148408057 17:47437674-47437696 GAAGGCAGCAGATGATTGGTTGG + Intronic
1148965466 17:51431343-51431365 GAAAGCAGCAGGTACTTGGGTGG - Intergenic
1149077115 17:52608457-52608479 GAAATTAACAGATTCTTGGTCGG + Intergenic
1149095892 17:52840133-52840155 AAAAACTGAAGAAACTTGGTGGG + Intergenic
1149221584 17:54420408-54420430 GAAGGCAGCAGATGCTTGGTTGG - Intergenic
1150528844 17:65955576-65955598 GATGACAGCAGAAATTTGGTTGG - Intronic
1150818574 17:68415930-68415952 GAAGGCAGCAGATGGTTGGTTGG + Intronic
1150896094 17:69212863-69212885 GAAGACAGCAGATACTTGGTTGG + Intronic
1150945288 17:69739422-69739444 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1151598854 17:75094152-75094174 GAAAGCAGGAGAGTCTTGGTGGG - Intronic
1152953907 18:19370-19392 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
1153065650 18:1041631-1041653 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1153071742 18:1114112-1114134 GAAGACAGCAGAGACTTAGTTGG + Intergenic
1153168729 18:2291601-2291623 GAATGCAGCAGATACTTGGTTGG + Intergenic
1153396206 18:4624101-4624123 GAAGAGAGCAGATACTTGGTTGG + Intergenic
1153400665 18:4680845-4680867 GAATGCATCAGATAGTTGGTTGG - Intergenic
1153425233 18:4955612-4955634 GATGACAGCAGATACTCTGTTGG - Intergenic
1153451167 18:5231084-5231106 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1153550792 18:6259365-6259387 AAAAACAACAGATACTTGCAAGG - Intronic
1153828953 18:8902903-8902925 GAAGACAGTAGATACTTGGTTGG - Intergenic
1153869669 18:9305903-9305925 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1153965735 18:10180341-10180363 GAAGGTAGCAGATAGTTGGTTGG + Intergenic
1154090192 18:11351302-11351324 GAAGACAGCAGAAAGTTCGTTGG - Intergenic
1154298069 18:13167763-13167785 GAGGACAGCAGATAACTGGTTGG - Intergenic
1154446328 18:14438617-14438639 GATAACAGCAGAAACCTGGCAGG - Intergenic
1155886944 18:31219525-31219547 GAAGACAGAAGGTACTTGGTTGG - Intergenic
1156326855 18:36081684-36081706 GAAGATAGCAGATACTTGGTTGG - Intergenic
1156344577 18:36245039-36245061 GAAGACAGTAGATACTTGGTTGG + Intronic
1156606941 18:38678017-38678039 GAAGAGAGCAGAAACTCGGTTGG + Intergenic
1156642700 18:39121442-39121464 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1156667669 18:39427483-39427505 GAAGGCAGCAGATAGTTCGTTGG - Intergenic
1156893175 18:42213669-42213691 GAATATAGCAGACACTTGGTTGG + Intergenic
1157507693 18:48240925-48240947 GAAGACAGCAGATACTTGGTTGG - Intronic
1157703096 18:49777454-49777476 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1157885036 18:51358668-51358690 GAAAACAAACAATACTTGGTGGG - Intergenic
1158277991 18:55789816-55789838 GAAAACAGTAGGTACTTAGAAGG - Intergenic
1158377432 18:56886700-56886722 GAAGACAGCAGAAACTTGGTTGG - Intronic
1158756697 18:60333665-60333687 GAAGGCAGCTGATAGTTGGTTGG - Intergenic
1158830017 18:61266332-61266354 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1159077199 18:63694085-63694107 GAAAAAAGCTGATACATGCTGGG + Intronic
1159603696 18:70452828-70452850 GAAAATAGCAGCTACCTCGTAGG - Intergenic
1159612683 18:70544202-70544224 GAAGACAGCAGATACTTGGTTGG + Intergenic
1159838635 18:73371202-73371224 GAAAACATCAGATACTTGGTTGG - Intergenic
1160059023 18:75512903-75512925 GAAAACAGCACATACTTGGTTGG - Intergenic
1163737279 19:18989296-18989318 GAAAAGAGCAGGTATTGGGTTGG - Intergenic
1163886372 19:19968837-19968859 GAAGACAGTAGATATTTCGTTGG + Intergenic
1163897193 19:20069601-20069623 GATGATAGCAGATATTTGGTTGG - Intergenic
1163907967 19:20163650-20163672 AAAGACCGCAGATATTTGGTTGG - Intergenic
1163949914 19:20574414-20574436 GAAGACAGCAGATATTTTGTGGG + Intronic
1163968089 19:20766973-20766995 GAAGACAGCAGATATTTTATTGG - Intronic
1164018171 19:21271513-21271535 GAAGGCAGAAGATACTTGGTTGG + Intronic
1164096737 19:22017234-22017256 GAAAACAACAGATGCTGGGGAGG + Intergenic
1164237872 19:23352688-23352710 GAAGACAGCAGATAGTTGATTGG - Intronic
1164267610 19:23634711-23634733 GAAGGCAGCAGATGGTTGGTTGG - Intronic
1164273605 19:23697133-23697155 AAAGACAGCAGATACTTGGTTGG + Intergenic
1164319941 19:24135349-24135371 GAAGATAGCAGATAGTTGATTGG + Intergenic
1164919737 19:32080032-32080054 GAAAAGAGCTGATAGTTGGAGGG - Intergenic
1165007177 19:32816819-32816841 GAAAACAGCAGGCACCTGTTAGG + Intronic
1165084677 19:33335846-33335868 AAAAAAAGAAGATGCTTGGTTGG - Intergenic
1166260768 19:41639368-41639390 GAACACAGCGGAAATTTGGTTGG - Intronic
1166262924 19:41654634-41654656 GAAAGCAGCAGATACTTGGTTGG - Intronic
1166442508 19:42827149-42827171 GAGGGCAGCAGATACTTGCTTGG + Intronic
1166450309 19:42893608-42893630 GAGGGCAGCAGATACTTGCTTGG + Intronic
1166462202 19:42997918-42997940 GAGGGCAGCAGATACTTGCTTGG + Intronic
1166479473 19:43157868-43157890 GAGGGCAGCAGATACTTGCTTGG + Intronic
1166604059 19:44124928-44124950 GAAGGCAGCAGATGGTTGGTTGG + Intronic
1168395889 19:56048130-56048152 GAAGGCAGCAGATGGTTGGTTGG + Intronic
924992662 2:326941-326963 GAAGACAGCAGATGCTTGGTTGG + Intergenic
925637719 2:5957664-5957686 AAAGACAGCAGAAATTTGGTTGG + Intergenic
925705722 2:6683286-6683308 GAAGAGAGCAGATATTTGGTTGG - Intergenic
925795507 2:7537894-7537916 GAGGACAACAGAAACTTGGTTGG + Intergenic
926866800 2:17368904-17368926 AAAGACAGAAGATACTTGGTTGG + Intergenic
927036532 2:19183370-19183392 GAAGACAGCAGAAACTTGGTGGG + Intergenic
927069761 2:19515372-19515394 GAAGACAACAGAAACTTGGCTGG + Intergenic
927080147 2:19619313-19619335 GAAGACAGCAGATACTTGGTGGG - Intergenic
927176539 2:20413214-20413236 AAAGACAGCAGAAACTTGGTTGG + Intergenic
927328155 2:21830732-21830754 GAAGGCAGTAGATAGTTGGTTGG + Intergenic
928356886 2:30624344-30624366 GAAGACAGCGGATACTTGGTTGG - Intronic
928443038 2:31309449-31309471 GAAGGCAGCAGAGAGTTGGTTGG + Intergenic
928473152 2:31594277-31594299 AAAGACAGCAGATACTTGGTTGG - Intergenic
928733901 2:34263234-34263256 GAAGGCAACAGATAGTTGGTTGG - Intergenic
928772326 2:34717859-34717881 GCAGGCAGCAGATATTTGGTTGG + Intergenic
928782885 2:34846754-34846776 GAAGATAGCAGAAACTTGGTTGG + Intergenic
928796134 2:35021720-35021742 GAAAACAACAGATACTGGAGAGG - Intergenic
928798674 2:35058522-35058544 GAAAACAGCAGATACTTGGTTGG + Intergenic
928988659 2:37206878-37206900 GAACACAGCAGATTCTTGGTTGG - Intronic
929010089 2:37433285-37433307 GAAGGCAGCAGATAGTTGTTTGG + Intergenic
929027419 2:37617997-37618019 GAAAATAGCAGCTACTTCATAGG - Intergenic
929123495 2:38502344-38502366 GAAAACAGCAGAGCATTGTTGGG + Intergenic
929197288 2:39198063-39198085 AAAGACAGCAGATACTTGGTTGG - Intronic
929722712 2:44387426-44387448 GAAGGCAGCAGATAGTTGGTTGG + Intronic
930404137 2:50932407-50932429 GAAGACAGCAAATACTTGGTTGG + Intronic
930574116 2:53125510-53125532 GAAGACAGCAGATACTTTATTGG + Intergenic
931136172 2:59403876-59403898 GAAGGCAGCAGATAGTTGTTTGG - Intergenic
931136814 2:59412426-59412448 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
931271371 2:60706587-60706609 GGAAACAGCAGGTTCTTTGTTGG - Intergenic
931524974 2:63143334-63143356 GAAGGCAGCAGAGAGTTGGTTGG + Intronic
931536004 2:63277479-63277501 GAAGACAAGAGAAACTTGGTTGG - Intronic
931834819 2:66087501-66087523 AAAGACAGCAGTCACTTGGTTGG - Intergenic
932270496 2:70404803-70404825 GAAGGCAGCAGATAGTTTGTTGG - Intergenic
932307823 2:70716358-70716380 GCACAAAGCAGATTCTTGGTTGG + Intronic
932384670 2:71321262-71321284 GAAGGCAGCAGATAGTTGGTTGG + Intronic
932925651 2:75970667-75970689 GAAGACAGCAGATACTTGGTTGG - Intergenic
933086133 2:78056641-78056663 GGAGACAGCAGATACTTGGTTGG + Intergenic
933110953 2:78399330-78399352 GAAGACAGCAGATATTTGGTTGG - Intergenic
933340786 2:81023749-81023771 GAAGACAGCAGATATTTAATCGG + Intergenic
933398108 2:81757038-81757060 GAAGGCAGCAAATACTTGGTTGG - Intergenic
933436098 2:82251848-82251870 AAAAACAGCAGATACTGGTGAGG - Intergenic
933474551 2:82772717-82772739 GAAGACAGCAGATACTTGGTTGG - Intergenic
933910833 2:86940152-86940174 GAACACAGCAAGTACTTGTTAGG + Intronic
934021896 2:87963258-87963280 GAACACAGCAAGTACTTGTTAGG - Intergenic
934083165 2:88486861-88486883 AAAAACATCAAATACTTGGGAGG - Intergenic
934111166 2:88744908-88744930 GAAGACAACAGATACATGGTTGG + Intronic
934177556 2:89589734-89589756 GAAGGCAGCAGATAGTTAGTTGG + Intergenic
934186951 2:89755240-89755262 GAAGGCAGCAGATAGTTAGTTGG + Intergenic
934287853 2:91664036-91664058 GAAGGCAGCAGATAGTTAGTTGG + Intergenic
934310038 2:91853931-91853953 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
934546277 2:95219299-95219321 AAAAACAGAAAATACTTGGCCGG - Intronic
935610262 2:105015708-105015730 GAAGGCAACAGATACTTGGTTGG + Intergenic
936899118 2:117464342-117464364 GAAGACAGCAGAAACTTGGTTGG + Intergenic
937410761 2:121672976-121672998 GAAGACAGAAGATATGTGGTTGG - Intergenic
937663206 2:124454126-124454148 GAAGGCAGCAGATAGTTGGTTGG - Intronic
937722873 2:125124474-125124496 GAAGGTAGCAGATATTTGGTTGG + Intergenic
937781788 2:125847076-125847098 AAAGACAGCAGATGGTTGGTTGG + Intergenic
937971881 2:127556307-127556329 GAAGGCAGCAGATGCTTGGTTGG + Intronic
938497606 2:131809498-131809520 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
938564065 2:132501991-132502013 GAAGACAGCAGAAACTTGCTTGG + Intronic
939240036 2:139546566-139546588 GAAGGCAGCAGATGGTTGGTTGG + Intergenic
939245582 2:139619462-139619484 GAAGACAGCAGGTACTTGATTGG + Intergenic
939449399 2:142353581-142353603 GAAGACAGCAGATACTTGGTTGG - Intergenic
939769755 2:146300630-146300652 GAAGGCAGCAGATAATTGGTTGG - Intergenic
939919325 2:148088930-148088952 GAAGACAACAGATACTTGGTTGG - Intronic
940034515 2:149299961-149299983 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
940172176 2:150841262-150841284 GAAGGCAGCAGATAGTCGGTTGG + Intergenic
