ID: 1042902827

View in Genome Browser
Species Human (GRCh38)
Location 8:73746330-73746352
Sequence CGGTGTGGCTGCGAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 660}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042902827_1042902834 5 Left 1042902827 8:73746330-73746352 CCCTCTCCCTCGCAGCCACACCG 0: 1
1: 0
2: 0
3: 35
4: 660
Right 1042902834 8:73746358-73746380 GCACTCGCCGTCCTCTCTTCCGG No data
1042902827_1042902837 20 Left 1042902827 8:73746330-73746352 CCCTCTCCCTCGCAGCCACACCG 0: 1
1: 0
2: 0
3: 35
4: 660
Right 1042902837 8:73746373-73746395 TCTTCCGGCCGCTACCACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042902827 Original CRISPR CGGTGTGGCTGCGAGGGAGA GGG (reversed) Intronic
900293867 1:1938834-1938856 CGGTGAGCCTGCCAGGGAGAGGG - Exonic
900737154 1:4306135-4306157 CAGTGGGGATGCTAGGGAGAAGG + Intergenic
901264711 1:7901976-7901998 GGGAGTGGGTGCGAGGGAGAGGG + Intergenic
901685723 1:10942325-10942347 GGGTGGGGCTGCGTGGGAGGTGG - Intergenic
902062582 1:13658105-13658127 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
902275611 1:15337289-15337311 GGGTGTGGCAGGGAGAGAGAAGG - Intronic
902646789 1:17805117-17805139 CCGTGTGGCTGGAAGGGAGCTGG - Intronic
902690189 1:18106168-18106190 CTGGGTGGATGCGAGTGAGAGGG + Intergenic
903100346 1:21024010-21024032 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
903148029 1:21387776-21387798 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
903458373 1:23504221-23504243 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
903485872 1:23689020-23689042 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
903526389 1:23994550-23994572 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
903633909 1:24799400-24799422 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
903894756 1:26596269-26596291 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
903923528 1:26817862-26817884 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
903993372 1:27289305-27289327 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
904077317 1:27852852-27852874 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
904128713 1:28260170-28260192 GGGTGGGGCGGTGAGGGAGAGGG - Intronic
904794930 1:33051732-33051754 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
904831551 1:33309295-33309317 CGGGGTGGCGGCCAGGCAGAGGG + Intronic
905422828 1:37859899-37859921 GGCTGTGGCTGCCAGGGCGAGGG - Intergenic
905699321 1:39999795-39999817 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
906136166 1:43502077-43502099 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
906306794 1:44724720-44724742 CGGCGTGACTGCGGGGGCGACGG - Intronic
906329940 1:44876457-44876479 CGGGGCGGCTGCCAGGCAGAGGG - Intronic
906486761 1:46240893-46240915 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
906741948 1:48192493-48192515 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
907089646 1:51711656-51711678 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
907453812 1:54562650-54562672 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
907999755 1:59668530-59668552 CTGTGTGGCTTAGAGGGGGATGG - Intronic
910343765 1:86215854-86215876 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
910777558 1:90891904-90891926 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
911533924 1:99078490-99078512 CGGGGTGGCAGCCAGGCAGAGGG + Intergenic
912116287 1:106412508-106412530 CGGGGCGGCTGCCAGGTAGAGGG - Intergenic
912298534 1:108490073-108490095 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
912316953 1:108675742-108675764 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
912669090 1:111608144-111608166 CGGGGCGGCTGCGAGGCGGAGGG + Intronic
912799649 1:112712867-112712889 CGGAGTGGTTGGGAGGCAGAGGG + Exonic
912825375 1:112898900-112898922 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
912844045 1:113063661-113063683 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
912844769 1:113069205-113069227 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
912977339 1:114342563-114342585 TGCTGTGGCTGCCAGGGGGAGGG - Intergenic
913306230 1:117430453-117430475 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
914775288 1:150729230-150729252 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
914787948 1:150850997-150851019 CGGGGTGGCTGCCGGGCAGAGGG - Intronic
914888017 1:151600422-151600444 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
914908917 1:151769191-151769213 CGGTGTGGCGGCCGGGCAGAGGG + Intronic
914953959 1:152144921-152144943 CGGGGTGGCTGCTGGGCAGAGGG + Intergenic
914987344 1:152472097-152472119 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
915112866 1:153575433-153575455 CGGGGTGGCGGCCGGGGAGAGGG - Intergenic
915141499 1:153771178-153771200 GGGTGGGGCAGAGAGGGAGAGGG + Intronic
915307555 1:154989363-154989385 AGGTGTGGCTGGGTGGCAGATGG + Intronic
915861560 1:159449908-159449930 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
916037437 1:160933620-160933642 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
916555449 1:165890733-165890755 CTGTCTGGCAGAGAGGGAGATGG + Intronic
916671958 1:167029765-167029787 CGGGGTGGCTGCCGGGTAGAGGG - Intergenic
917006198 1:170419085-170419107 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
917154743 1:171984388-171984410 CGGTGTGGAGGGGAGGGAGGTGG - Intronic
917376107 1:174350334-174350356 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
918228793 1:182509922-182509944 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
918812497 1:189139858-189139880 CGGGGCGGCTGCCAGGCAGAGGG + Intergenic
919423891 1:197405829-197405851 CGGGGTGGCTGCCAGGTGGAGGG - Intronic
919767220 1:201135187-201135209 CGCTGGGGCTGGGAGGGAGGTGG + Exonic
920794937 1:209129230-209129252 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
920934604 1:210419298-210419320 CTGTGTGTCTGCCAGGGAGGTGG + Intronic
921142709 1:212321471-212321493 CGGTGTGGCTGCCGGGCGGAGGG + Intronic
921158902 1:212459013-212459035 GGGTGTGGCTGAGGGGGAGGAGG + Intergenic
921414337 1:214870006-214870028 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
921761419 1:218919465-218919487 CTGTGTGGCTGAGAGGCAGGAGG - Intergenic
921902790 1:220466762-220466784 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
922102473 1:222487831-222487853 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
922693210 1:227711135-227711157 CGGTGTGGCTGCCGGGCGGAGGG + Intergenic
922780747 1:228250397-228250419 GGGTGTGCATGGGAGGGAGAGGG + Intronic
922782586 1:228264548-228264570 GGGTGTGCATGGGAGGGAGAGGG + Intronic
923491426 1:234487497-234487519 GGGTTTGACAGCGAGGGAGAAGG - Intergenic
924925607 1:248676900-248676922 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
