ID: 1042897037

View in Genome Browser
Species Human (GRCh38)
Location 8:73681751-73681773
Sequence TCACATAAACTGAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2290
Summary {0: 5, 1: 338, 2: 491, 3: 463, 4: 993}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042897029_1042897037 26 Left 1042897029 8:73681702-73681724 CCAACCAAGTATCTGCTGTTTTC 0: 10
1: 130
2: 297
3: 433
4: 608
Right 1042897037 8:73681751-73681773 TCACATAAACTGAAGGTAAAGGG 0: 5
1: 338
2: 491
3: 463
4: 993
1042897030_1042897037 22 Left 1042897030 8:73681706-73681728 CCAAGTATCTGCTGTTTTCAAGG 0: 2
1: 11
2: 164
3: 332
4: 815
Right 1042897037 8:73681751-73681773 TCACATAAACTGAAGGTAAAGGG 0: 5
1: 338
2: 491
3: 463
4: 993
1042897034_1042897037 -7 Left 1042897034 8:73681735-73681757 CCTAACACATAAGGACTCACATA 0: 349
1: 430
2: 380
3: 255
4: 362
Right 1042897037 8:73681751-73681773 TCACATAAACTGAAGGTAAAGGG 0: 5
1: 338
2: 491
3: 463
4: 993

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042897037 Original CRISPR TCACATAAACTGAAGGTAAA GGG Intronic
Too many off-targets to display for this crispr