940217814 2:151318205-151318227 GAAGGTAGCAGATAGTTGGTTGG - Intergenic
940384692 2:153057400-153057422 GAAGACAGCACATACTTAGTTGG + Intergenic
940453984 2:153872929-153872951 GAAAAAAACAGATACATGGCCGG - Intronic
940630506 2:156231935-156231957 GAAGACAGCAGATATTTGGTTGG - Intergenic
940709209 2:157142236-157142258 GAAGGCAACAGATACTTGGTTGG + Intergenic
940762545 2:157753038-157753060 GAAGGCAGCAGATAGTTGCTTGG - Intronic
940796624 2:158087403-158087425 GAAGACAGCAGATCCTTGGTTGG + Intronic
941060856 2:160844974-160844996 GAAGACAGCAGATACTTGATTGG - Intergenic
941169569 2:162120199-162120221 GAAAAGAGCAGAGTGTTGGTTGG - Intergenic
941358167 2:164517591-164517613 GAAGACAGCAAATACTTGGTTGG - Intronic
941627634 2:167846837-167846859 GAAGACAGCAGATGGTTAGTTGG - Intergenic
942062857 2:172243855-172243877 GAAAGCAGCAGAAACATGGAGGG + Intergenic
942154538 2:173114298-173114320 GAAGACAGCAGATGGTTGGTTGG + Intronic
942635133 2:177995647-177995669 TAAAACAGCAGATGCGGGGTGGG - Intronic
942743816 2:179208949-179208971 GAAGACAACAGATACTTGGTTGG - Intronic
943130530 2:183848232-183848254 GAAAGCAGCAGATAGTGGGTTGG - Intergenic
943198996 2:184794733-184794755 AAAGGCAGCAGATAGTTGGTTGG - Intronic
943250388 2:185514345-185514367 GAAAACAGCACAAACTTCATTGG + Intergenic
943339803 2:186666347-186666369 GAACACAGCACATACTTTGGTGG + Intronic
943443685 2:187955441-187955463 GCAAACAGCAGATACTGGAGAGG + Intergenic
943449188 2:188026928-188026950 GAAGATGGCAGATACTTGGTTGG + Intergenic
943581028 2:189683726-189683748 GAAAACAGCAGCTCCTCTGTTGG + Intronic
943607669 2:189995529-189995551 GAAGATAGAAGATACTTGATTGG + Intronic
943654478 2:190493107-190493129 GAAGGCAGCAGATACTTGGTTGG - Intronic
943943695 2:194031051-194031073 GAAGACAGCAGATACTTGGCTGG - Intergenic
943947487 2:194086756-194086778 GAAAAGAGCAGGTACTGGGAAGG - Intergenic
943970884 2:194404614-194404636 GAAAACAGCAGATGCTGGAGAGG - Intergenic
944263449 2:197698876-197698898 GAAGACAGCAGATAATTGTTTGG + Intronic
944371602 2:198990284-198990306 GCAGACACCAGATACTTAGTGGG - Intergenic
944485583 2:200201775-200201797 GAAGACAGCAGAAACTTGGTTGG - Intergenic
944503090 2:200382040-200382062 GAAAACAGCCGTTTTTTGGTGGG + Intronic
944602303 2:201315282-201315304 GAAGGCAGCAGATAGTTGATTGG - Intronic
945075357 2:206033061-206033083 GAAGGCAGCAGATAGTTGGTTGG - Intronic
945362573 2:208909035-208909057 GAAGACAGTAGATACTTGGTTGG - Intergenic
945377191 2:209092840-209092862 GAATAGAGCAGAAATTTGGTTGG + Intergenic
945387206 2:209216671-209216693 GAAGACAGCAAATAGTTGGTTGG - Intergenic
945739074 2:213639155-213639177 GAAGACAGAGGATACTTGATTGG + Intronic
946036663 2:216748066-216748088 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
946205202 2:218101023-218101045 GAAGACAGCAGATATTTGATGGG + Intergenic
946501484 2:220251967-220251989 GAAGGCAGCAGGTAGTTGGTTGG - Intergenic
946824192 2:223659473-223659495 GAAGACAGCAAAAACTTGATTGG - Intergenic
947689142 2:232118395-232118417 GAAAAGATCACACACTTGGTTGG - Intronic
948320349 2:237063930-237063952 GAAAACAGCACTCACTTGATGGG + Intergenic
948531385 2:238608484-238608506 GAAAGCAGCAGATACTTGGTTGG - Intergenic
948576918 2:238958375-238958397 GAAGACAGTAGAAACTTGATTGG - Intergenic
1169397725 20:5249236-5249258 GAAGACAGTGGATACTTGGTTGG + Intergenic
1169526519 20:6432973-6432995 GCTAACACCAGATACTTGGGAGG - Intergenic
1170086421 20:12537378-12537400 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1170133728 20:13051168-13051190 GAAGGCAGCAGATAGTTGGTTGG - Intronic
1170241527 20:14172250-14172272 AAAGACAGCAGATAGTTAGTTGG + Intronic
1170245558 20:14218423-14218445 GAAGGAAGCAGATAGTTGGTTGG + Intronic
1170489285 20:16855657-16855679 GAAGACAGCAGGAACTTGGTTGG + Intergenic
1170650986 20:18241137-18241159 GAAGACAGCAGATACTTGGTTGG - Intergenic
1170726728 20:18935372-18935394 GAAGACAGCAAGAACTTGGTTGG + Intergenic
1170741238 20:19058656-19058678 GAAGACAGGAGAAACTTGATTGG - Intergenic
1170865560 20:20152448-20152470 CAAGACAGCAGATACTTGATTGG - Intronic
1171038500 20:21737839-21737861 GAAGACAGCAGATACTTGGTTGG + Intergenic
1171066766 20:22024884-22024906 GAAGGCAGTAGATACTTGGTTGG + Intergenic
1171080384 20:22176299-22176321 GAAGACAGCAGATACTTGGTTGG + Intergenic
1171081409 20:22189181-22189203 GAAGGCACCAGATAGTTGGTTGG + Intergenic
1171198356 20:23221029-23221051 AAAGACAGCAGATATTTGGTTGG + Intergenic
1171242105 20:23579497-23579519 GAAGACAGCAGGTACTCGGTTGG + Intergenic
1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG + Intergenic
1172212543 20:33211123-33211145 GAAAACAACAGTTACTTCCTAGG - Intergenic
1172233715 20:33355067-33355089 GAAAACATAAGAAACTTGGGGGG - Intergenic
1172771871 20:37386750-37386772 GCATGCAGCAGATACTTGGGTGG - Intronic
1172851238 20:37967344-37967366 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1173350006 20:42236137-42236159 GAAACTAACAGACACTTGGTTGG + Intronic
1173372995 20:42456185-42456207 GAAAATACCACATACTTGTTAGG + Intronic
1173568543 20:44059981-44060003 GAAGACAGCAGATACTCAGTTGG - Intronic
1175232926 20:57485980-57486002 GAAGACAGCAGATACTTGGTTGG + Intergenic
1176658468 21:9611316-9611338 AAAGACAGCAGATACTTGATTGG + Intergenic
1177069424 21:16484882-16484904 GAAGACAGCACATACTTAGTTGG + Intergenic
1177124474 21:17179061-17179083 GAAGACAGCAGAATCTTGCTTGG - Intergenic
1177339319 21:19779761-19779783 GGAAACAACAGATACTGGATAGG - Intergenic
1177364359 21:20115316-20115338 GAAGACAGCAGATACTTGGTTGG + Intergenic
1177661377 21:24087709-24087731 AAAGACAGCAGAAACTTGCTTGG - Intergenic
1177681203 21:24373798-24373820 GAAGACAGCAGATAGTTGGTTGG + Intergenic
1177749854 21:25267287-25267309 GAAGACAGCAAATACTTGGTTGG - Intergenic
1177934943 21:27333507-27333529 CAAGACAGCAGGTAATTGGTTGG - Intergenic
1177995160 21:28088191-28088213 GAAAACAGCAGATAATTAGTTGG + Intergenic
1178059574 21:28836736-28836758 GAAGGCAGCAGATGGTTGGTTGG - Intergenic
1178252858 21:31021085-31021107 GAATTAAGCAAATACTTGGTGGG - Intergenic
1178581050 21:33839084-33839106 CAATTCAGCAGATATTTGGTGGG + Intronic
1178801868 21:35803144-35803166 GAAGGCAGCAGATAGTTGGTTGG - Intronic
1178823841 21:35998753-35998775 CAAAACAGCAGATACCTACTGGG + Intronic
1179260475 21:39753896-39753918 GAAGACAGTAGATATTTGGTTGG + Intronic
1179443505 21:41413274-41413296 GAAGACAGTAGATACTTGGTTGG - Intergenic
1179467580 21:41587338-41587360 GAAGACAGAAGAAACTTGGTTGG + Intergenic
1180454717 22:15503325-15503347 GAAGGCAGCAGATAGTTAGTTGG + Intergenic
1180536775 22:16399812-16399834 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
1181870857 22:25898186-25898208 GAAAACAGCAGATGCTGGAATGG - Intronic
1182391112 22:29997296-29997318 GGAAACAGCAATTACTTGGATGG - Intronic
1182446367 22:30392023-30392045 GAAAACAGCTGATACCAGCTGGG + Intronic
1182536725 22:31009192-31009214 TAAAACAACAGAAATTTGGTCGG - Intergenic
1183732333 22:39625678-39625700 GAAGACAGCAGAGAGGTGGTTGG + Intronic
1183802411 22:40177994-40178016 GAAACCAGCAGAGACTCTGTCGG - Exonic
1184063798 22:42103331-42103353 GAAGACAGCAGATGGTTGGTTGG + Intergenic
1184932929 22:47694790-47694812 AAAAATAGCAGAAACTTGGCAGG - Intergenic
949145854 3:699280-699302 GATGACAGCAGATACTTGGTTGG + Intergenic
949189825 3:1238165-1238187 GAAGACAGCAGAGACTTTATTGG - Intronic
949377533 3:3406995-3407017 GAAGACAGCAGATATTTGATTGG - Intergenic
949476040 3:4446629-4446651 TAAGACATCAGATAATTGGTGGG - Intronic
949553664 3:5133564-5133586 GCAAACAGCAGTTACAGGGTGGG + Intronic
949799358 3:7886141-7886163 GAAGACAGCAGATACTTGGTTGG - Intergenic
950297202 3:11842407-11842429 AAAAAAAGCAGAACCTTGGTGGG + Intronic
950592205 3:13946075-13946097 GAAGGCAGTAGATAGTTGGTTGG + Intronic
950603218 3:14054645-14054667 GAAGGCAGCAGATAGTTGATTGG + Intronic
950820106 3:15748105-15748127 GAAGACAGCAGAAACTTGGTTGG + Intronic
951183986 3:19690579-19690601 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
951198358 3:19849493-19849515 GAAGAAAGCAGATACTTGGTTGG - Intergenic
951260478 3:20502128-20502150 GGAGACAGCAGATAGTTGGTTGG + Intergenic
951268274 3:20595861-20595883 AAAGGCAGCAGATACTTGGTTGG + Intergenic
951294679 3:20919387-20919409 GAGGACAGCAGATACTTGGTTGG - Intergenic
951404812 3:22282913-22282935 GAAGATAGCAGATACTTGATTGG - Intronic
951572294 3:24077320-24077342 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
951859079 3:27230595-27230617 GAGGACAGCAGATATTTGGTTGG - Intronic
951967361 3:28401348-28401370 GAAGTCAGCAGATAGTTGGCTGG - Intronic
952083065 3:29783772-29783794 GAAGACAGTAGAAACTTGGCTGG - Intronic
952183049 3:30939685-30939707 GAAGATAGCAGATACTCGGTTGG + Intergenic
952265270 3:31779293-31779315 TAAGACAGCAGATACTTGGTTGG - Intronic
952349858 3:32523887-32523909 AAAGACAACAGATACTTGGCCGG + Intergenic
952361804 3:32637617-32637639 TAAAACAGCATATACTGGCTGGG - Intergenic
952689663 3:36190368-36190390 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
952714732 3:36469003-36469025 GAAGACAGCAGAAACTTGGTTGG + Intronic
952984654 3:38768153-38768175 GAAGACAGTAGATACTTGGTTGG + Intronic
953163422 3:40443081-40443103 GAAAAAAAAAGATACTTGGCTGG + Intergenic
953185470 3:40633553-40633575 GAAGACAGCAGATACTTGGTTGG - Intergenic
953195584 3:40729950-40729972 GAAGACAGCATATACTTGATTGG + Intergenic
953276895 3:41510056-41510078 GAAGACAGCAGAAATTTGTTTGG - Intronic
953382386 3:42482166-42482188 GAAGACAGCAGACACTTGGTTGG - Intergenic
953495334 3:43381290-43381312 GGCAGCAGCAGATACTTGGTTGG - Intronic
953639337 3:44691173-44691195 GAAGACAGCAGATACTTGGTTGG - Intergenic
953866610 3:46588820-46588842 GAAGGCAGCAGTTAGTTGGTGGG - Intronic
954313995 3:49791313-49791335 GAAAAAAGCAGATAGATGGTGGG + Intronic
