ID: 1042903073

View in Genome Browser
Species Human (GRCh38)
Location 8:73747110-73747132
Sequence CCCGCAGAGCCTGCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 411}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042903073_1042903082 10 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903082 8:73747143-73747165 GCGAGCTGGGCCCCTGGGCGAGG No data
1042903073_1042903090 24 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903090 8:73747157-73747179 TGGGCGAGGGCCATTCCCGGGGG No data
1042903073_1042903078 -4 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903078 8:73747129-73747151 CGGGGCTAGCGGCGGCGAGCTGG 0: 1
1: 1
2: 1
3: 19
4: 156
1042903073_1042903091 25 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903091 8:73747158-73747180 GGGCGAGGGCCATTCCCGGGGGG No data
1042903073_1042903081 5 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903081 8:73747138-73747160 CGGCGGCGAGCTGGGCCCCTGGG No data
1042903073_1042903088 22 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903088 8:73747155-73747177 CCTGGGCGAGGGCCATTCCCGGG No data
1042903073_1042903083 11 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903083 8:73747144-73747166 CGAGCTGGGCCCCTGGGCGAGGG No data
1042903073_1042903086 21 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903086 8:73747154-73747176 CCCTGGGCGAGGGCCATTCCCGG No data
1042903073_1042903092 30 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903092 8:73747163-73747185 AGGGCCATTCCCGGGGGGCTTGG No data
1042903073_1042903080 4 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903080 8:73747137-73747159 GCGGCGGCGAGCTGGGCCCCTGG 0: 1
1: 0
2: 3
3: 42
4: 332
1042903073_1042903089 23 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903089 8:73747156-73747178 CTGGGCGAGGGCCATTCCCGGGG No data
1042903073_1042903079 -3 Left 1042903073 8:73747110-73747132 CCAGCAGCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 5
3: 53
4: 411
Right 1042903079 8:73747130-73747152 GGGGCTAGCGGCGGCGAGCTGGG 0: 1
1: 1
2: 0
3: 3
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042903073 Original CRISPR CCCGCAGAGCCTGCAGCTGC TGG (reversed) Intronic
901061895 1:6475430-6475452 CCCCCAGAGCCGGCAGATGCGGG - Intronic
901098522 1:6701700-6701722 CCCCCAGAGCGTCCAGCCGCTGG + Intronic
901473475 1:9473411-9473433 CCCCCAGCTCCTGCCGCTGCTGG - Intergenic
901511636 1:9720735-9720757 CCCTCAGCAGCTGCAGCTGCGGG + Exonic
901813282 1:11779691-11779713 CACCCAGAGCCTCCTGCTGCTGG + Intronic
901870812 1:12138330-12138352 CCTGGAGAGCCTGCCGCTGCAGG + Exonic
902260297 1:15219914-15219936 CCCACACAGCCTCCTGCTGCAGG + Exonic
902447396 1:16476013-16476035 CCTGCAGGGCCGGCAGCGGCAGG - Intergenic
903838987 1:26225116-26225138 CCCGCAGGCCCTGGAGCAGCCGG - Intergenic
904006252 1:27364772-27364794 CCCGCAGGGCCTGCAGGTCAGGG + Exonic
904422788 1:30404954-30404976 CCCTCAGAGCCTGCTGCTCTGGG + Intergenic
904720087 1:32500928-32500950 CGCGCAGAGACAGCAGCCGCCGG + Intronic
905456066 1:38088698-38088720 CTGGCACAGCCTGGAGCTGCTGG - Intergenic
907282737 1:53361749-53361771 CCCCCAGAGTCTGCAGCACCTGG - Intergenic
907444776 1:54500437-54500459 CCCCCAGAGCCTGGACTTGCTGG + Intergenic
907905645 1:58782392-58782414 CCTTCAGGGCCTGCAGCCGCGGG + Exonic
908229144 1:62086861-62086883 CCCACAGAGCCTGCTCCTGCCGG - Intronic
908523499 1:64966490-64966512 CCCGCACTGTCTGCAGCTCCAGG + Exonic
910646986 1:89524900-89524922 CCCGCTGAGCCCGCAGCCTCCGG + Exonic
910695338 1:90007634-90007656 CCCCGAGAGCCTACAGGTGCAGG - Exonic
911092897 1:94031828-94031850 CCAGCAGCGCCTGCACATGCTGG + Exonic
912428292 1:109613486-109613508 CCCGCAGTGGCTGCTGCTCCAGG + Exonic
912517884 1:110227291-110227313 CCCACAGAGCCTGCATGGGCTGG - Intronic
913254930 1:116944719-116944741 CCCGCCGAGCCTGAGCCTGCGGG + Exonic
915535548 1:156533389-156533411 CTCCCTGAGCCTGCAGCTCCTGG + Intronic
915701216 1:157798429-157798451 ACCGCAGAGCATGCACCAGCGGG + Intronic