1063044001 10:2373111-2373133 AGGTGTGTCTGCGAGAGAGTGGG - Intergenic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1063394014 10:5669793-5669815 CTGTGTGGCTACGAGAGATAAGG - Intergenic
1063822636 10:9855529-9855551 CGGGGTGGCGGCCAGGCAGAGGG + Intergenic
1064811580 10:19205698-19205720 AGATGTGGCTGCAAGGCAGATGG + Intronic
1065055351 10:21837703-21837725 CGGGGCGGCTGCCAGGCAGAGGG - Intronic
1065335802 10:24655966-24655988 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1065594421 10:27296737-27296759 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1065857030 10:29839080-29839102 GGGTGTGGGAGGGAGGGAGAAGG + Intergenic
1067077245 10:43195097-43195119 CGGAGTTCCTGCGAGGGAGACGG + Exonic
1068494776 10:57773660-57773682 TTGTGTGGCTGGGAGGGATATGG + Intergenic
1068659460 10:59608905-59608927 AGGAGTGGCTGGGAGGGAAATGG + Intergenic
1068667973 10:59696816-59696838 CGGTGTGGCTGCCGGGCGGAGGG - Intronic
1069733011 10:70631338-70631360 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1069741464 10:70688111-70688133 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1070318144 10:75333781-75333803 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1072116513 10:92374947-92374969 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1072602388 10:96941605-96941627 CGGGGTGGCTGCCAGGCGGAGGG + Intronic
1072648180 10:97275495-97275517 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1072950017 10:99839709-99839731 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1072980161 10:100092932-100092954 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1073025829 10:100486744-100486766 TGTGGTGGCTGCGAGGGAGAAGG + Exonic
1073386040 10:103128818-103128840 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1073544205 10:104335448-104335470 AGGTGTGGCTCAGAGGGAAACGG - Intronic
1075588033 10:123671394-123671416 TGGTGTGGCTGAGCGGGGGAGGG - Intronic
1075588054 10:123671521-123671543 AGGTGTGGCTGAGTGGGGGAGGG - Intronic
1076021576 10:127077909-127077931 GGGTATGGATGGGAGGGAGAAGG + Intronic
1077052949 11:575954-575976 AGGCGGGGCTGCGAGGGAGGGGG + Intergenic
1077116978 11:889632-889654 CGGTGTGGCTGGCAGGGACTAGG - Intronic
1077286216 11:1767163-1767185 CGGTGAGGCTGCGAGCCAGTGGG + Intergenic
1077397529 11:2332499-2332521 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1077577718 11:3397376-3397398 CGGGGTGGCTGCCAGGTGGAGGG - Intergenic
1079020568 11:16907037-16907059 CGGAGTGGCTGCCGGGCAGAGGG - Intronic
1079039907 11:17050792-17050814 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1079372011 11:19860234-19860256 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1079444828 11:20548539-20548561 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
1080097923 11:28430109-28430131 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1080860042 11:36144641-36144663 CGGTGTGGCTGCCGGGCGGAGGG - Intronic
1083154587 11:60815222-60815244 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1083191742 11:61057140-61057162 CGGTGAGCCTGCCAGGGACACGG - Intergenic
1083382275 11:62278672-62278694 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1083646213 11:64172701-64172723 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1083832033 11:65239370-65239392 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1083953534 11:65970243-65970265 CAGTGTGGCTATGCGGGAGAAGG - Intronic
1084048905 11:66587738-66587760 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1084924826 11:72502785-72502807 CGGGGTGGCTGCCAGGCGGAGGG + Intergenic
1085443289 11:76582433-76582455 CGGGGTGGCGGCCAGGCAGAGGG + Intergenic
1085513399 11:77098973-77098995 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1085609494 11:77933859-77933881 CGGGGTGGCTGCCGGGCAGAGGG - Intronic
1086366085 11:86110771-86110793 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1087057386 11:93947490-93947512 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1087948528 11:104194363-104194385 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1088985314 11:114900255-114900277 CCAGGTGGCTGAGAGGGAGAAGG + Intergenic
1089170902 11:116510945-116510967 CAGGCTGGCTGAGAGGGAGAAGG + Intergenic
1089314008 11:117578311-117578333 AGGTGTGGCAGTGAGGGAGAAGG - Intronic
1089421141 11:118332006-118332028 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1090322890 11:125862959-125862981 CGGAGTGGTTGCCAGGCAGAGGG - Intergenic
1090437202 11:126696707-126696729 CGGTGTGGCTTTGGGAGAGAGGG - Intronic
1091595240 12:1873993-1874015 GGGGGTGGCTGTGAGGGAGGAGG + Intronic
1092199046 12:6568599-6568621 GGCAGTGGATGCGAGGGAGAGGG - Intronic
1092526118 12:9311269-9311291 CCGTCTGGCTGCCAGGAAGAAGG + Intergenic
1092541162 12:9420514-9420536 CCGTCTGGCTGCCAGGAAGAAGG - Intergenic
1092590952 12:9952927-9952949 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1093038515 12:14354825-14354847 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
1093038586 12:14354991-14355013 CGGGGTGGCGGCCAGGCAGAGGG - Intergenic
1094498862 12:31006022-31006044 GGGTGTGGCAGGAAGGGAGAGGG + Intergenic
1094511881 12:31101961-31101983 CCGTCTGGCTGCCAGGAAGAAGG + Exonic
1095068841 12:37815162-37815184 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1095439449 12:42227591-42227613 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1095571085 12:43685202-43685224 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1096022378 12:48333347-48333369 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1096044644 12:48551950-48551972 CGGGGTGGCTGCCAGGCAGAGGG - Intergenic
1096082360 12:48842097-48842119 CGGGGTGGCTGCCAGGCGGAGGG - Intronic
1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG + Intronic
1096556994 12:52409784-52409806 CGGAGTGGCTGCCGGGCAGAGGG - Intergenic
1096579718 12:52576793-52576815 CAGAGTGGCTGTGACGGAGAAGG + Intergenic
1096599995 12:52722311-52722333 CGTTGTGGCTGACAAGGAGAAGG + Intergenic
1096856664 12:54488446-54488468 CGGGGTGGCTGCGGGGCGGAGGG + Intergenic
1097028552 12:56075980-56076002 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1098018942 12:66134674-66134696 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1098569023 12:71968368-71968390 TGGTGTGCCTGCGAGAAAGATGG - Intronic
1098773835 12:74588058-74588080 CGGGGTGGCAGCCAGGCAGAGGG + Intergenic
1100507594 12:95235779-95235801 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1100577611 12:95907644-95907666 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1100582002 12:95947367-95947389 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1102098133 12:110256827-110256849 CAGTGTGGTTGCGGGTGAGAGGG - Intergenic
1102268292 12:111507416-111507438 CGGGGTGGCTGCCAGGCGGAGGG - Intronic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102578493 12:113872277-113872299 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1103299900 12:119918979-119919001 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1103414066 12:120732429-120732451 CGGGGTGGCTGCCAGGCAGAGGG + Intronic