955446002 3:59010284-59010306 GAAGACAGCAGATACTTGGTTGG - Intronic
955477349 3:59351705-59351727 GAAGGCAGCAGATAGTTGCTTGG + Intergenic
955859912 3:63317643-63317665 GGAGGCAGCAGATAGTTGGTTGG + Intronic
956377188 3:68626940-68626962 GAAGACAGCAGATACTTAGTTGG + Intergenic
956476923 3:69632016-69632038 GGAAACAGCAGATACTGGAGAGG - Intergenic
956950456 3:74275867-74275889 GAAGGCAGCAGATATTTGTTTGG - Intronic
956995473 3:74822548-74822570 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
957602109 3:82350662-82350684 GAAGACAGCAGATACGTGGTTGG - Intergenic
957681547 3:83441993-83442015 GAAGTTAGCAGATACTTGGTTGG - Intergenic
958003109 3:87776546-87776568 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
958066466 3:88550188-88550210 GAAGGCAGCAGATACTTGGTTGG + Intergenic
958149566 3:89671973-89671995 GAAGACAGCAGATACTTGATTGG - Intergenic
958436079 3:94097248-94097270 GAAGAAAGCTGATATTTGGTTGG - Intronic
958444696 3:94201158-94201180 GAAGACAGCAGATACTTGGTTGG + Intergenic
958509922 3:95035129-95035151 CAAGACAGCAGATACTTGGTTGG + Intergenic
958515394 3:95108839-95108861 GAAAACAGCAGATAGATGAATGG - Intergenic
958646944 3:96886591-96886613 GAAGGCAGCAGATAGTTGGTTGG + Intronic
958775446 3:98477628-98477650 GAAGGCAGCAGATATTTGGTTGG + Intergenic
958787178 3:98610939-98610961 GAAGATGGCAGATACTTGGTTGG + Intergenic
958818850 3:98949682-98949704 GAAGACAGCAGATACTTGGTTGG + Intergenic
958857299 3:99400127-99400149 GGAAACAGCAGAGATTTGGTTGG + Intergenic
959125719 3:102288587-102288609 GAAGACAGCGGAATCTTGGTTGG + Intronic
959215214 3:103443274-103443296 AAAAAGAACAAATACTTGGTAGG - Intergenic
959325858 3:104935551-104935573 GAAAAAAGCAGATATTGGGTAGG + Intergenic
959361977 3:105404815-105404837 GAAGATAGCAGAAACTTGGTTGG - Intronic
959424004 3:106163482-106163504 GGATACAGGAGAAACTTGGTTGG - Intergenic
959616037 3:108348404-108348426 GAAAAGAGCCGAGAGTTGGTAGG + Intronic
959666342 3:108926340-108926362 GAAGGCAGCAGATAGTTGTTTGG + Intronic
959727183 3:109557739-109557761 GAAGACAGCAGATGCTTGGTTGG + Intergenic
959756785 3:109909188-109909210 GAAGGCAGCAGGTAGTTGGTTGG + Intergenic
959867692 3:111290224-111290246 GTAGCCAGCAAATACTTGGTTGG + Intergenic
959875341 3:111375422-111375444 GAAGGCAGCAGATAATTGGTTGG - Intronic
959877990 3:111408741-111408763 GAAGACAGCAGATTCTTGGTTGG - Intronic
959993705 3:112657335-112657357 GAAAACAGCAGATGCTGGTGGGG - Intergenic
960152883 3:114269046-114269068 AAAGACAGCAGATACTTGGTTGG + Intergenic
960366924 3:116783999-116784021 GAGAACAGAAGAGACTTGGTGGG + Intronic
960491747 3:118323919-118323941 GAAAACAGCAGATGCTGGAGAGG + Intergenic
960578304 3:119248855-119248877 GAAAACAGTAGATACTTGGTTGG - Intergenic
960712152 3:120542206-120542228 GGAGACAGCAGATACTTGGTTGG + Intergenic
960756649 3:121020995-121021017 AAAGACAGCAGATACTTGGTTGG - Intronic
960761838 3:121080238-121080260 GAAGACAACAGATATTGGGTTGG + Intronic
961806624 3:129494014-129494036 GAGAACTGCAGATCCTTAGTGGG + Intronic
961977907 3:131046021-131046043 GAGAACAGCAGATGGTTGGTTGG + Intronic
962013100 3:131412596-131412618 AAAGACAGCAGATACTTGGTTGG - Intergenic
962034629 3:131638267-131638289 GAAGACAGCAGAAACTTGGTTGG - Intronic
962083578 3:132166624-132166646 GAAAACACCAAATACTCAGTAGG + Intronic
962147239 3:132853463-132853485 AAAGACAGCAGAAACTTGGTTGG + Intergenic
962192074 3:133321242-133321264 GAAGACAGCACATACTTGGTTGG - Intronic
962503181 3:136016727-136016749 AAAGACAGCAGATACTTGGTTGG + Intronic
962504756 3:136035129-136035151 GAAGGCAGCAGATAATTGGTTGG + Intronic
962709616 3:138074875-138074897 GAAGACAGCAGAAACTTGGTTGG - Intronic
962983819 3:140516247-140516269 AAAGACAGCAGCTACTTGGTTGG + Intronic
962999576 3:140665941-140665963 GAAGGCAGTAGATATTTGGTTGG - Intergenic
963023407 3:140895262-140895284 GAAGATAGCAGATACTTGGTTGG + Intergenic
963050958 3:141143275-141143297 GAAGACAGCAGATACTTGGTTGG + Intronic
963081227 3:141395507-141395529 CAAAACTGAAGATACTTCGTAGG + Intronic
963373689 3:144436315-144436337 GAAGACAGCAGAAACTTGGTTGG + Intergenic
963522332 3:146371221-146371243 GAAGACAGAGGAAACTTGGTTGG + Intergenic
963700209 3:148616905-148616927 GAAAACAGCTGATGCGTGGTGGG - Intergenic
964252940 3:154741109-154741131 GAAGGCAGCAGATAATTGGTTGG - Intergenic
964325168 3:155537474-155537496 GAAGACAGCAGATATTTGGTTGG - Intronic
964331791 3:155610940-155610962 AAAACCAGCAGATACTTGGTTGG - Intronic
964457489 3:156884186-156884208 GAAGACAGCAGATACTTGGTTGG + Intronic
964644031 3:158938700-158938722 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
964651121 3:159012694-159012716 TAAAACAGTACATCCTTGGTAGG - Intronic
964772823 3:160242091-160242113 GAAGACAGGAGAAACTTGGTTGG - Intronic
964867671 3:161278829-161278851 GAACATAGCAGATACTTAATTGG - Intergenic
965026898 3:163313692-163313714 GAAAGCAGCAGATAGTTGGTTGG - Intergenic
965060875 3:163784473-163784495 AAAGACAGCAGATACTTGGTTGG + Intergenic
965154215 3:165026060-165026082 GGAGGCAGCAGATAGTTGGTTGG - Intronic
965216686 3:165873105-165873127 GAAAGCAGCAGCTAGTTGGTTGG + Intergenic
965243535 3:166233850-166233872 TAAAAAAACAGATACTTTGTAGG - Intergenic
965745610 3:171922016-171922038 GAAGGCAGCAGATACTTGGTTGG - Intronic
966092925 3:176161628-176161650 GAAGACAGCAGATACTTGGTTGG - Intergenic
966117496 3:176483408-176483430 GAGGGCAGCAGATAGTTGGTTGG + Intergenic
966229731 3:177638980-177639002 GAAGACAGCAGAAACTTGGTTGG + Intergenic
966352824 3:179048900-179048922 GAAGATAGCAGATACTTGGTTGG - Intronic
966525866 3:180918497-180918519 GAAAAGGGCAGATACTTTGCTGG + Intronic
966553092 3:181227811-181227833 GAATACAGCAGGTACTTGGTTGG + Intergenic
967037620 3:185659670-185659692 GTAAAAAGCAGCTACTTGGCAGG - Intronic
967209277 3:187152372-187152394 GAAGGCAGCAGATAGTTTGTTGG - Intronic
967236298 3:187386885-187386907 GAAGACAGCAGATACATGGTTGG - Intergenic
967257325 3:187607225-187607247 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
967504772 3:190241204-190241226 GAAGACAGCAGATACTTGGTTGG - Intergenic
967559138 3:190897557-190897579 GAAGACAGCAGATCGTTGGTTGG - Intergenic
967651587 3:191992381-191992403 GAAGGCAGCAGATTGTTGGTTGG - Intergenic
967741388 3:193006651-193006673 GAAAGGAGCAGATAGTTGGTTGG + Intergenic
967958508 3:194899090-194899112 GAAGACAGCAGATACTTGGTTGG + Intergenic
968125461 3:196156317-196156339 GAAGGCAGCAGATAGTTGGCTGG + Intergenic
968720787 4:2202270-2202292 GAAGGCAGCAGATGGTTGGTTGG - Intronic
968807279 4:2782867-2782889 GAAGACAGCAGATTCTTGTTTGG + Intergenic
969165466 4:5306554-5306576 GAAGAGAGCAGATACTTGGTTGG + Intronic
970076034 4:12221995-12222017 CATAACAGTAGATACTTGTTGGG + Intergenic
970215634 4:13757065-13757087 AAAGACAGCAAATACTTGGTTGG + Intergenic
970283147 4:14480357-14480379 GAAGACAACAGACACTTGGTTGG - Intergenic
970312257 4:14794890-14794912 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
970549111 4:17161831-17161853 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
970588223 4:17534676-17534698 GAAAAAAGAAAATACTTGCTGGG + Intergenic
970668910 4:18373340-18373362 GAAAACAGTAGACACTTGTGAGG + Intergenic
970856417 4:20653653-20653675 GAAGACAGCAGTTACTTGGTTGG - Intergenic
970996285 4:22270726-22270748 GAAGGCTGCAGATAGTTGGTTGG - Intergenic
971050226 4:22853720-22853742 GAAGACAGCAGAAAGTTGGTTGG + Intergenic
971554780 4:28000352-28000374 GAAGACAGCAGAAACTTGGTTGG + Intergenic
971938340 4:33183108-33183130 GAAGACAGCTGATACTTGGTTGG + Intergenic
972049004 4:34704367-34704389 GAAAGCAGCAGATAATTGGTTGG - Intergenic
972097150 4:35362650-35362672 GTAGACAGCAGATATTTGGTTGG + Intergenic
972188875 4:36566840-36566862 GAAGGCAGCAGATAGTTGGATGG + Intergenic
972806648 4:42535193-42535215 AAAGACAGCAGATACTTGGTTGG - Intronic
972826977 4:42769835-42769857 GAAGACAGCAGATATTTGGTTGG - Intergenic
972899590 4:43667119-43667141 GAAAACAGCAGATACTTGGTTGG + Intergenic
973091620 4:46144698-46144720 GAAGACAGCAGATATTTGGTTGG + Intergenic
973342877 4:49024258-49024280 GAAGACAGCAGGAACTTGGTTGG + Intronic
973654818 4:53035819-53035841 GGAAACAACAGATACTGGGGAGG + Intronic
973675861 4:53262166-53262188 GAAGACAGCAGAAACTTGGTTGG + Intronic
973831321 4:54762733-54762755 GAAGACAGCAGATGGTTGGTTGG + Intergenic
973920332 4:55677670-55677692 GAAGGTAGCAGACACTTGGTTGG - Intergenic
974017911 4:56665928-56665950 GCAGACAGCAGATCCTTGATGGG + Intronic
974127316 4:57711975-57711997 GAAGACAACAGATACTTGATTGG - Intergenic
974133274 4:57783274-57783296 GAAGATAGTAGAAACTTGGTTGG + Intergenic
974196317 4:58580265-58580287 GAAAACAGCAGATGCTTGAGAGG - Intergenic
974225197 4:59033152-59033174 GAAAAAAGGAAACACTTGGTGGG - Intergenic
974582097 4:63815992-63816014 GGAAACAGCAGTTGCTGGGTTGG - Intergenic
974583287 4:63835355-63835377 GAAGACAGCAGATACTTGGTTGG + Intergenic
974801624 4:66826322-66826344 GAAGGCAGCAGATACTTAGTTGG + Intergenic
974848987 4:67382909-67382931 GAAGACAGCAGATACTTGGTTGG - Intergenic
974857570 4:67478797-67478819 GAGGACAGCAGGTACTTTGTTGG - Intronic
974862243 4:67536684-67536706 CAAAACAACAGAGACTTTGTAGG - Intronic
975061903 4:70013775-70013797 GAAGGCAGCAGATACTTGGTTGG + Intergenic
975075828 4:70207861-70207883 GAAAACAACAGATGCTGGGGAGG - Intergenic
975243623 4:72092752-72092774 GAAGATAGCAGATACTTGGTTGG + Intronic
975509963 4:75183120-75183142 GAAGACAGCAGATACTTGGTTGG - Intergenic
975534778 4:75437631-75437653 GAAGGCAGCAGACACTTGGTTGG - Intergenic
975623420 4:76317207-76317229 GAAGACAGCAGATACTTGGTTGG - Intronic
975684421 4:76905456-76905478 GAAAAGTGCATATACCTGGTGGG - Intergenic
975790335 4:77942789-77942811 GAAGACAGCAGATACTTGGTTGG + Intronic
975899880 4:79139550-79139572 CAAGACAGCAGACACTTGATTGG + Intergenic
975944841 4:79693908-79693930 GAAAACAGCAGATACTTGGTTGG + Intergenic
975951206 4:79773566-79773588 GAAGACAGCAGATACTTGGTTGG - Intergenic
975975498 4:80090974-80090996 GAAAACAACAGCTGGTTGGTTGG - Intronic
976157215 4:82159233-82159255 GAAGACAACAGATTGTTGGTTGG - Intergenic
976562595 4:86519535-86519557 GAAGACAGCAGATATTTGGTTGG + Intronic
976791449 4:88882741-88882763 GAAGATAGCAGATAGTTGGTTGG - Intronic
976888043 4:90009608-90009630 GAAGACAGCAGATACTTGGTTGG - Intergenic
976922205 4:90454678-90454700 GAAAGCAGCAGATAATTTGGGGG - Intronic
976962920 4:91001669-91001691 GAGAGCAACAGATAGTTGGTTGG + Intronic
977019799 4:91745102-91745124 GAAGACAGCAGGTAGTTGGTTGG + Intergenic
977474121 4:97483305-97483327 GAAGGCAGCAGATAGTTGGTTGG - Intronic
977511778 4:97971146-97971168 GAAAACAGCAGATGCTGGAGAGG + Intronic
977635712 4:99295535-99295557 GAAGACAGTAGGTACTTTGTTGG - Intergenic
977746970 4:100560483-100560505 GAAGGCAGAAGATACTTGGTTGG - Intronic
977762950 4:100761107-100761129 GGAGACAGCAGATAATTGATTGG - Intronic
977826250 4:101535225-101535247 GAAGACAGCAGATACTTGTTTGG - Intronic
977828928 4:101566712-101566734 GAAGACAACAGATACTTGGTTGG - Intronic
977905881 4:102477486-102477508 GAAGACAGCAGATACTTGGTTGG - Intergenic
978425813 4:108581157-108581179 CAAAACAGCAAATAATTGATAGG + Intergenic
978737156 4:112096994-112097016 AAAAACAGCAGATACTAGTGAGG + Intergenic
978916314 4:114129594-114129616 GAAGACAGAAGATACTTGGTTGG - Intergenic
978925110 4:114233394-114233416 GAAGACAGAAGATACTTGGTTGG - Intergenic
979020512 4:115490952-115490974 GAAGTCAGTAGATACTTGGTTGG - Intergenic
979029994 4:115631745-115631767 AAAGACAGCAGACACTTGATTGG + Intergenic
979159832 4:117446232-117446254 GAAGACAGCAGATACTTGGTTGG + Intergenic
979202013 4:117989710-117989732 GAAGACAGCAGTTACTTGGTTGG - Intergenic
979357170 4:119717940-119717962 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
979584653 4:122401903-122401925 GAAGACAGCAGAAATTTGGTTGG + Intronic
979705078 4:123711299-123711321 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
979712495 4:123796545-123796567 GAAGACAGCAGATACTTGGTTGG + Intergenic
979748533 4:124246705-124246727 AAAAATAGCAGATATTTGCTGGG - Intergenic
979790564 4:124775856-124775878 GAAGACAGCAGACACATGGCTGG + Intergenic
979794748 4:124833142-124833164 GAAGGCAGCAGATAGTTGGTGGG + Intergenic
979952494 4:126910792-126910814 TAAAACATCAGAGACTTGGATGG + Intergenic
979984658 4:127298607-127298629 GAAGACAGCAGACACTTGGTTGG - Intergenic
980033600 4:127858379-127858401 GAAGGGAGCAGATACTTGGTTGG - Intergenic
980087601 4:128407802-128407824 GAAGACAGCAGATACCTGGTTGG + Intergenic
980153026 4:129071712-129071734 GAAGGCAGCAGATAGTTGGTTGG + Intronic
980409779 4:132402147-132402169 GAAGACAGCAAATCCTTGGCTGG + Intergenic
980435170 4:132763355-132763377 GAAAAAAGCAGAAACTTTGATGG + Intergenic
980519132 4:133908376-133908398 GAAGACAGCAGATACTTGGTTGG + Intergenic
980644908 4:135631320-135631342 GAAGACAGCAGAAACTTAGTCGG + Intergenic
980860884 4:138498267-138498289 GAAGACAGCAGAAACTTGGTTGG + Intergenic
981230287 4:142345564-142345586 GACACAAGCACATACTTGGTGGG + Intronic
981346882 4:143686050-143686072 GAATGCAGCAGATAGTTGGTTGG - Intronic
981760597 4:148190887-148190909 GAAGGCAGCAGATAGTTGGTTGG + Intronic
981795698 4:148592940-148592962 GAAGACAGCAGATACATGGTTGG + Intergenic
982019492 4:151189407-151189429 TAAAACAACAGAAACTTGGCCGG - Intronic
982050063 4:151491720-151491742 GAAGACAGCAGATACTTGGTTGG - Intronic
982119419 4:152127255-152127277 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
982218581 4:153105325-153105347 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
982299338 4:153863323-153863345 GAAGTCAGCAGATATTTGATTGG + Intergenic
982451234 4:155554332-155554354 GAATACAGCAGATACTTGTTTGG - Intergenic
982451243 4:155554427-155554449 GAATACAGCAGATACTTGTTTGG - Intergenic
982451252 4:155554522-155554544 GAATACAGCAGATACTTGTTTGG - Intergenic
982617528 4:157659174-157659196 GAAAACAACAGATACTGGCAAGG + Intergenic
982647510 4:158042996-158043018 AAAAACAACAGATACTTGCAAGG + Intergenic
982829937 4:160046398-160046420 GAAGACAGCAGATACTTGGTTGG - Intergenic
982960216 4:161826803-161826825 AAAGACAGTAGGTACTTGGTTGG + Intronic
982991984 4:162287935-162287957 GAAGACAGCAGAAACTTGGTTGG - Intergenic
983277637 4:165637480-165637502 GAAGACAGCAGATATGTGGTTGG - Intergenic
983477331 4:168229947-168229969 GAAGACAGCAGATACTTGGTTGG - Intronic
983729670 4:170977586-170977608 GAAGACAGCAGATACTTGGTTGG + Intergenic
983749708 4:171251240-171251262 GAAGACAGCACATACTTCATTGG + Intergenic
983754839 4:171321994-171322016 GAAGACAGCAGATACTTGGTTGG - Intergenic
983826081 4:172262537-172262559 GAAGACAGCAGATAATTGTTTGG + Intronic
983845405 4:172512353-172512375 GAAGACAATAGATACTTGTTTGG + Intronic
983962889 4:173776234-173776256 GAAGAGAGTAGATACTTGGTTGG + Intergenic
984066707 4:175056895-175056917 GAGGACAGCAGATACTTGGTTGG - Intergenic
984325866 4:178249515-178249537 GGAAACAACAGATACTGGGGAGG - Intergenic
984598793 4:181703212-181703234 GAAACCAGGAGAGACTTGGCTGG - Intergenic
984721917 4:182980475-182980497 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
985008414 4:185558136-185558158 GAAGGCAGCAGATAGTTGATTGG + Intergenic
985093096 4:186383662-186383684 GAAAGCAGCAGCTAGTTGGTTGG - Intergenic
985108078 4:186518693-186518715 GAAGGCAGCAGAAACTTGGTTGG + Intronic
985240611 4:187927665-187927687 AAAGGCAGCAGATAGTTGGTTGG + Intergenic
985355935 4:189118884-189118906 GAATACAGCAGATATTTGGTTGG - Intergenic
985416940 4:189744763-189744785 AAAGACAGCAGATACTTGATTGG - Intergenic
985424349 4:189813673-189813695 GCAATTAGCACATACTTGGTGGG - Intergenic
985586130 5:736045-736067 GAAGACAGCAGATACTTGGTTGG - Intronic
985600549 5:827457-827479 GAAGACAGCAGATACTTGGTTGG - Intronic
986259188 5:6128044-6128066 GAAGACAGCAGAAACTTGGTTGG - Intergenic
986634221 5:9803966-9803988 GAAGACAGCAGAAACTTGGTTGG - Intergenic
986870419 5:12038559-12038581 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
987030220 5:13970206-13970228 GAAGATAAGAGATACTTGGTTGG + Intergenic
987223357 5:15813920-15813942 GAAAACAACAGATACTGGAGAGG + Intronic
987436671 5:17903801-17903823 GAAGACAGCAGATACTTGGTTGG + Intergenic
987440451 5:17949928-17949950 GAAGGTAGCAGATACTTGGTTGG + Intergenic
987563737 5:19557365-19557387 GAAGACAGCAGATACTTGGTTGG - Intronic
987577915 5:19754236-19754258 GAAGGCAACAGATACTTGGTTGG - Intronic
987640296 5:20603607-20603629 AAACACAGCAGAAACTTGGTAGG - Intergenic
987846527 5:23294484-23294506 GAAAATAGCACATACTTGGTTGG + Intergenic
987902069 5:24025238-24025260 GAAGACAGCAGATGCTTGGTTGG - Intronic
988124698 5:27014316-27014338 GAACTCTTCAGATACTTGGTCGG - Intronic
988278262 5:29111743-29111765 GAAGATAGCAGATACTTGATTGG + Intergenic
988652183 5:33165034-33165056 GAAGACAGCAGATACTTGGTTGG + Intergenic
988876085 5:35447450-35447472 GAAGATAGCAGTTACTTGCTTGG - Intergenic
988902425 5:35747415-35747437 GACAGCAGCAGATAGTTGGTTGG - Intronic
988922469 5:35956211-35956233 GAAAACAGCACATACAGTGTAGG - Intronic
988929564 5:36023745-36023767 GAATCCAGCAGACACTTGGTTGG + Intergenic
989355293 5:40537563-40537585 GAAGACAACAGAAACTTGTTTGG + Intergenic
989533616 5:42538072-42538094 GAAGGCAGCAGATACTTGGTTGG + Intronic
989562589 5:42869074-42869096 GAAGACAGCAGAAACTTGCTTGG + Intronic
989727634 5:44605571-44605593 GAAGAGAGCAGATACTTGTTTGG - Intergenic
989818097 5:45761277-45761299 AGACACAGGAGATACTTGGTTGG + Intergenic
990233532 5:53741076-53741098 GAAGGCAGCAGATAGTTGATTGG - Intergenic
990638171 5:57752256-57752278 GACAACAGCATATATTTTGTAGG - Intergenic
990775941 5:59306303-59306325 GAAGGCAGCAGATAGTTGGTTGG + Intronic
990891658 5:60657205-60657227 GAAAATAACAGATACTTGGTTGG + Intronic
991154493 5:63415382-63415404 GAAAACAGCTGAGTCTTGATTGG - Intergenic
991451514 5:66755926-66755948 TAAAACAGCATATAATGGGTGGG + Intronic
991543352 5:67753876-67753898 GAAGACAGCAGATACTTGATTGG - Intergenic
991624444 5:68585411-68585433 GATAACAGCACATACTTTGTAGG - Intergenic
991924069 5:71686162-71686184 GAAAGCAGCAGATAGTTGGTTGG - Intergenic
992335853 5:75768743-75768765 GAAGACAGCAGATACTTGGTTGG + Intergenic
992339899 5:75812771-75812793 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
992887801 5:81176352-81176374 GAAAATAGCAAATATTTGGGGGG + Intronic
992898833 5:81272157-81272179 GAAGACAGTGGATACTTGGTTGG - Intergenic
993269275 5:85773087-85773109 GAAGACAGCAGATACTTGGTTGG + Intergenic
993365822 5:87033149-87033171 GAAGACAGCAGATACTTGGTAGG + Intergenic
993429839 5:87818484-87818506 AAAAACAGCAGACAATTAGTTGG + Intergenic
993606910 5:90002283-90002305 GAAGACAGCAGATATTTGGTTGG - Intergenic
993646300 5:90467588-90467610 GAAGACAGCAGAAACTTGGTTGG + Intronic
993796850 5:92277739-92277761 GAAGACAGCGTATACTTGGTTGG - Intergenic
993883697 5:93393002-93393024 GAAGGCAGCAGATAGTAGGTTGG + Intergenic
993917249 5:93757972-93757994 GAAGGCAGCAGATAGTTGGTTGG - Intronic
993964972 5:94349025-94349047 AAAGACAGCAGATAGTTGGTTGG - Intronic
994018109 5:94992058-94992080 GTTAACAGCAGTCACTTGGTAGG + Intronic
994034194 5:95179870-95179892 GAAGACAGTAGAAACTTGGTTGG - Intronic
994208032 5:97057834-97057856 AAAGGCAGCAGGTACTTGGTTGG + Intergenic
994220652 5:97191503-97191525 GAAGTCAGCAGTTAGTTGGTTGG + Intergenic
994304229 5:98182461-98182483 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
994347403 5:98702740-98702762 GAAGACCGAAGATACTTGGTTGG - Intergenic
994496742 5:100522118-100522140 GAAGACAGCAGAAACTTGCTTGG - Intergenic
994636261 5:102347570-102347592 GAAGACAGAAGACACTTGGTTGG - Intergenic