1103457057 12:121076170-121076192 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
1103591250 12:121993719-121993741 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1103952106 12:124556992-124557014 CGGTGTGGCTGAGACAGAGCGGG + Intronic
1104064891 12:125298309-125298331 CTGGGTGGGTGGGAGGGAGATGG - Intronic
1104134099 12:125921241-125921263 GGGTGGGGCTGGGAGGGTGAGGG - Intergenic
1105555941 13:21448034-21448056 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1106918564 13:34540584-34540606 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1107493102 13:40900541-40900563 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1107953366 13:45485555-45485577 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1108024401 13:46162936-46162958 CGGGGTGGCTGCCAGGCGGAGGG - Intronic
1108330211 13:49378105-49378127 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1108351306 13:49592893-49592915 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1108625936 13:52228810-52228832 GGGAGTGGCTGGGAGTGAGAGGG + Intergenic
1108660130 13:52577670-52577692 GGGAGTGGCTGGGAGTGAGAGGG - Intergenic
1110269286 13:73574696-73574718 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1111388639 13:87561889-87561911 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
1111721433 13:91950351-91950373 GGGTGGGGCTGGGAGGGAGGAGG - Intronic
1112262091 13:97886229-97886251 CTGTGAGGCAGGGAGGGAGAAGG + Intergenic
1112374483 13:98825896-98825918 CGCTATGGCTGTGGGGGAGAAGG + Exonic
1114057788 14:18988943-18988965 CTGTGTTGCTGCAAGGGAAATGG + Intronic
1114104759 14:19412810-19412832 CTGTGTTGCTGCAAGGGAAATGG - Intronic
1114165098 14:20212540-20212562 CGGGGTGGCTGCCAGGCAGAGGG - Intergenic
1114578766 14:23737013-23737035 CGGGGTGGCGGCCAGGCAGAGGG - Intergenic
1114594226 14:23898222-23898244 CGGGGTGGCAGCCAGGCAGAGGG + Intergenic
1114615198 14:24064588-24064610 AGGTGTGGATGAGAGGGAGGTGG + Intronic
1115504278 14:34079029-34079051 CGGGGTGGCTGCCGGGCAGAGGG - Intronic
1115547522 14:34476379-34476401 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1116364703 14:44045406-44045428 CAGTGTGGCTGCCATCGAGAAGG + Intergenic
1116480324 14:45389111-45389133 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1116912929 14:50490609-50490631 CAGTGTGCCTGCTAGGCAGAAGG - Intronic
1117596848 14:57333726-57333748 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1117763678 14:59058947-59058969 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1118238980 14:64038005-64038027 CGGGGTGGCTGCCAGGCGGAGGG + Intronic
1118590393 14:67396577-67396599 GGGTGTGGCTTCTGGGGAGAAGG - Intronic
1119515209 14:75242555-75242577 CGCTGTGACAGAGAGGGAGATGG + Intronic
1119763990 14:77176536-77176558 GGGTGAGGCTGCTAGGCAGAGGG - Intronic
1119868540 14:77993806-77993828 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1119923407 14:78468860-78468882 TGGTGTGGGAGTGAGGGAGAGGG + Intronic
1120170553 14:81244534-81244556 CGGGGTGGCTGCCAGGCGGAGGG + Intergenic
1121096377 14:91220610-91220632 CCGTGTGGCTGGGAGGCAGATGG + Intronic
1121142921 14:91557626-91557648 CGGGGTGGCTGCCAGGCGGAGGG + Intergenic
1121306810 14:92911937-92911959 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1122127587 14:99587552-99587574 CGGAGGGGCTGTGAGGGACAGGG - Intronic
1122212263 14:100180924-100180946 CGGTGTGGCTGCCGGGCGGAGGG - Intergenic
1122963915 14:105112279-105112301 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1123062068 14:105598903-105598925 CGGTGTGGGTGAGTGGGGGATGG + Intergenic
1123086811 14:105720634-105720656 CGGTGTGGGTGAGTGGGGGATGG + Intergenic
1123761565 15:23437379-23437401 CGGTGTGAGTGCCAGGCAGACGG - Intergenic
1124245799 15:28070154-28070176 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1124334924 15:28849466-28849488 CGGGGTGGCGGCCAGGCAGAGGG + Intergenic
1125079150 15:35655981-35656003 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1125566534 15:40682805-40682827 CGGTGTGGCTGCCGGGCTGAGGG - Intergenic
1125659114 15:41382349-41382371 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1126125720 15:45293154-45293176 CGGGGTGGCTGCCAGGCGGAGGG + Intergenic
1126816446 15:52459696-52459718 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1126850944 15:52796394-52796416 AGGTGGGGCTGCGGGGCAGATGG + Intergenic
1127072891 15:55302826-55302848 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1127829346 15:62736876-62736898 AGGGGTGGCTGCTAGAGAGACGG + Exonic
1128597482 15:68964758-68964780 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1129428381 15:75481223-75481245 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1129431232 15:75503468-75503490 CGGGGTGGCTGCCGGGCAGAGGG - Intronic
1129675405 15:77630577-77630599 CTGTGTGACTGGGAGGGAGGTGG - Intronic
1130340849 15:82998414-82998436 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1130946744 15:88553723-88553745 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1131125192 15:89853861-89853883 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1131127155 15:89867764-89867786 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1131394913 15:92078490-92078512 TGGTGTGGCTGTGTAGGAGATGG - Intronic
1131479314 15:92768293-92768315 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1132036980 15:98493050-98493072 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1132521065 16:389373-389395 GGGTGTGGGTGCGAGTGAGCTGG + Intergenic
1132992262 16:2802125-2802147 CGGAGTGGTTGCCAGGCAGAGGG + Intergenic
1135694315 16:24574176-24574198 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1136160543 16:28416598-28416620 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1136202552 16:28698716-28698738 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1136428638 16:30184777-30184799 CTGTGTGGGTGTGAGGGAGGTGG + Intronic
1136910433 16:34140833-34140855 CGGTGGGGCGGGGAGGCAGAGGG + Intergenic
1138299149 16:55911890-55911912 CTATGGGGCTGCCAGGGAGAGGG + Intronic
1138467279 16:57201161-57201183 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1138467289 16:57201201-57201223 CGGTGTGGCTGCCGGGCGGAGGG + Intronic
1138467298 16:57201241-57201263 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1138642626 16:58397169-58397191 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1139528551 16:67530479-67530501 AGGGGCGGCTGCAAGGGAGAAGG - Intronic
1139885425 16:70204614-70204636 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1140236891 16:73167315-73167337 ACGTGTGGCTGGGAGGGAGGGGG - Intergenic
1140602929 16:76500086-76500108 CGGGGTGGCGGCGGGGCAGAGGG + Intronic
1140736181 16:77899870-77899892 GGGTGAGGCTGAAAGGGAGATGG - Intronic