994777977 5:104059693-104059715 GAAGACTGCAGATACTTGGTTGG + Intergenic
994883437 5:105527926-105527948 GAAGGCAGAAGATAGTTGGTTGG + Intergenic
994887543 5:105583547-105583569 GAAGACAGTGAATACTTGGTTGG - Intergenic
995082928 5:108075132-108075154 AAAAACTGCAAATACTTTGTTGG + Intronic
995450958 5:112300059-112300081 GAAGGCAGCAGATACCTGGTTGG + Intronic
995699117 5:114914147-114914169 GAAGACAGCAGATACTTGGTTGG - Intergenic
995722704 5:115153113-115153135 GAAGGCAGCAGATAGTTGGTTGG - Intronic
995818013 5:116193394-116193416 GAAGGCAGCAGATAGTTTGTTGG - Intronic
995955520 5:117771701-117771723 GAAGGCAGCAGATGGTTGGTTGG - Intergenic
995968845 5:117942350-117942372 CAGAACAGCACATACGTGGTAGG + Intergenic
996032159 5:118717456-118717478 GAAGGCAGCAGCTAGTTGGTTGG - Intergenic
996123851 5:119703277-119703299 AAAGGCAGCAGATAGTTGGTTGG + Intergenic
996141136 5:119911188-119911210 GAAGACAGCAGATACTTGGTTGG + Intergenic
996197985 5:120633447-120633469 GAAGACAGCAGAAACTTGGTTGG - Intronic
996240903 5:121200208-121200230 CAAAACACCAGAAACTGGGTAGG + Intergenic
996279619 5:121712893-121712915 GAAGACAGCAGGTACTTAGTTGG - Intergenic
996326812 5:122284699-122284721 TAAGACAGTAGATATTTGGTTGG + Intergenic
996608825 5:125355708-125355730 CAAGATAGCAGATACTTGGTTGG + Intergenic
996657283 5:125956157-125956179 GAAGACAGTAGAAACTTGGCTGG - Intergenic
996780064 5:127175719-127175741 AAAGACAGTAGTTACTTGGTTGG + Intergenic
996875188 5:128233351-128233373 GAAAATAGCAGAAACTTGGTTGG + Intergenic
997003891 5:129796150-129796172 GAAGACAGCAGAAACTTTGTTGG + Intergenic
997761122 5:136448315-136448337 GAAGGCAGCAGGTAGTTGGTTGG - Intergenic
997765383 5:136498281-136498303 GAAGGCAGCAGACAGTTGGTTGG + Intergenic
997901050 5:137764737-137764759 GAAGACAGTAGATACTTGGTTGG - Intergenic
998703184 5:144729238-144729260 GAAGACAGCAGATACTTGATAGG + Intergenic
998741816 5:145211932-145211954 GAACACAGCAGACACTTGGTTGG - Intergenic
998758787 5:145409448-145409470 GATGACAGCAGATACTTGGTTGG - Intergenic
999086293 5:148893626-148893648 GAAGACAGCATATGCTTGGTTGG - Intergenic
999108859 5:149097716-149097738 GAAGACAGCAGATACGTGGTTGG - Intergenic
999337704 5:150736841-150736863 GAAGACGGCAGATACTTGGTTGG - Intronic
999484502 5:151982077-151982099 GAAGGCAGCAGATAGTTGTTTGG + Intergenic
999490950 5:152051279-152051301 GAAGACAGCAGATACTTGGTAGG + Intergenic
999801077 5:155037286-155037308 GAAAGCAGAAGATAGTTGCTTGG + Intergenic
999818816 5:155203857-155203879 GAAGGCAGCAGATAGGTGGTTGG - Intergenic
999839108 5:155405080-155405102 GAAGACAACAGATACTTGGTTGG - Intergenic
999913176 5:156228555-156228577 GAAGGCAGCAGATAGTTGGCTGG + Intronic
999930607 5:156429425-156429447 GAAGACAGCAGATATTTGGTTGG + Intronic
1000158867 5:158580081-158580103 GACCACAGCAGAAACTTGATTGG + Intergenic
1000525413 5:162351801-162351823 GAAGACAGCAGATTTTTGGTTGG + Intergenic
1000779938 5:165467407-165467429 GAAGGCAGCAGAGAATTGGTTGG - Intergenic
1000831362 5:166105240-166105262 GAAAACAGTAAATATTAGGTTGG - Intergenic
1001176974 5:169479230-169479252 GAATGCAGCAGATCCTTGGTTGG + Intergenic
1001290897 5:170458936-170458958 GAAGGCAGCAGATAGCTGGTTGG - Intronic
1001733565 5:173979717-173979739 GAAGACAGTAGATACTTGGTTGG + Intronic
1001805909 5:174585992-174586014 AAAAACAGCAGATACTGGTGAGG - Intergenic
1002814059 6:661879-661901 GAAGGCAGCAGATTGTTGGTTGG - Intronic
1002849203 6:977759-977781 GAAGACAGTAGATACTTGGTTGG + Intergenic
1002907118 6:1457639-1457661 GAAAACTGCAAATGCTTTGTTGG + Intergenic
1003029233 6:2587487-2587509 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1003063346 6:2879511-2879533 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1003451078 6:6232177-6232199 GAAGGCAGCAGACAGTTGGTTGG - Intronic
1003465141 6:6372324-6372346 AAAAACAACAGATACTTGGTTGG - Intergenic
1004096768 6:12562749-12562771 GAAGACAGCAGATACTTGGTTGG - Intergenic
1004138533 6:12991981-12992003 GAAAATAGCAGATACTAATTAGG - Intronic
1004151980 6:13129384-13129406 GAAGACAGCAGATATTTGGTTGG - Intronic
1004600296 6:17143338-17143360 GAAGACAACAGATATTTGGTTGG + Intergenic
1004888725 6:20076657-20076679 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1005107531 6:22240682-22240704 GAAGACAGAAGGAACTTGGTTGG - Intergenic
1005244285 6:23863900-23863922 AAAGACAGCAGAAACTTGGTTGG - Intergenic
1005259278 6:24040775-24040797 GAAACCAGTAGATACATGGTTGG + Intergenic
1005691342 6:28309643-28309665 GAAGACAGCAGATACTTCTTTGG + Intergenic
1005929506 6:30472834-30472856 GAAGACAGCAAATACTTAGTTGG - Intergenic
1006062786 6:31437634-31437656 GAAGACAGCAGATACTCGATTGG + Intergenic
1006203422 6:32317798-32317820 GAAAATAACAGATACTGGGGAGG + Intronic
1006587419 6:35125504-35125526 GAAAACAGCAAATGCTGGCTAGG + Intronic
1007891089 6:45292556-45292578 GAAGGCAGCAGATAATTGGTTGG - Intronic
1007892858 6:45312053-45312075 GAAGGCAGCAGATAATTGGTTGG - Intronic
1008042106 6:46813461-46813483 GAAGACAGCAGAAACTTGGTTGG + Intronic
1008171880 6:48217917-48217939 GAAGGCAGCAGATACTTGGTTGG - Intergenic
1008185594 6:48386766-48386788 GAAGGCAGCAGATATTTGGGTGG + Intergenic
1008190482 6:48450667-48450689 GAAAGCAGCAGATCCTTGATTGG + Intergenic
1008231420 6:48988757-48988779 GAAGACACCAGATACTTGGTTGG - Intergenic
1008305508 6:49894128-49894150 GAAGGCAGCAGAGAGTTGGTTGG - Intergenic
1008736115 6:54546044-54546066 GAATGCAGCAGATAGCTGGTTGG + Intergenic
1008775227 6:55030282-55030304 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1008973386 6:57396565-57396587 GAAGGCAGCAGATAATTGGTTGG + Intronic
1009162289 6:60298109-60298131 GAAGGCAGCAGATAATTGGTTGG + Intergenic
1009360110 6:62801103-62801125 GAATATAGCAGATACTTGGGTGG + Intergenic
1009644487 6:66380014-66380036 AAAGAAACCAGATACTTGGTTGG - Intergenic
1009779642 6:68253851-68253873 GAAGATACCAGATACTTGGTCGG + Intergenic
1009800068 6:68526041-68526063 GAAGACAGTGGACACTTGGTTGG + Intergenic
1010015340 6:71099472-71099494 GAAGACAGCAGATATTTGGTTGG + Intergenic
1010017219 6:71119374-71119396 GAAGACATCAGTTACTTGGTTGG + Intergenic
1010045492 6:71438120-71438142 GAAGACAGCAGATAGATGGTTGG - Intergenic
1010076171 6:71801584-71801606 GAAGGCAGCAGATTGTTGGTTGG + Intergenic
1010164904 6:72904267-72904289 AAAGGCAGCAGATAGTTGGTTGG + Intronic
1010181702 6:73094313-73094335 GAAGTCAGCAGGTAGTTGGTTGG + Intronic
1010458995 6:76092073-76092095 GAAGACAGCAGATACTTGGTTGG + Intergenic
1010479682 6:76336284-76336306 GAAGAGGGCAGATACTTGGTTGG + Intergenic
1010707580 6:79133340-79133362 GAAGGCAGCAGATCGTTGGTTGG + Intergenic
1010789504 6:80048732-80048754 GAAAACAACAGATACTGGAGAGG - Intergenic
1010801695 6:80184360-80184382 ACAGACAGTAGATACTTGGTTGG + Intronic
1010976095 6:82315128-82315150 GAAGACAGCAAATACTTGGGTGG - Intergenic
1011005439 6:82639340-82639362 GAAGACAGCAGATACTTGGTTGG - Intergenic
1011132939 6:84070978-84071000 GAAGACAGCAGGTAGTTGGTTGG + Intronic
1011199376 6:84818221-84818243 GGAAACAGCAGATACTGGAGAGG - Intergenic
1011210344 6:84949304-84949326 CAAGACAGCAGATACTTGGTTGG + Intergenic
1011233509 6:85189679-85189701 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1011321016 6:86093641-86093663 AAAAACAGCAGATACTTGGTTGG + Intergenic
1011328885 6:86182091-86182113 GAAGGCAGCAGATAGTTGTTTGG + Intergenic
1011365907 6:86582510-86582532 GAAAACAGCAGATACTTCATTGG + Intergenic
1011394808 6:86895083-86895105 GTAGGCAGCAGATAGTTGGTGGG - Intergenic
1011636949 6:89383397-89383419 AAAAAAAGAAAATACTTGGTTGG + Intronic
1011725155 6:90203747-90203769 GATGACAGCAGATTCTTGATGGG + Intronic
1011893113 6:92192301-92192323 GAAGGCAGCAGATGGTTGGTTGG + Intergenic
1011965636 6:93154453-93154475 GAACACAGGAGAGACTTGGTTGG + Intergenic
1012022963 6:93949231-93949253 GAAAGCAGCAGATATATGGCAGG + Intergenic
1012203215 6:96432193-96432215 GAAGACAGCAGATATCTGGTTGG + Intergenic
1012204568 6:96444459-96444481 GAAGACAGCAGATAGTTGGTTGG - Intergenic
1012273385 6:97242503-97242525 GGAGACAGCAGATACTTGGTTGG + Intronic
1012302798 6:97610715-97610737 GAAGACAGCAGATACTTGGTTGG + Intergenic
1012684802 6:102232605-102232627 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1012793991 6:103736490-103736512 GAAGACAGCAGATAGTTTGTAGG - Intergenic
1012870036 6:104661445-104661467 GAAGAACGCAGATACTTGGTTGG - Intergenic
1012922923 6:105237808-105237830 GAAGGTAGCAGATAGTTGGTTGG - Intergenic
1012965835 6:105671644-105671666 GAAGACAACAGATACTTGGTTGG - Intergenic
1013029217 6:106314702-106314724 TAAAACAGCAAAAACTTGTTTGG + Intronic
1013495624 6:110694219-110694241 GAAGACAGCAGATACTTGGTTGG - Intronic
1013635797 6:112028045-112028067 GAAACCTGCATATACTTGGTAGG + Intergenic
1013686258 6:112587499-112587521 AAGGACAGCAGATACTTGGTTGG + Intergenic
1013720870 6:113026812-113026834 GAAGGCAGCAGATAATTGGTTGG + Intergenic
1013852450 6:114532846-114532868 GAAGGCAGCAGATAGTTGTTTGG + Intergenic
1013856897 6:114583464-114583486 GAAGGCAGCAGATACTTGGTTGG - Intergenic
1013900809 6:115154399-115154421 GAACGCAGCAGATAGTTGGTTGG + Intergenic
1013940877 6:115660384-115660406 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1013985354 6:116185780-116185802 GAAGACAGCAGATACTTGGTTGG + Intronic
1014304651 6:119725690-119725712 GAAGACAGCAGATAGTTGGTTGG + Intergenic
1014312962 6:119828649-119828671 AAAGACAGCAGATACCTGGTTGG + Intergenic
1014337021 6:120149277-120149299 GAAGGCAGCAGATAATTGGTTGG - Intergenic
1014421210 6:121247543-121247565 GAAGACAGCAGATATTTTGCTGG - Intronic
1014481861 6:121949199-121949221 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1014531196 6:122561829-122561851 GAAGTCAGCAGGTAGTTGGTTGG + Intronic
1014566746 6:122958173-122958195 AAAGATAGCAGATACTTTGTTGG - Intergenic