1142880291 17:2878413-2878435 GGGTGAGGCTGAGTGGGAGAGGG + Intronic
1142884304 17:2903292-2903314 AGCTGTGGCTGCTTGGGAGAGGG + Intronic
1142939883 17:3371987-3372009 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1143008891 17:3854568-3854590 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1143115311 17:4578542-4578564 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1143342778 17:6226380-6226402 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
1143625818 17:8109689-8109711 CGGTGAGGCTGCGGGGGCGGGGG + Intronic
1144517431 17:15928399-15928421 CTGTGCGGATGCCAGGGAGACGG + Intergenic
1144860395 17:18298135-18298157 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1145022275 17:19441612-19441634 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
1145047300 17:19628139-19628161 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1145205774 17:20984432-20984454 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1145684231 17:26638293-26638315 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1145750939 17:27354416-27354438 CGGGGTGGATGCGAGGGTGAGGG - Intergenic
1145862805 17:28223818-28223840 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1145895741 17:28456336-28456358 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1145936100 17:28715747-28715769 GGGTGTGGGTGCTGGGGAGAAGG + Intronic
1147172580 17:38630903-38630925 CGGTGTGGCTGCCGGGCGGAGGG - Intergenic
1147588365 17:41665982-41666004 CGGTCTGGCTGCGATGGGGGAGG - Intergenic
1147638076 17:41976031-41976053 CAGTGTGGGTTCGAGGGAGATGG - Exonic
1147657489 17:42098944-42098966 CTGTGTGGCAGGGAGGGAGATGG - Intergenic
1147785053 17:42973074-42973096 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1147809705 17:43159475-43159497 CGGGGTGGCTGCCAGGCGGAGGG + Intergenic
1147963289 17:44180434-44180456 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1148597118 17:48865575-48865597 ATGTGTGGGTGCGAGGGGGATGG - Intronic
1149633018 17:58142581-58142603 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
1149908834 17:60551266-60551288 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1150061579 17:62073085-62073107 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1150380622 17:64716739-64716761 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1150557705 17:66269062-66269084 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1150649415 17:67000301-67000323 CAGGCTGGCTGGGAGGGAGACGG - Intronic
1150894631 17:69196254-69196276 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1151827500 17:76531334-76531356 CGGAGTGGCTGCGAGAGGGAGGG - Intronic
1152531750 17:80922974-80922996 CGGGGTGTCCGGGAGGGAGAGGG - Intronic
1152696230 17:81798106-81798128 CGGGGCGGCTGCGGGGCAGAGGG + Intergenic
1154278682 18:12981024-12981046 CGGTGTGGCTGCCGGGCGGAGGG + Intronic
1155956469 18:31960362-31960384 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1156066372 18:33147894-33147916 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1157222653 18:45838703-45838725 CGGCGCGGCTGCAGGGGAGAAGG - Exonic
1157629479 18:49080705-49080727 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1157639819 18:49202745-49202767 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1157677453 18:49578266-49578288 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1158148547 18:54343213-54343235 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1159856737 18:73598135-73598157 AGGTGTGGCTGTCAGTGAGAAGG + Intergenic
1160554275 18:79715943-79715965 CGTTGTGGCTGGGAGGGCGGAGG + Intronic
1160706845 19:533843-533865 CGCTGTGCCTGGGAGGGAGTTGG + Intronic
1161473371 19:4472421-4472443 GGGTGAGGCCGCGCGGGAGATGG + Exonic
1161790191 19:6355499-6355521 CGGGGTGGCTGCTGGGCAGAGGG - Intergenic
1162163846 19:8739450-8739472 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
1162836058 19:13318713-13318735 CGGTGTGGATGTAAGAGAGAGGG + Intronic
1162886796 19:13703192-13703214 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1163198887 19:15747821-15747843 CGGTGGGGGAGGGAGGGAGAGGG + Intergenic
1163905983 19:20150292-20150314 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1164106119 19:22107967-22107989 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1164109113 19:22138028-22138050 CGCTGCGGGTGCGAGGGTGAGGG - Intergenic
1164168034 19:22700323-22700345 CGGGGTGGCAGCCAGGCAGAGGG + Intergenic
1164192013 19:22925938-22925960 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1164244670 19:23419366-23419388 CGGGGTGGCTGCCAGGCAGAGGG - Intergenic
1164298512 19:23937388-23937410 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1164653234 19:29901285-29901307 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1164659192 19:29948867-29948889 CGGGGTGGCGGCCAGGCAGAGGG + Intronic
1164937669 19:32227799-32227821 CCGTGTGGCTGAAAAGGAGAAGG + Intergenic
1165193101 19:34079836-34079858 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1166028646 19:40108960-40108982 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1166029755 19:40117932-40117954 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1166115071 19:40648452-40648474 CGGTGTGGCTGCCGGGCTGAGGG + Intergenic
1166261542 19:41644662-41644684 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1166421461 19:42639725-42639747 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
1167453377 19:49585191-49585213 AGGTGTGGTTGCTAGGGAGAAGG - Intronic
1167739775 19:51317493-51317515 CAGTGTGGCTGCCAGGCAGCTGG - Intronic
1167897544 19:52593681-52593703 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
1168572603 19:57483291-57483313 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
925633207 2:5916094-5916116 GGGTGTGGCTGAGCAGGAGAAGG - Intergenic
925942035 2:8830066-8830088 CTGTGTGACTCAGAGGGAGATGG - Intronic
926705693 2:15835899-15835921 TGGTGAGGATGCGATGGAGAAGG + Intergenic
927510688 2:23642323-23642345 CCCTGTGCCTGCAAGGGAGATGG - Exonic
928405535 2:31011699-31011721 AGGGGTAGCTGGGAGGGAGAAGG - Intronic
928596886 2:32868539-32868561 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
929415985 2:41746830-41746852 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
929614479 2:43297291-43297313 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
930079399 2:47433809-47433831 CGGTGTGGCTGCCGGGCGGAGGG + Intronic
930202314 2:48557218-48557240 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
930271570 2:49263508-49263530 CGTTGTGGATGCTATGGAGATGG - Intergenic
930703944 2:54485942-54485964 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
930833968 2:55773985-55774007 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
930941567 2:57020656-57020678 TGGTGAGGCTGCAAGGAAGAGGG - Intergenic