1014581567 6:123143818-123143840 GAAGACAGCAGATACTTGGTTGG - Intergenic
1014604093 6:123450311-123450333 AAAGGCAGCAGATAGTTGGTTGG - Intronic
1014658435 6:124135351-124135373 GAAGATAGCAGATACTTGGTTGG - Intronic
1014739228 6:125127674-125127696 GAAGGCAGCAGATAGTTGATTGG - Intronic
1014749757 6:125242705-125242727 GAAGACAGCAGATACTTGGTTGG + Intronic
1014792590 6:125691541-125691563 GAAGACAGCAGGTACTTGGTTGG + Intergenic
1014878211 6:126687346-126687368 GAATACAGCAGATACTTGGTTGG - Intergenic
1015348052 6:132182469-132182491 GAAGACAGCAGATACTTGGTTGG - Intergenic
1015362177 6:132353054-132353076 GAAGGCAGCAGATAGTTGATTGG + Intronic
1015663117 6:135598639-135598661 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1015849604 6:137558362-137558384 GAAGGCAGCAGGTACTTGGTTGG + Intergenic
1015877774 6:137841266-137841288 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1015900047 6:138055184-138055206 GAAGGCAGCAGATACTTGGTTGG - Intergenic
1016018107 6:139206723-139206745 GAAGACAGCAGACACTTGGTTGG - Intergenic
1016176075 6:141078940-141078962 GATGACAGCATATACTTAGTTGG - Intergenic
1016197262 6:141359708-141359730 GAAGGCAGCAGATAGTTGATTGG + Intergenic
1016216137 6:141606175-141606197 GAAGACAGCAGACATCTGGTTGG + Intergenic
1016289773 6:142516517-142516539 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1016351561 6:143174614-143174636 GAAGACACCAGATACTTGGTTGG + Intronic
1016425399 6:143931219-143931241 GAAGACAACAGATACTTCATCGG + Intronic
1016484857 6:144526595-144526617 GAAGACAGCAGTTACTTGGTTGG + Intronic
1016909939 6:149188696-149188718 GAAGGCAGCAGACATTTGGTTGG + Intergenic
1017190293 6:151646596-151646618 GAAGGCAACAGATAGTTGGTTGG + Intergenic
1017214751 6:151897596-151897618 GAAGGCAGCAGATACTTGGTTGG + Intronic
1017280126 6:152614476-152614498 GAAAACAACAGATGCTGGGGAGG + Intronic
1017535115 6:155339224-155339246 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1018781591 6:167072420-167072442 GAAAACAGCAGATACTTGGTTGG + Intergenic
1018974343 6:168553947-168553969 GAAAAACGCTGATACCTGGTGGG - Intronic
1018974358 6:168554049-168554071 GAAAAAAGCTGATACCTGGTGGG - Intronic
1019108900 6:169693560-169693582 GAAGACACCAGATACTTGATTGG - Intronic
1019122905 6:169818803-169818825 GAAGACAGCAGATACTTGATTGG + Intergenic
1020332181 7:7030660-7030682 GAAGACAGCAGATACTTGATTGG + Intergenic
1020635094 7:10686785-10686807 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1020866684 7:13573074-13573096 GAAGACTGCAGAAACATGGTGGG + Intergenic
1020873392 7:13663144-13663166 GAAGACAGCAGATACTTGGTTGG - Intergenic
1020995639 7:15260237-15260259 GAAGACAGCAGAAACTTGGTTGG - Intronic
1021081715 7:16372761-16372783 GAAGACAGCAGATACTTGGTTGG - Intronic
1021138318 7:16992680-16992702 GAAAACATCAGAATGTTGGTGGG + Intergenic
1021204481 7:17763624-17763646 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1022091337 7:27109904-27109926 GAAAACACCAGAGACCTGCTGGG - Intronic
1022295540 7:29048292-29048314 GAAGGCAGCAGATAGTTGGTTGG - Intronic
1022564971 7:31390248-31390270 GAAGACAGCAGATAGTTGGTGGG + Intergenic
1023144559 7:37136994-37137016 GAAGGCAGCAGAAACTTGGTTGG - Intronic
1023657449 7:42439134-42439156 GAAGACAGCAGAAACTTAGTTGG + Intergenic
1023748771 7:43349765-43349787 GAAGGCAGCAGATAGTTGGTTGG + Intronic
1024174932 7:46829430-46829452 AAAGACAACAGATACTTGGTTGG - Intergenic
1024244824 7:47461334-47461356 GGAGACAGCAGATCCATGGTTGG - Intronic
1024304671 7:47918061-47918083 GAAGGCAGCAGATCGTTGGTTGG - Intronic
1024327819 7:48125427-48125449 GAAGATAGCAGATACTTGGTTGG + Intergenic
1024419454 7:49146038-49146060 GAAGACAGCAGATACTTGGTTGG - Intergenic
1024665428 7:51542285-51542307 GAAGACAGCAGATTCTTGATTGG + Intergenic
1024669099 7:51575712-51575734 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1024782501 7:52867363-52867385 GAAGACAGCAGACATTTGGTTGG - Intergenic
1024840214 7:53576729-53576751 GAAGGCAACAGATACTTGCTTGG - Intergenic
1024876033 7:54024763-54024785 GAAGACAGCAGGTACTTGGTTGG + Intergenic
1024917029 7:54513460-54513482 GAAGGCAGCAGATGGTTGGTTGG + Intergenic
1024946967 7:54818377-54818399 GAAGACAGCAGAAACGTGGTTGG + Intergenic
1025601323 7:63000523-63000545 GAAAAAAGGAGATACTTGATTGG - Intergenic
1025807370 7:64847766-64847788 GAAGACAGCAGATAATTGGCTGG + Intergenic
1027328840 7:77069916-77069938 TCAAGCAGCAGATAGTTGGTTGG + Intergenic
1027417456 7:77988471-77988493 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1027563003 7:79756026-79756048 GAAGACAACAGAAACTTGGTTGG + Intergenic
1027641131 7:80735168-80735190 AAAAACAACAGATACTGGGGAGG + Intergenic
1027948310 7:84779844-84779866 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1028068025 7:86412908-86412930 GTAAACATCAGAGTCTTGGTTGG + Intergenic
1028305021 7:89252380-89252402 GAAAACAGTAGATGCTTGAGAGG + Intronic
1028502068 7:91529733-91529755 GAAGATAGCAGAAACATGGTCGG - Intergenic
1028529457 7:91822852-91822874 AAAGACAGCAAATACTTGGTTGG + Intronic
1028783067 7:94759156-94759178 GAAGACAGTAGATACTTGGTTGG - Intergenic
1028792738 7:94871869-94871891 AAAGACAGCACATACTTGGCTGG + Intergenic
1028818494 7:95177609-95177631 GAAGGCAGCAGATAGTTGGTTGG - Intronic
1028819328 7:95188397-95188419 GAAGATAGCATATACTTGGTTGG + Intronic
1028822726 7:95230983-95231005 GAAGACAGCAGAAACTTGATTGG - Intronic
1028936679 7:96472653-96472675 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1029053356 7:97713187-97713209 GAAGGCAGCATATACTTGGTTGG - Intergenic
1030456055 7:109775034-109775056 GAAGACAGAGGATACTTGGTTGG - Intergenic
1030533633 7:110739290-110739312 GAAGACAGCAGAAACTTGGTTGG - Intronic
1030761030 7:113352023-113352045 GAAAGCGGAAGATACTTGGGAGG + Intergenic
1030936190 7:115587116-115587138 GAAGGCAGTAGATATTTGGTTGG - Intergenic
1030972508 7:116077501-116077523 GAAGAAAGCAGAAACTTGGTTGG - Intronic
1031090248 7:117346160-117346182 GAAGACAGCAGATACTTGGTTGG + Intergenic
1031220214 7:118956132-118956154 GAAGACAACAGATTCTTGGTTGG + Intergenic
1031309099 7:120171900-120171922 GAAAGGAGCAGATGATTGGTTGG - Intergenic
1031479621 7:122262554-122262576 GAAAACTGGAGGTACTAGGTGGG - Intergenic
1031594579 7:123634219-123634241 GGGAACAGCACATACTGGGTGGG - Intronic
1031675970 7:124612334-124612356 GAAGACAGCAGATACTTGGTTGG - Intergenic
1031761070 7:125714233-125714255 GAAGGCAGCAGATGGTTGGTTGG + Intergenic
1031796730 7:126184653-126184675 GAAGAGAGCAGATACTTAGTTGG + Intergenic
1031828116 7:126591104-126591126 GAAGGCAGCAGATACTTAGTTGG - Intronic
1032898525 7:136279998-136280020 GAAATCAGAAGATACAGGGTGGG - Intergenic
1033027013 7:137784198-137784220 GAAGACAGCAGAAACTTGGTTGG - Intronic
1033259180 7:139827374-139827396 GAAGGCAGCAGATAGTTAGTTGG + Intronic
1033259815 7:139833219-139833241 GAAGGCAGCAGATAGTTGGTTGG - Intronic
1033400930 7:141024399-141024421 GAAGACAGCAGATATTTGGTTGG + Intergenic
1033816491 7:145080565-145080587 GAAGACAGTAGATACTTGGTTGG + Intergenic
1033901405 7:146145428-146145450 GAAAAGAGTAGATACTGGGCAGG + Intronic
1033961398 7:146918096-146918118 GAAGACAGCAGCTACTTGGTTGG + Intronic
1034019748 7:147628701-147628723 GAAGACAGCAGATATTTTGTTGG - Intronic
1034705313 7:153137760-153137782 GAAGGCAGCAAATACTTGGTTGG + Intergenic
1035121748 7:156574089-156574111 GCAGACAGAAGATATTTGGTTGG + Intergenic
1035399284 7:158554342-158554364 GAAACCAGGAGACAATTGGTTGG + Intronic
1035591259 8:816123-816145 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1036012374 8:4741104-4741126 GAAAAGAGGAGATACTAGGATGG - Intronic
1036108609 8:5873454-5873476 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1037253417 8:16923605-16923627 AAATACAGCGGATACCTGGTGGG - Intergenic
1037320640 8:17639175-17639197 CAAAACAGCAGATACTTGGTTGG + Intronic
1037713412 8:21374759-21374781 GAAGGCAGCAGATAATTTGTTGG + Intergenic
1038366967 8:26946350-26946372 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1038635451 8:29282981-29283003 AGAAACAGCACATACTTGATGGG - Intergenic
1039030290 8:33301413-33301435 GAAGACAGAAGATACTTTCTTGG - Intergenic
1039083100 8:33753583-33753605 GAAGGCAGCAGATAGTTGCTTGG + Intergenic
1039144906 8:34436820-34436842 GAAGACAGTAGATACTTGGTTGG + Intergenic
1039226603 8:35395440-35395462 GAAAACAGGAGATAGTGGGGTGG + Intronic
1039492183 8:37956111-37956133 GAAAACAGCCGTTCCCTGGTGGG + Intergenic
1039642545 8:39239652-39239674 AAAGACAGCAGATACCTGTTTGG - Intronic
1039763687 8:40606089-40606111 GAAGACAGTGGATACTTGGTTGG + Intronic
1039811327 8:41051225-41051247 GAAGACAGCAGATACTTGGTTGG - Intergenic
1040362554 8:46681321-46681343 GAAGACAGCAGATATTTGGTTGG + Intergenic
1040626532 8:49156213-49156235 GGAGACAGAAGATACTTAGTTGG - Intergenic
1040635477 8:49268691-49268713 GAAGACAGCAGATTATTGGTTGG + Intergenic
1040670912 8:49689604-49689626 GAAGACAGCAGATACTTGGTTGG + Intergenic
1040800438 8:51333574-51333596 GAAGGCAGCAGATAGTTGGTTGG - Intronic
1040989371 8:53333337-53333359 GAAAACAGCAGATACTTGGTTGG + Intergenic
1041150507 8:54927654-54927676 GAAGAAAGCAAATGCTTGGTTGG - Intergenic
1041227968 8:55718950-55718972 GAAGGCAGCAGATGGTTGGTTGG - Intronic
1041637311 8:60158282-60158304 GAAGGCAGAAGATAGTTGGTTGG - Intergenic
1041832215 8:62166775-62166797 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1041897325 8:62939985-62940007 GAAGACAGAAGAGACTTGGTTGG - Intronic
1042084380 8:65091630-65091652 GAAGATAGCAGATACTTGGTTGG - Intergenic
1042088795 8:65135685-65135707 GAAGGCAGCAGATAGTTGTTTGG - Intergenic
1042122632 8:65505330-65505352 GAAGGCAGCAGATAGTTGGCTGG + Intergenic
1042431584 8:68712416-68712438 GAAGACAGCAGAAACTTGGTTGG - Intronic
1042465479 8:69125360-69125382 GAAGATGACAGATACTTGGTTGG + Intergenic