931656323 2:64512463-64512485 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
931681018 2:64750325-64750347 CGGGGTGGCAGCGAGGGAGGGGG + Intronic
932807525 2:74796193-74796215 CGGGGTGGCTGCTGGGCAGAGGG + Intergenic
933149677 2:78899211-78899233 CAGTGTGGCTGGGAGAGAGAGGG + Intergenic
933523593 2:83407311-83407333 GGGTGTGCCTGTGAGGGTGATGG + Intergenic
933734937 2:85487736-85487758 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
933734947 2:85487776-85487798 GGGTGTGGCTGCCAGGCGGAGGG - Intergenic
934549084 2:95243642-95243664 CGGGGTGGCTGCCAGGCGGAGGG - Intronic
934703436 2:96461544-96461566 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
936475464 2:112835886-112835908 AAGTGTGGCTTGGAGGGAGAGGG - Intronic
936546091 2:113394233-113394255 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
937437588 2:121892817-121892839 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
937472586 2:122186824-122186846 CGGTGTGGGTGGAAGAGAGATGG - Intergenic
937904153 2:127044303-127044325 AGGTGTGGGTGTGAGGGTGAAGG - Intergenic
937919587 2:127120082-127120104 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
937944911 2:127324102-127324124 TGTTTTGGCTGGGAGGGAGAGGG - Intronic
938006185 2:127788944-127788966 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
938342385 2:130544249-130544271 CAATGTGGCTGCAAGGGAGCAGG + Intronic
938347447 2:130576460-130576482 CAATGTGGCTGCAAGGGAGCAGG - Intronic
938836310 2:135106223-135106245 CGGGGTGGCGGCCAGGCAGAGGG - Intronic
938934770 2:136118209-136118231 CGCTGGGGCGGGGAGGGAGAAGG + Intergenic
940101712 2:150047691-150047713 GTGTGTGGCTGTGAGGCAGATGG + Intergenic
940652421 2:156451809-156451831 CGGGGTGGCTGCCAGGCGGAGGG + Intronic
941197587 2:162470499-162470521 CGGGGTGGCTGCCCGGCAGAGGG - Intronic
941416349 2:165226249-165226271 CAGTGTGTCTGCTAGGGTGAAGG - Intergenic
941814821 2:169786615-169786637 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
941822290 2:169855876-169855898 CGGGGTGGCGGCCAGGCAGAGGG + Intronic
942630124 2:177945571-177945593 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
943297201 2:186154254-186154276 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
944222604 2:197317420-197317442 GGGTGGGGCTGGGAGGGAGAAGG + Intergenic
944283571 2:197923401-197923423 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
944751596 2:202715365-202715387 CGGGGTGGCTGCCAGGCGGAGGG + Intronic
945115176 2:206401511-206401533 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
945835833 2:214835600-214835622 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
946391073 2:219417485-219417507 AGCTGTTGCTGCCAGGGAGATGG + Intergenic
947878731 2:233486276-233486298 CGATGTGGCAGAGAGGGACAGGG + Intronic
948651661 2:239449621-239449643 CGGGGTGGCTGCCAGGCGGAGGG + Intergenic
1169370801 20:5027558-5027580 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1170425066 20:16227992-16228014 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1170623143 20:18010718-18010740 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1171899907 20:30847182-30847204 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1171957496 20:31471606-31471628 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1172031494 20:31985170-31985192 GGGTGGGGCTGGGAGGCAGATGG - Intronic
1172059039 20:32176084-32176106 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1172141169 20:32723886-32723908 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1172165852 20:32898652-32898674 CGGTGGGGCTGGAAGGGAGGGGG + Intronic
1172349957 20:34230916-34230938 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1173495553 20:43514958-43514980 GAGTGTGGCTGCGATGGGGAGGG + Intronic
1173898445 20:46568843-46568865 CTGTGTGGCTGCGAGGATGCTGG - Intronic
1176111557 20:63413241-63413263 CGGTGTGGATGGGGGAGAGATGG + Intronic
1176348452 21:5771090-5771112 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1176355266 21:5891674-5891696 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1176496375 21:7553365-7553387 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1176542773 21:8169160-8169182 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1176561724 21:8352205-8352227 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1177134201 21:17292336-17292358 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1177178543 21:17720733-17720755 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1177875479 21:26626303-26626325 CGGAGTGGCTGCCAGGGGCAGGG + Intergenic
1178034398 21:28564042-28564064 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
1178075498 21:29011380-29011402 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1180476272 22:15711555-15711577 CTGTGTTGCTGCAAGGGAAATGG + Intronic
1180672095 22:17561331-17561353 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1180739303 22:18041709-18041731 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1181557424 22:23679274-23679296 CGCAGGGGCTGAGAGGGAGAGGG + Intergenic
1181982268 22:26773625-26773647 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1182199361 22:28553538-28553560 CGGGGTGGCTGCCAGGCAGAGGG - Intronic
1182331219 22:29552706-29552728 CGGGGTGGCGGCCAGGCAGAGGG - Intronic
1182616854 22:31593239-31593261 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1182976329 22:34626258-34626280 CGGGGCGGCTGCCAGGCAGAGGG + Intergenic
1183595205 22:38807047-38807069 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1183841534 22:40502304-40502326 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1183845212 22:40536856-40536878 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1185012069 22:48319825-48319847 CGGGGAGGCTCCAAGGGAGAGGG - Intergenic
1185377080 22:50487581-50487603 CTGTGGGGCTGCCTGGGAGAGGG + Intronic
1185415285 22:50706057-50706079 CGGTGGGGCTGCAAAGAAGAGGG - Intergenic
949529743 3:4943770-4943792 TGGTGAGGCTGGGAGGGAAATGG - Intergenic
949696454 3:6701481-6701503 GGGTGTGGCTGCATGTGAGATGG - Intergenic
949989889 3:9570121-9570143 CGGGGCGGCTGCGGGGCAGAGGG - Intergenic
950110356 3:10414724-10414746 CGATGTGGCTGGAAGGGTGAGGG + Intronic
950253764 3:11487888-11487910 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
950590239 3:13931788-13931810 AGGTGTGGCAGGGATGGAGATGG - Intergenic
950710317 3:14809374-14809396 AGGTGTGGCAGGGATGGAGATGG - Intergenic
950754897 3:15163304-15163326 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
950829313 3:15859261-15859283 CGGGGTGGTTGCGAGGGAAACGG - Intronic
952896578 3:38082039-38082061 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
953425996 3:42797700-42797722 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
953561387 3:43995841-43995863 AGGTGTGGCCGCGGGGGAGGGGG + Intergenic
954059285 3:48055956-48055978 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
954080626 3:48211280-48211302 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
954151960 3:48662359-48662381 TCGTGGGGCTCCGAGGGAGAAGG - Exonic
954599790 3:51858784-51858806 CGGGGTGGCTGCTGGGCAGAGGG - Intergenic
955172828 3:56583826-56583848 CGGGGTGGCGGCCAGGAAGAGGG + Intronic
955297325 3:57747374-57747396 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
955368665 3:58332702-58332724 CGGTGCGGCTGCGAGGAGCAGGG + Intergenic
955394923 3:58550375-58550397 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
955434942 3:58890668-58890690 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
956270315 3:67443803-67443825 CGGAGTGGTTGCCAGGCAGAGGG - Intronic
956825927 3:72996929-72996951 CGGAGTGTGTGCGAGGGAGGGGG + Exonic
957316817 3:78583581-78583603 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
957620122 3:82584619-82584641 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
958957472 3:100478107-100478129 CGGGGTGGCTGCCAGGCGGAGGG + Intergenic
959042600 3:101439284-101439306 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
959201697 3:103255064-103255086 CGGGGTGGCTGCGGGGTGGAGGG + Intergenic
959419489 3:106112218-106112240 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
959683784 3:109124205-109124227 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
959865165 3:111259026-111259048 CGATGTGCCAGCCAGGGAGAGGG - Intronic
960030132 3:113046826-113046848 CGGTGTGGCTGCCGGGCGGAGGG + Intergenic
960030141 3:113046866-113046888 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
961704435 3:128773388-128773410 CGGGGTGGCTGCCGGGCAGAGGG - Intronic
961729199 3:128954357-128954379 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
961789114 3:129363519-129363541 CGGGGTGGCTGCCAGGCGGAGGG + Intergenic
961789711 3:129366654-129366676 CGGTGGGGCAGCGAGGGCGCAGG + Intergenic
962063181 3:131952315-131952337 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
962113080 3:132471489-132471511 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
962688793 3:137872747-137872769 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
962688884 3:137872993-137873015 CGGGGTGGCAGCCAGGCAGAGGG - Intergenic
963035154 3:141019478-141019500 GGGCTTGGCTCCGAGGGAGAGGG - Intergenic
965423134 3:168487411-168487433 AGGTGAGGCTGAGAGGAAGAAGG + Intergenic
966351000 3:179032754-179032776 CGGGGCGGCTGCGGGGCAGAGGG - Intronic
966359555 3:179119909-179119931 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
966440178 3:179936146-179936168 CGGTGTGGGTAAGAAGGAGATGG + Intronic
967578489 3:191124986-191125008 CGGGGTGGCGGCCAGGCAGAGGG + Intergenic
967980315 3:195061506-195061528 GGGTCTGGGTGCCAGGGAGACGG + Intergenic
968092369 3:195907421-195907443 AGGTGTGGCTGTGAGTCAGATGG - Intronic
968201846 3:196761980-196762002 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
968985287 4:3871566-3871588 CGGTGTGGCCAGGAGGGAGGTGG - Intergenic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969508276 4:7602197-7602219 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
971073752 4:23124984-23125006 TGGTGTGGGTGTGAAGGAGATGG + Intergenic
972270716 4:37509206-37509228 CGGGGTGGCGGCCAGGCAGAGGG + Intronic
972939763 4:44182045-44182067 CGGGGTGGCTGCCAGGCAGAGGG - Intronic
973281522 4:48364119-48364141 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
973593404 4:52464856-52464878 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
974076571 4:57173210-57173232 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
974076580 4:57173250-57173272 CGGTGTGGCTGCCGGGCGGAGGG - Intergenic
975793727 4:77984084-77984106 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
975848379 4:78548131-78548153 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
976340865 4:83943865-83943887 CGGTGCGGCTGCCAGGCGGAGGG + Intergenic
979941780 4:126771355-126771377 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
980030215 4:127819651-127819673 CCCTGTGGCTGGCAGGGAGAGGG - Intronic
980056531 4:128083865-128083887 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
980120287 4:128720924-128720946 CGGTGGGGCAGGGAGGGAGGTGG - Intergenic
980883672 4:138739435-138739457 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
981303268 4:143215243-143215265 GGGTGAGGCTGAGAGGAAGAGGG - Intronic
981970412 4:150659469-150659491 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
982192061 4:152866700-152866722 CGGGGTGGCTGCCAGGCGGAGGG + Intronic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
982568443 4:157017804-157017826 GGGTGGGGTTGGGAGGGAGATGG - Intergenic
982615999 4:157637338-157637360 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
982723494 4:158882257-158882279 CGGGGTGGCTGCCAGGCGGAGGG - Intronic
982723574 4:158882464-158882486 CGGGGTGGCGGCCAGGCAGAGGG - Intronic
983058559 4:163128633-163128655 GGGTGGGGTTGGGAGGGAGAAGG + Intronic
983218144 4:165020151-165020173 CGGGGTGGCTGCCAGGCGGAGGG + Intergenic
983628747 4:169828478-169828500 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
984831952 4:183984042-183984064 AGGTGTGGATGGGAGGGAGGTGG - Intronic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985743506 5:1633757-1633779 CGGGGCGGCTGCGCGGGAGGCGG + Intergenic
985783809 5:1883908-1883930 AGGGCTGGCTGCGAGGGAGGGGG + Intronic
986173801 5:5334761-5334783 CAGTGCGGCTGGGAGGGAGCTGG - Intergenic
987037542 5:14033194-14033216 GGGTGTGGCTGGGGAGGAGAGGG - Intergenic
988551969 5:32207991-32208013 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
988760684 5:34306953-34306975 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
989076033 5:37563809-37563831 CGGTGTGGCTGCCGGGCGGAGGG + Intronic
989100890 5:37822073-37822095 CTGTGGGCCTGAGAGGGAGATGG + Intronic
990485763 5:56258213-56258235 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
990871013 5:60431236-60431258 CGGGGTGGCTGCCAGGCGGAGGG + Intronic
990909985 5:60843710-60843732 CGGCGGGACTGGGAGGGAGAAGG - Intronic
991127383 5:63083907-63083929 CGGGGTGGCTGCCAGGCGGAGGG + Intergenic
991377061 5:65977440-65977462 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
991507958 5:67344068-67344090 TGGCGTGGCTCCAAGGGAGACGG - Intergenic
991907360 5:71525838-71525860 CGGTGTGGCTGCCGGGCGGAGGG + Intronic
992373819 5:76171492-76171514 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
992470126 5:77043823-77043845 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
992801771 5:80301403-80301425 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
995694242 5:114861925-114861947 TGGTGTGGATGCGATGAAGAGGG - Intergenic
995853706 5:116572936-116572958 CGGAGGGGCGGCGAGGGAGCGGG + Intronic
995912724 5:117207245-117207267 CTGTGTGGCTTCCTGGGAGATGG + Intergenic
996386352 5:122913625-122913647 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