1042608170 8:70567529-70567551 GGAGACAGCAGATACTTGGTTGG - Intergenic
1042645360 8:70980541-70980563 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1042728840 8:71908754-71908776 GAAGACAGAAGATTCTTGGTTGG + Intronic
1042897029 8:73681702-73681724 GAAAACAGCAGATACTTGGTTGG - Intronic
1043040971 8:75261412-75261434 GAAAGTAGCAGATAGTTCGTTGG - Intergenic
1043121486 8:76330926-76330948 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1043545301 8:81308365-81308387 GAAGACAGCAGAAACTAGGTGGG - Intergenic
1043556534 8:81437183-81437205 GAAGACAGCAGAAATTTGGTTGG + Intergenic
1043679097 8:82998869-82998891 GAAAAGAGCACATACTTGTTTGG - Intergenic
1043876184 8:85489446-85489468 GAAGACAGGAGAAACTTGGTTGG + Intergenic
1043985653 8:86692640-86692662 GAAGACAGCAGACACTTGGTTGG + Intronic
1043988032 8:86716945-86716967 GAAGACACCAGACACTTTGTTGG - Intronic
1044227792 8:89738750-89738772 GAAGGGAGCAGATATTTGGTTGG - Intergenic
1044239275 8:89869794-89869816 GAAAACAGCAAATAGGTGGAGGG - Intergenic
1044292076 8:90484067-90484089 GAAGACAGCATATACTTGGTTGG - Intergenic
1044334686 8:90966532-90966554 AAAGACAGCAGAGACTTGGTTGG - Intronic
1044657150 8:94560785-94560807 GAAGATAGCAGATACTTGGTTGG + Intergenic
1044903521 8:96974096-96974118 GAAGACAGCAGAAACTTGGTTGG - Intronic
1044947690 8:97406274-97406296 GAAGACAGCAGAAATTTGGTTGG + Intergenic
1045671231 8:104555395-104555417 GCAGACAGCAGATACGTGGTTGG - Intronic
1045780015 8:105851597-105851619 GAAGGCAGCAGATGGTTGGTTGG - Intergenic
1045814101 8:106259714-106259736 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1045878125 8:107006281-107006303 GAAGACAGCAGATACTTGGTTGG - Intergenic
1046033715 8:108815654-108815676 GAAGACAGCAGACACTTGGTTGG + Intergenic
1046369392 8:113281572-113281594 GAAGGCAGCAGATAGTTGGTTGG + Intronic
1046448830 8:114360271-114360293 GAAGACGGTAGATACTTTGTTGG - Intergenic
1046962833 8:120127792-120127814 GAAAACAGCAGTCATTTGGCTGG - Intronic
1047148020 8:122227593-122227615 GAAGACAGCAAATACTTAGTTGG - Intergenic
1047227134 8:122966064-122966086 GAAGACAGCAGATACTTGGTTGG + Intronic
1047592199 8:126338430-126338452 GAAGACAGCAGATACTTGGTTGG - Intergenic
1047607099 8:126486182-126486204 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1047798156 8:128279208-128279230 GAAGACAGCAGATACTTTGTCGG - Intergenic
1047890257 8:129301133-129301155 GAAGACAGAAGAAACTTGGTTGG + Intergenic
1047937235 8:129794675-129794697 GAAGACAGCAGATATTTGGTTGG + Intergenic
1048120247 8:131572536-131572558 AAAGGCAGCAGATACTTGGTTGG + Intergenic
1048184936 8:132231128-132231150 GAAAACAGCAGAAGCTGGGAAGG + Intronic
1048530854 8:135249031-135249053 GAAGACAGCAGAAATTTGGTTGG + Intergenic
1049485814 8:142859834-142859856 GAAAACAACAGATACTGGCATGG - Intronic
1049833939 8:144720997-144721019 CAAAAGTGGAGATACTTGGTAGG + Intronic
1049869540 8:144963619-144963641 GAAGGCAGCAGATACTTGGTTGG + Intergenic
1049897906 9:127593-127615 GAAGGCAACAGATAGTTGGTTGG + Intronic
1050133425 9:2437437-2437459 GAAGAAAGCAGATACTTGGTTGG + Intergenic
1050502887 9:6317084-6317106 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1050903717 9:10977058-10977080 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1051277737 9:15413700-15413722 GAAGGCAGCAGATAGCTGGTTGG + Intergenic
1051601166 9:18876155-18876177 GAAGACAGCAGATACTTGGTTGG + Intronic
1051687511 9:19673780-19673802 GAAAACAGCAGATACTTGGTTGG + Intronic
1051816758 9:21117672-21117694 GAAGACAGCAGAAACTTGATTGG + Intergenic
1051881352 9:21842991-21843013 GAAGACTGCAGATACTTAGTTGG - Intronic
1051929652 9:22369218-22369240 GAAGACAGCAGATACTTGGTTGG - Intergenic
1052006475 9:23355860-23355882 GAAGACAGTAGATACTTAGTTGG + Intergenic
1052053012 9:23870003-23870025 GAAGACTGCAGATACTTGGTTGG - Intergenic
1052167013 9:25343520-25343542 GAAAATAGCAGAGACTGGGAAGG + Intergenic
1052307421 9:27026062-27026084 GAAGATGGGAGATACTTGGTTGG - Intronic
1052537321 9:29763375-29763397 GAAGACAGCAGATAGTTGGTTGG - Intergenic
1052550077 9:29937120-29937142 GAAGACAGTAGATAGTTGGTTGG + Intergenic
1052624719 9:30960621-30960643 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1053126745 9:35587242-35587264 GAAGACAGCAGAAATTTGGTTGG - Intergenic
1053162379 9:35822230-35822252 GAAAAGGGTAGATGCTTGGTAGG - Intronic
1053231503 9:36414157-36414179 GAAGACAGCAGATACTTGGTTGG + Intronic
1053740985 9:41137886-41137908 GAAGGCAACAGATAGTTGGTTGG + Intronic
1053753354 9:41278207-41278229 GAAGGCAGCAGATAGTTAGTTGG + Intergenic
1054332901 9:63777470-63777492 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
1054687364 9:68293411-68293433 GAAGGCAACAGATAGTTGGTTGG - Intronic
1054844626 9:69780809-69780831 GAAGACCGCAGATACTTGGTTGG + Intergenic
1054938992 9:70719604-70719626 GAAGATAACAAATACTTGGTTGG - Intronic
1054940683 9:70737597-70737619 GAAGATAACAAATACTTGGTTGG - Intronic
1055125140 9:72710757-72710779 GAAGACAGCAGATACTTAGTTGG + Intronic
1055138099 9:72846150-72846172 GAAGACAGCAAATACTTGGTTGG - Intergenic
1055156498 9:73068783-73068805 GAAGACAGCAGAAACTTAATTGG - Intronic
1055846721 9:80573845-80573867 GAAGACAGCAGACACTTGGTTGG - Intergenic
1056025815 9:82494231-82494253 TGAGGCAGCAGATACTTGGTTGG + Intergenic
1056026867 9:82506851-82506873 GAAGACAGCAGATATTTAGTTGG - Intergenic
1056035633 9:82601789-82601811 GAAAAAAGCAGATGTTGGGTTGG + Intergenic
1056396889 9:86189427-86189449 GAAGACAGCAGAAACTTAGTTGG - Intergenic
1056671874 9:88636964-88636986 GAAGTCAGCAGATATTTGGTTGG + Intergenic
1056698850 9:88885315-88885337 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1056736165 9:89211287-89211309 GAAAACAGCAAGTACTCAGTTGG + Intergenic
1056948259 9:91019549-91019571 GAAGACAGCAGATACCTGGTTGG - Intergenic
1057004014 9:91539776-91539798 GAAGACAGCAGGTAGTTGGTTGG - Intergenic
1057475901 9:95401232-95401254 GAAAACAGCAGATACTTGGTTGG - Intergenic
1058156539 9:101522630-101522652 GAAGGCAGCAGATAGTTGGTTGG + Intronic
1058233761 9:102463272-102463294 GAAAACAGCAGAAACTTGGCTGG - Intergenic
1058396330 9:104557888-104557910 GAAGATAGCAGATACTTGGTTGG - Intergenic
1058410651 9:104727108-104727130 GAAGGCAGCGGATAGTTGGTTGG - Intergenic
1058540506 9:106007547-106007569 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1058623007 9:106903833-106903855 GAAGGCAGCAGATAGTTGGTTGG + Intronic
1058770859 9:108230095-108230117 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1058784375 9:108372655-108372677 GAAGAAAGCAGATACTTGGTTGG + Intergenic
1058867598 9:109175910-109175932 GAAAGCTGCAGATACCTGGGAGG - Intronic
1059022089 9:110587456-110587478 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1059032874 9:110719314-110719336 GAAGACAGTAGAAACTTGGTTGG - Intronic
1059609392 9:115876530-115876552 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1059673970 9:116518744-116518766 GAAGACAGCAGAAACTCAGTTGG - Intronic
1060311011 9:122462331-122462353 GAAGACAGAAGATACTTGGCTGG + Intergenic
1060314269 9:122494596-122494618 GAAGAGAGCAGAAACTTGGTTGG + Intergenic
1062713791 9:137992168-137992190 GAAGACAGCAGAAACATGGTTGG - Intronic
1202799897 9_KI270719v1_random:165781-165803 GAAGGCAGCAGATAGTTAGTTGG - Intergenic
1203636197 Un_KI270750v1:114893-114915 AAAGACAGCAGATACTTGATTGG + Intergenic
1185878433 X:3718795-3718817 AAAAACAGCTGAAACTTGGCCGG + Intergenic
1186308612 X:8292037-8292059 GAAGGCAACAGATAGTTGGTTGG - Intergenic
1187109097 X:16277514-16277536 GAAGACAGCAGATACTTGGTTGG + Intergenic
1187218182 X:17297614-17297636 GAAAACAACAGATGCTGGATAGG + Intergenic
1187589042 X:20695380-20695402 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1187681576 X:21772351-21772373 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1187752009 X:22477131-22477153 GAAGACAGCAGAAACTTGATTGG + Intergenic
1188040333 X:25364508-25364530 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1188045694 X:25424264-25424286 GAAGGCAGCAGATAGTTGATTGG + Intergenic
1188389175 X:29598945-29598967 AAAGACAGCAAAAACTTGGTTGG + Intronic
1189878961 X:45469386-45469408 GAAGGAAGCAGATACTTGCTTGG + Intergenic
1189931906 X:46021316-46021338 GAAGGCAGAAGATAGTTGGTTGG - Intergenic
1189945815 X:46177485-46177507 GACCACAGCAGAAACTTGGTTGG + Intergenic
1189962234 X:46334714-46334736 GAAGCCAGCAGATAGTTGGTTGG - Intergenic
1190449129 X:50559950-50559972 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1190632007 X:52397102-52397124 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1190897135 X:54631680-54631702 GAAGACAGCAGGTACTTGATAGG + Intergenic
1191067510 X:56366343-56366365 GAAAGCAGCAGACAGTTAGTTGG + Intergenic
1191100462 X:56721157-56721179 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1191144657 X:57153280-57153302 GAAGGCAGCAGATACTTGCTTGG + Intergenic
1191179777 X:57548652-57548674 GAAGACAACAGATACTTAGTTGG - Intergenic
1191741705 X:64442904-64442926 GAAGACAGCAGATTCTTGGTTGG - Intergenic
1191784353 X:64901707-64901729 GAAGACAGCAGATACTTGGTTGG + Intergenic
1191787451 X:64932272-64932294 GAAAACAACACATACTTGGTTGG + Intronic
1191804958 X:65125883-65125905 GAAAGTAGCATAAACTTGGTTGG + Intergenic
1191806862 X:65145383-65145405 GAAGGCAGCATATAATTGGTTGG + Intergenic
1191879491 X:65830610-65830632 GAAGAAAGCAGATATTTGGTTGG - Intergenic
1191917415 X:66217762-66217784 GAAGACAGTAGATACTTAGTTGG - Intronic
1191937430 X:66440430-66440452 CAAACCAGCAAATACTGGGTAGG - Intergenic
1191954350 X:66627356-66627378 GAAGGCAGCAGATAATTTGTTGG - Intronic
1191989631 X:67020260-67020282 CAAAACAGCAGAAACTTGTAGGG - Intergenic
1192014436 X:67314193-67314215 GAAGGCAGCAGATAGTTGATTGG + Intergenic