997521269 5:134525856-134525878 CGGGGTCGCGGCGAGGGAGGCGG - Intronic
997875013 5:137538437-137538459 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
998432212 5:142076586-142076608 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
999450883 5:151677298-151677320 CTTTGTGGCTGCAGGGGAGATGG - Intronic
999987008 5:157014295-157014317 CGGGGTGGCTGCCAGGCAGAGGG - Intergenic
1000032941 5:157419701-157419723 CGGGGTGGCTGCCAGGCGGAGGG - Intronic
1000853638 5:166371532-166371554 TGGTCTGGCTGAAAGGGAGAAGG + Intergenic
1000985337 5:167859222-167859244 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1001394262 5:171404379-171404401 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1001591797 5:172870736-172870758 GGGAGTGGCTGCGAGAGGGAGGG - Intronic
1002013628 5:176304938-176304960 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1002031541 5:176433872-176433894 CGGGGTGGTTGCCAGGTAGAGGG - Intergenic
1002031574 5:176433992-176434014 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
1002115748 5:176961383-176961405 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1002626156 5:180531188-180531210 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
1003014454 6:2456760-2456782 CGGGGAGGCTGAGAGGGGGACGG - Intergenic
1003126989 6:3363438-3363460 AGGAGAGGCTGTGAGGGAGAAGG + Intronic
1004390897 6:15208975-15208997 GGGTGAGGCTAGGAGGGAGATGG - Intergenic
1005419019 6:25630122-25630144 AGGTGTGGTTTCCAGGGAGAAGG - Intergenic
1005607064 6:27485693-27485715 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1005929819 6:30475235-30475257 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
1005968474 6:30743286-30743308 TAGGGTGGCTGCGAGGTAGAGGG - Exonic
1006014108 6:31067131-31067153 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1006065093 6:31455706-31455728 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1006128537 6:31854610-31854632 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1006346314 6:33485801-33485823 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
1006492231 6:34397412-34397434 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1006617552 6:35340487-35340509 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1006971452 6:38049891-38049913 CGGGGTGGGTGTGAGGGGGAGGG - Intronic
1007674330 6:43581137-43581159 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1008112218 6:47506045-47506067 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1008377628 6:50810052-50810074 CAGGGTGGCTGCCAGGCAGAGGG + Intergenic
1008489811 6:52074759-52074781 CAGTGTAGCAGCCAGGGAGATGG - Intronic
1008553748 6:52656123-52656145 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1008919219 6:56824718-56824740 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1010239259 6:73601335-73601357 CGGGGTGGCTGCCGGGCAGAGGG - Intronic
1010270884 6:73914981-73915003 CGGGGTGGCTGCTGGGCAGAGGG + Intergenic
1011291442 6:85781250-85781272 CGGGGTGGCGGCCAGGCAGAGGG - Intergenic
1011588071 6:88947396-88947418 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1011588219 6:88947847-88947869 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1011693028 6:89887476-89887498 CGGTGGGGCGGTGAGGGAGTGGG - Intergenic
1012219517 6:96631412-96631434 GGGTGTGTCTGCGTGGGAGGTGG - Intergenic
1013325986 6:109046835-109046857 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1013681328 6:112528450-112528472 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1014557149 6:122849551-122849573 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1015476639 6:133664722-133664744 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1015625856 6:135180950-135180972 CGGTGCGGCAGCCAGGGAGGAGG + Intergenic
1015689480 6:135905719-135905741 CTGTGTGGGTGCGAGGGTGTGGG + Intronic
1016476439 6:144433506-144433528 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1016637188 6:146306148-146306170 CAGTGTGGCTTCTAGGGAGGCGG + Intronic
1016973598 6:149786478-149786500 CGGGGTGGCTGCCAGGCGGAGGG + Intronic
1017676240 6:156816995-156817017 AGGTCTGGCAGGGAGGGAGAAGG + Intronic
1017771828 6:157650063-157650085 CGCTGTGGGTGCACGGGAGAGGG + Intronic
1017825809 6:158081148-158081170 CGATGTGGGTGCTCGGGAGAGGG + Exonic
1017844052 6:158240990-158241012 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1018525988 6:164710493-164710515 GGGTGTGGCTCTCAGGGAGATGG + Intergenic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1019341293 7:510287-510309 CAGTGTACCTGCCAGGGAGATGG + Intronic
1019439085 7:1037998-1038020 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1019445731 7:1070100-1070122 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1019620472 7:1989442-1989464 CGGTGGGGCCGACAGGGAGAGGG + Intronic
1019669090 7:2268293-2268315 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1019716427 7:2541477-2541499 CGCTGGGGCTGCGAGGAAGAGGG + Exonic
1021672474 7:23046577-23046599 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1021735322 7:23636693-23636715 CGGGGTGGCTGCCAGGCGGAGGG - Intronic
1021872248 7:25018396-25018418 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1022700443 7:32754247-32754269 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1023267053 7:38417777-38417799 GGCTGTGGCAGCGAGGCAGATGG + Intronic
1024989213 7:55220433-55220455 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1025796053 7:64738961-64738983 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1025808263 7:64856263-64856285 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1026783460 7:73284567-73284589 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1026894326 7:74001188-74001210 CTGTGTGGCTGCCAGGGAAGGGG - Intergenic
1027371060 7:77509164-77509186 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1029080785 7:97972331-97972353 CGGGGTGGTGGCGAGGGAGGCGG - Intergenic
1029468978 7:100742110-100742132 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1029475430 7:100780704-100780726 GGGTGAGGGTGGGAGGGAGACGG - Intronic
1029569304 7:101359459-101359481 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1030288312 7:107848305-107848327 CGGGGTGGCTGCCAGGTGGAGGG - Intergenic
1030602774 7:111610102-111610124 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1032291059 7:130590928-130590950 TGGTGTGGCTGCCGGGCAGAGGG - Intronic
1035018936 7:155789013-155789035 CGGTGTGGCAAGCAGGGAGAAGG - Intergenic
1035508006 8:150173-150195 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1036169423 8:6468363-6468385 CGGTCTGGGTGTGTGGGAGAAGG - Intronic
1036507011 8:9365236-9365258 CGGGGTGGCTGCTGGGCAGAGGG + Intergenic
1036536770 8:9657884-9657906 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1036663968 8:10726767-10726789 CTCTGTGGCTGGGAGGGGGAAGG - Intronic
1037756273 8:21712250-21712272 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
1037829533 8:22179501-22179523 TGGTGTGGCTGCCACGGAGCAGG + Intronic
1039201015 8:35094318-35094340 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1039435350 8:37556151-37556173 GGGTGTGGCAGGGAGGGAGCAGG - Intergenic
1039753162 8:40496470-40496492 CGGGGCGGCTGCCAGGCAGAGGG + Intergenic
1039807608 8:41014454-41014476 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
1040052835 8:43033139-43033161 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
1040590788 8:48790215-48790237 AGGTGTGGCTGGGAGGCAAAGGG - Intergenic
1040616208 8:49041421-49041443 CGGGGTGGCGGCCAGGCAGAGGG + Intergenic
1041070734 8:54125277-54125299 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1041796671 8:61753326-61753348 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1042048919 8:64685617-64685639 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1042139289 8:65662694-65662716 CGGTGTGGCTGCCGGGCGGAGGG - Intronic
1042687942 8:71462377-71462399 CGGAGTGGGTGCCAGGAAGAGGG + Intronic
1042902827 8:73746330-73746352 CGGTGTGGCTGCGAGGGAGAGGG - Intronic
1043958444 8:86389683-86389705 CGGGGTGGCGGCCAGGCAGACGG + Intronic
1044248927 8:89984245-89984267 GGGTGAGGCTGGGAGGGAGGGGG + Intronic
1044597156 8:93970568-93970590 CGGGGTGGCGGCCAGGCAGAGGG + Intergenic
1044632311 8:94291788-94291810 GGGTGTGGGGGCGAGGGAGCTGG - Intergenic
1044660569 8:94590647-94590669 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1045120459 8:99029021-99029043 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1046547237 8:115668037-115668059 GAGTGGGGCTGCGAGGGGGAGGG + Intronic
1046599285 8:116297847-116297869 CGGGGTGGCGGCCAGGCAGAGGG - Intergenic
1046844629 8:118902218-118902240 TGGAGTGGATGCCAGGGAGAGGG - Intergenic
1048941345 8:139403306-139403328 GGCTGTGGGTGTGAGGGAGAAGG - Intergenic
1049024945 8:139981888-139981910 CGCTGCGGCTGCTGGGGAGATGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049774173 8:144397055-144397077 GGGCGGGGCTGTGAGGGAGATGG + Intronic
1050558158 9:6807634-6807656 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1051160439 9:14201352-14201374 GGGTGTGGGTGTGAGGGGGAGGG - Intronic
1051335728 9:16064355-16064377 CAGTGTGTCTGCGAGAGAGAAGG + Intergenic
1051431865 9:16987580-16987602 CGGGGTGGTAGGGAGGGAGAAGG + Intergenic
1051609479 9:18947417-18947439 GGGTGTGGCTGAAAGGCAGACGG - Intronic
1051615145 9:18999636-18999658 CGGTGTGGCGGCCGGGCAGAGGG - Intronic
1053048130 9:34936901-34936923 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1053255935 9:36615598-36615620 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1053457174 9:38241983-38242005 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1055255573 9:74366483-74366505 AGGTGTGGCTGAGAGGATGAGGG - Intergenic
1055414365 9:76064654-76064676 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1055506643 9:76955527-76955549 CGGTGTGGCTGCCAGGCGGAGGG - Intergenic
1055506652 9:76955567-76955589 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
1055948259 9:81710292-81710314 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1056152500 9:83804045-83804067 CGGGGTGGCTGCCGGGCAGAGGG - Intronic
1056336435 9:85573856-85573878 CGGGGTGGCTGCCAGGCGGAGGG - Intronic
1056624889 9:88245226-88245248 GGGTGTGGCTGCCGGGCAGAGGG + Intergenic
1056670857 9:88626234-88626256 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1057751504 9:97796636-97796658 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1058659967 9:107257751-107257773 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1058661319 9:107271643-107271665 CGGTGTGGCTGCCGGGCGGAGGG - Intergenic
1058722506 9:107776108-107776130 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1059120769 9:111640678-111640700 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1059210964 9:112514143-112514165 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1060064884 9:120495496-120495518 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1060687039 9:125623548-125623570 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1060703912 9:125780839-125780861 CGGGGTGGCTGCCGGGCAGAGGG + Intronic
1060801746 9:126549473-126549495 AGGTGTGGGTGCCAGGCAGAGGG + Intergenic
1061143088 9:128780309-128780331 TGGGGTGGCTGCCAGGGGGAGGG - Intergenic
1061983987 9:134118623-134118645 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1062032126 9:134366505-134366527 CGGGGTGGCTGCTGGGGAGGGGG - Intronic
1062343089 9:136102420-136102442 AGGTCTGGCTGCCGGGGAGAGGG + Intergenic
1062434068 9:136538697-136538719 AGCTGTGGCTGCGAGGGCGTGGG - Intronic
1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG + Intergenic
1062543419 9:137051527-137051549 CGCTGTGGCTCCCAGGTAGAGGG + Exonic
1185989530 X:4877750-4877772 GGGTGTGCCTGTGAGGGTGAGGG + Intergenic
1186922970 X:14302741-14302763 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1187146223 X:16639928-16639950 CAGAGTGGCTATGAGGGAGAGGG - Intronic
1187976590 X:24709633-24709655 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1188173793 X:26962629-26962651 TGGTGTGGCTGTGAGGGAGGGGG - Intergenic
1188477079 X:30602243-30602265 CGGGGTGGTTGCCAGGCAGAGGG - Intergenic
1189160730 X:38805639-38805661 CGGTGGGGCTGCGTGGAGGAGGG + Exonic
1189587270 X:42474227-42474249 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1190567266 X:51743590-51743612 CTGTGTGGCAGTGAGGGAGCGGG - Exonic
1190793661 X:53721939-53721961 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1190906815 X:54736548-54736570 CGGTGTGGCTGCCGGGCGGAAGG - Intergenic
1191618208 X:63189899-63189921 CGGGGTGGTTGCCAGGCAGAGGG + Intergenic
1191894150 X:65975237-65975259 CGGGGTGGCGGCGGGGCAGAGGG + Intergenic
1192352871 X:70371767-70371789 CGGGGTGGCTGCCAGGTGGAGGG + Intronic
1192621184 X:72681277-72681299 CGGGGTGGTTGCCAGGCAGAGGG - Intronic
1192768531 X:74166543-74166565 CGGGGTGGCTGCCGGGCAGAGGG - Intergenic
1193068059 X:77279453-77279475 CGGGGTGGCTGCCAGGCGGAGGG - Intergenic
1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG + Intronic
1193164635 X:78265683-78265705 CGGGGTGGCTGCCGGGCAGAGGG + Intergenic
1194579882 X:95659070-95659092 CAGTGTGGCTGTCAGGCAGAGGG - Intergenic
1194611603 X:96051247-96051269 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
1195036216 X:100972957-100972979 CGGAGTGGTTGCCAGGCAGAGGG + Intronic
1198246865 X:134839487-134839509 CGGTGTGGCTGCCGGGCGGAGGG - Intronic
1198260412 X:134960412-134960434 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
1198809473 X:140520942-140520964 CAGTGTGGCTAAGAGGTAGAAGG + Intergenic
1199452720 X:147992660-147992682 CGGGGTGGTTGCCAGGCAGAGGG + Intronic
1201335774 Y:12878805-12878827 CGGTGTGGCTGCCGGGCGGAGGG - Intergenic