1192164161 X:68814795-68814817 GAAGACAGCAGATACTTGGTTGG - Intergenic
1192298240 X:69872476-69872498 GAAGACAGTAGAAACTTGGTTGG - Intronic
1192609838 X:72556478-72556500 GAAGATAGCAGAAACTCGGTTGG - Intronic
1192673833 X:73173940-73173962 GAAGACAGCAGATCCTTGGTTGG + Intergenic
1192688462 X:73333052-73333074 GAAGACAGTAAATACTTGGTTGG + Intergenic
1192707836 X:73545937-73545959 GAAAACAACAGATACTGGAGAGG + Intergenic
1192820420 X:74638879-74638901 GAAGGCAGAAGATAGTTGGTTGG - Intergenic
1192869251 X:75170490-75170512 GAAGATGGCAGATACTTGGTTGG + Intergenic
1192872710 X:75199889-75199911 GAAAACAACAGATGCTGGGGAGG - Intergenic
1192876810 X:75238206-75238228 GAAGACAGCAGGTACTTGGTTGG - Intergenic
1192878323 X:75255587-75255609 GAAAACAGCAGGTAGTTGGTTGG - Intergenic
1192880910 X:75283189-75283211 GAAGGCAGCAGATAATTGGTTGG + Intronic
1192895455 X:75438571-75438593 GAAGACAGCAGATACTTGGTTGG + Intronic
1192900975 X:75496080-75496102 GAAGACAGGAGATACTTGAGTGG - Intronic
1192904768 X:75539559-75539581 GAAGACAGCAGATACTTTGTTGG + Intergenic
1192982025 X:76354208-76354230 GAAGACAGCAGATACTTGGTTGG + Intergenic
1192982167 X:76356344-76356366 GAAGACAGAAGATATTTGGTAGG - Intergenic
1192991682 X:76465784-76465806 GAAAACAGCAGATATTTGGTTGG + Intergenic
1192993795 X:76490807-76490829 GAAAACAGCAGAAACTTGGTTGG + Intergenic
1192994943 X:76503664-76503686 TGAGACAGCAGATACTTGGTTGG + Intergenic
1193007776 X:76640484-76640506 GAAAACAGCAGAAACTTTATTGG + Intergenic
1193015528 X:76728897-76728919 GAAGACAGCAGATACTTGGTTGG - Intergenic
1193062928 X:77225256-77225278 GAAAGCAACAGATAGTTGATTGG - Intergenic
1193154788 X:78160637-78160659 TAAGGCAGCAGATAGTTGGTTGG - Intergenic
1193157089 X:78185389-78185411 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1193159094 X:78207867-78207889 GGAAACAGCAGATACTGGAGAGG + Intergenic
1193182571 X:78475763-78475785 GAAGACAGCAGATACTTGATTGG + Intergenic
1193255556 X:79344416-79344438 GAAAGCAGAAGATACTTGGTTGG - Intergenic
1193270422 X:79523268-79523290 AAAAATAACAGATACTTGTTAGG + Intergenic
1193301082 X:79889572-79889594 GAAGACAGAAGATATTTGGTAGG - Intergenic
1193314872 X:80053283-80053305 GAAGACAGCAGATAGTTGGTTGG + Intergenic
1193366497 X:80639947-80639969 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1193405073 X:81090831-81090853 GAAGGCAGCAGATAGATGGTTGG - Intergenic
1193421004 X:81281913-81281935 GAAGGCAGCAGATAGTTGGTTGG - Intronic
1193437916 X:81501469-81501491 GAAGGCAGCAGGTAGTTGGTTGG + Intergenic
1193446730 X:81614697-81614719 GAGGACAGCAGATACTTGGGTGG + Intergenic
1193469729 X:81885706-81885728 GAAGACAGCAGATACTTTTTTGG + Intergenic
1193541050 X:82773348-82773370 GAAGGCAGCAGATACTTGGTTGG + Intergenic
1193590882 X:83387447-83387469 CAAGGCAGCAGATACTTGGGTGG - Intergenic
1193618863 X:83725908-83725930 GAAGACAACAGATACTTGGTTGG - Intergenic
1193632033 X:83901304-83901326 TAAGGCAGCAGACACTTGGTTGG - Intergenic
1193690599 X:84636724-84636746 GAAGACAACAGATACTTGGTTGG - Intergenic
1193771759 X:85595675-85595697 GAAGATAACAGATACTTAGTTGG - Intergenic
1193775771 X:85640177-85640199 GAAGACAGAAGATACTTGGTTGG + Intergenic
1193785828 X:85758810-85758832 GAAGACAGCAGATAATTGATTGG + Intergenic
1193862906 X:86693275-86693297 GAAATTAGCAGTTACTTGTTGGG - Intronic
1193924632 X:87468331-87468353 GAAGACAGCAGATACTTTGTTGG - Intergenic
1193950898 X:87796894-87796916 GAAGGCAGCAGATACTTGGTTGG - Intergenic
1193954465 X:87842728-87842750 CAAGACAGCAGATACTTGGTTGG + Intergenic
1194076225 X:89398006-89398028 GAAGAAAGCAAATACTTGGTTGG + Intergenic
1194165529 X:90509885-90509907 GAAGGCAGCAGACACTTGGTTGG - Intergenic
1194168272 X:90549734-90549756 GAAGACAGAAGATACTTGTTTGG - Intergenic
1194181765 X:90718777-90718799 GAAAATAGCAGATACTCGGCTGG - Intergenic
1194183941 X:90748301-90748323 GAAAGCAGAAGATACTTGGTTGG + Intergenic
1194191809 X:90846660-90846682 GAAAACAGCAGATACTTGATTGG + Intergenic
1194214145 X:91108111-91108133 GAAGACTGAAGATACTTGGTTGG + Intergenic
1194237384 X:91401006-91401028 GAAGGCAGCAGATGGTTGGTTGG - Intergenic
1194262874 X:91718610-91718632 GAAGACAGCAGATACTTGGTTGG - Intergenic
1194278397 X:91915416-91915438 GAAGACAGCAGCAACTTGGTTGG - Intronic
1194354049 X:92858422-92858444 GAAGACAGCAGATATTTTGTTGG - Intergenic
1194381290 X:93194367-93194389 GAAGATAGCAAAAACTTGGTTGG - Intergenic
1194470072 X:94283534-94283556 GAAGACAGAAGATACTTGGTTGG + Intergenic
1194471257 X:94300635-94300657 GAAGACAGAAGATACTTGGTTGG + Intergenic
1194532987 X:95073809-95073831 GAAGACAGCAGACACTCGGTTGG - Intergenic
1194543275 X:95201706-95201728 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1194602464 X:95939654-95939676 GAAGACAGCAGAAACTTGGTTGG + Intergenic
1194630459 X:96276374-96276396 GAAGGCAGCACATACTTGGTTGG - Intergenic
1194631853 X:96294943-96294965 GAAGACAGCAGATACTTGGTTGG - Intergenic
1194868090 X:99094400-99094422 GAAGACAGCAGATACTTGGTTGG + Intergenic
1194881648 X:99259652-99259674 GAAGACAGCAGATACTTGGTTGG + Intergenic
1194967535 X:100305645-100305667 GAAGACAGCAGAAACGTGGTTGG - Intronic
1195019320 X:100810926-100810948 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1195076257 X:101329712-101329734 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1195154216 X:102106497-102106519 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1195231796 X:102857648-102857670 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1195237312 X:102913417-102913439 GAAGACAGCAGAAACTAGGTTGG - Intergenic
1195795656 X:108643966-108643988 GAAGGCAGCAGATCATTGGTTGG - Intronic
1195972564 X:110489729-110489751 GAAGACAGTAGAAACTTGGTTGG + Intergenic
1195984980 X:110619954-110619976 GAAGGCAGCAGATACTTGGTTGG + Intergenic
1196161510 X:112489236-112489258 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1196171085 X:112589292-112589314 GAAGCCAGCAGATAGTTGGTTGG - Intergenic
1196477879 X:116110224-116110246 GAAAACAGCAGGTACTTGGTTGG + Intergenic
1196484706 X:116192180-116192202 GAGGACAGCAGATAATTTGTTGG + Intergenic
1196675561 X:118417087-118417109 GAAGACAGCAGATAGTTGGTTGG + Intronic
1196829976 X:119768164-119768186 GAAAGAAGGAAATACTTGGTGGG - Intergenic
1197054463 X:122099613-122099635 GAAGACAGAAGATACTTGGTTGG + Intergenic
1197066043 X:122235506-122235528 GAAGGCAGCAGATAGTTGGTTGG + Intergenic
1197102679 X:122674738-122674760 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1197120269 X:122882484-122882506 GAAGACAGCAGAAACTTGGTTGG - Intergenic
1197463595 X:126773417-126773439 GAAGGCAGCAGATACTTGGTTGG - Intergenic
1197472001 X:126875606-126875628 GATGACAGCAGATACTTGGTTGG + Intergenic
1197545452 X:127818109-127818131 GAAGACAGCAGATATTTGGTTGG - Intergenic
1197556613 X:127963520-127963542 GGAGACAGCAGATACTTGGTTGG + Intergenic
1197571988 X:128161408-128161430 AAAGATAGTAGATACTTGGTTGG + Intergenic
1197575803 X:128209754-128209776 GAGGACAGTAGATACTTGGTTGG - Intergenic
1197589095 X:128386020-128386042 GAAGGCAGCAGATAGTTGTTTGG - Intergenic
1197664422 X:129208622-129208644 GAAGGCAGCAGATATTTGGTTGG + Intergenic
1197911179 X:131483893-131483915 GAAGGCAGCAGATACTTGGCTGG - Intergenic
1197953884 X:131925622-131925644 GAAGGCAGCAGATAGTTGTTTGG - Intergenic
1198141151 X:133804875-133804897 GAATAGAGCAGATATTTGCTAGG - Intronic
1198559686 X:137836132-137836154 GAAGACAACAGAAACTTGGTTGG + Intergenic
1198604303 X:138320348-138320370 GAAGACAGCAGAAACTTGTTTGG + Intergenic
1198664929 X:139009881-139009903 GAAGACAGCAGAAACTTGGTTGG - Intronic
1198696065 X:139339591-139339613 GAAGACGGCGGATACTTGGTTGG + Intergenic
1198797088 X:140408825-140408847 GAAGACAGCAGATACTTGGTTGG + Intergenic
1198950376 X:142063589-142063611 GAAGACAGCAGATATTTGGTTGG + Intergenic
1198963672 X:142206426-142206448 GAAAACAGAAGACAGTTGCTAGG - Intergenic
1199234317 X:145472586-145472608 GAAAACAAGGGATTCTTGGTAGG - Intergenic
1199526096 X:148793527-148793549 GAATACAGAAGAGACTTTGTAGG + Intronic
1199553735 X:149083379-149083401 GAAGACAGTAGACACTTGGTTGG - Intergenic
1199587052 X:149425660-149425682 GAAGACAGCAGATACTTGGTTGG - Intergenic
1199668741 X:150123036-150123058 GAAGGCAGCAGATAGTTGGTTGG - Intergenic
1199913856 X:152317084-152317106 GAGGGCAGCAGATACTTGGTTGG - Intronic
1200008426 X:153103415-153103437 TAAAACTGCAGCAACTTGGTTGG - Intergenic
1200317917 X:155153739-155153761 GAAGGCAGCAGATAGGTGGTTGG + Intergenic
1200332858 X:155315844-155315866 GAAGACAGCAGAAACTTGTTTGG - Intronic
1200428864 Y:3053528-3053550 GAAGTAAGCAAATACTTGGTTGG + Intergenic
1200511795 Y:4087694-4087716 GAAGGCAGCAGACCCTTGGTTGG - Intergenic
1200514516 Y:4127514-4127536 GAAGACAGAAGATACTTGTTTGG - Intergenic
1200528388 Y:4300693-4300715 GAAAATAGCAGATACTTGGCTGG - Intergenic
1200530532 Y:4330232-4330254 GAAAGCAGAAGATACTTTGTTGG + Intergenic
1200538452 Y:4429094-4429116 GAAAACAGCAGATACTTGATTGG + Intergenic
1200561193 Y:4706090-4706112 GAAGACAGGAGATACTTGATTGG + Intergenic
1200595732 Y:5137496-5137518 GAAGACAGCAGCTACTTGGTTGG - Intronic
1200662404 Y:5975441-5975463 GAAGACAGCAGATATTTTATTGG - Intergenic
1200897665 Y:8392839-8392861 GAAAAAAGCGGATACTCGGCTGG + Intergenic
1201391794 Y:13505449-13505471 GAAAACAGCAGATATATGGTTGG - Intergenic
1201753283 Y:17458321-17458343 GAAAACAGCAGATGCTGGAGAGG + Intergenic
1201848270 Y:18447662-18447684 GAAAACAGCAGATGCTGGAGAGG - Intergenic
1201934565 Y:19394232-19394254 GAAGATAGCTGATACTTGATTGG + Intergenic
1201975831 Y:19848259-19848281 GAAGACAGCAGACACTTGGCTGG - Intergenic
1202036234 Y:20639488-20639510 GAAGGCAGCAGATATTTGGTTGG + Intergenic
1202043432 Y:20712027-20712049 GAAAACAGCAAATGCTGGCTAGG + Intergenic