916970821 1:170013127-170013149 TCCCCAGAGCCTGCATCTGTTGG + Intronic
919805741 1:201380103-201380125 CCTGCTGAGGCTGCAGCTGCAGG + Intronic
920050556 1:203162285-203162307 CCAGCAGACCCTGCAGCTTAGGG - Intronic
920856959 1:209670684-209670706 CAAGCAGAGCCACCAGCTGCTGG - Intergenic
921625265 1:217372632-217372654 TCCACAGAGCCTGCAGGAGCTGG + Intergenic
923051261 1:230392878-230392900 GCCCCAGAGCCTGGAGCAGCAGG + Intronic
923633760 1:235674080-235674102 CCCACAGAGCCTGTAACTTCTGG - Intronic
924567402 1:245210193-245210215 ACAGCAGAAGCTGCAGCTGCGGG - Intronic
924624852 1:245689172-245689194 CCCCCAGAGCGAGCAGGTGCGGG - Intronic
1062938244 10:1403615-1403637 CCCTCAGAGTGGGCAGCTGCCGG - Intronic
1063957049 10:11276835-11276857 CACGCAGAGCGTGCAGGGGCTGG - Intronic
1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG + Intronic
1065038296 10:21663307-21663329 CCTGCAGAGGTTTCAGCTGCTGG + Intronic
1065101293 10:22335285-22335307 CCTGCAGAGCCTGCGCCTGCCGG + Intergenic
1065917664 10:30366384-30366406 CCAGCAGAACCAGCAGCTACAGG - Intronic
1067065655 10:43102655-43102677 CCCACAGTGCCTGCTACTGCTGG + Intronic
1067266412 10:44749177-44749199 TCCTAAGAGCCTTCAGCTGCTGG - Intergenic
1067508068 10:46873208-46873230 CCAGAAGAGCCTGCAGCATCTGG - Intergenic
1067654181 10:48178637-48178659 CCAGAAGAGCCTGCAGCATCTGG + Intronic
1067836048 10:49642454-49642476 CCTGCAGAGCCTGCACATGATGG + Intronic
1069719590 10:70541110-70541132 CCCGCAGGGCCTCCAGCAGCTGG - Exonic
1070096090 10:73339663-73339685 GCAGCAGAGCCGGCAGCTCCAGG + Intronic
1072697057 10:97611640-97611662 CCCTCAGAGCCAGCCGTTGCTGG - Exonic
1072727927 10:97826015-97826037 CACGCAGAGCCTTGAGCTGATGG - Intergenic
1072782670 10:98261112-98261134 CCCGCAGGGCCGGCGGCTGGAGG - Exonic
1073143094 10:101261801-101261823 CAGGCTGAGCCTGCAGGTGCTGG - Intergenic
1073212703 10:101818033-101818055 CCCGCAGAGGTGGCAGCGGCCGG - Exonic
1073541200 10:104317363-104317385 CCAGGAGATACTGCAGCTGCTGG - Intronic
1073945062 10:108740876-108740898 CCAGCAGAGGCTGCAGTAGCAGG - Intergenic
1075104020 10:119525298-119525320 CCTGCACAGGCTGCAGCTGGTGG - Intronic
1075285632 10:121183468-121183490 CCAGAAGAGGATGCAGCTGCAGG + Intergenic
1075483189 10:122799691-122799713 TCTGCAGATTCTGCAGCTGCTGG + Intergenic
1075516499 10:123112868-123112890 CCAGCAGAGGCTGCAGAGGCTGG + Intergenic
1076329216 10:129652624-129652646 CCCGCAGTGGCTGCTGCTGTTGG + Intronic
1076603882 10:131677073-131677095 TCGGCAGAGCCTGCATTTGCAGG - Intergenic
1076657703 10:132035955-132035977 CCCACCGAGCTTGCAGGTGCAGG - Intergenic
1076847466 10:133076312-133076334 CCCACTGTGCCTGCATCTGCAGG - Intronic
1077060946 11:617637-617659 CCCGCAGAGCCCGCACCCCCCGG - Exonic
1077321987 11:1946833-1946855 ACCGCTGCGCTTGCAGCTGCTGG - Intergenic
1077354513 11:2108980-2109002 CCCTCAGAGGCCTCAGCTGCTGG - Intergenic
1077495934 11:2886395-2886417 CCCGCGCGGCCTGCTGCTGCTGG + Intergenic
1077539502 11:3139869-3139891 CTCGCAGAGGCTGAAGCTGGTGG + Intronic
1077661739 11:4074601-4074623 CCCGCAGCTCCTTCAGCCGCTGG - Exonic
1077925924 11:6682186-6682208 GCCGCAAACCCTGCAGCAGCTGG + Exonic
1078091613 11:8267949-8267971 CCCACAGATCCTGCAGGTGCAGG - Intronic
1078573059 11:12475949-12475971 CCCGGAGAGTGTGCAGCGGCAGG - Intronic
1083172006 11:60928725-60928747 CCCCCAGGGCCCTCAGCTGCAGG - Exonic
1083720045 11:64599528-64599550 CCCACAGAGCTGGCAGCTGAAGG + Intronic
1083725166 11:64624098-64624120 CCCCCGGAACCTTCAGCTGCTGG + Intronic
1083725173 11:64624107-64624129 CCCCCAGTGCCAGCAGCTGAAGG - Intronic
1083811390 11:65108695-65108717 CCCGGAGACCCTGCAGGTGGTGG - Exonic
1083941896 11:65900341-65900363 CCCGCAGAGCCGCCAGCCCCGGG - Exonic
1084050881 11:66599180-66599202 CCAGGAGAGCCTGCACCTCCTGG - Exonic
1084272841 11:68038398-68038420 CCCCCCGCGGCTGCAGCTGCAGG + Intergenic
1084274010 11:68042761-68042783 CCCGCACATCCCGCAGCTCCTGG - Exonic
1084274312 11:68043883-68043905 ACAGCAGAGCCAGGAGCTGCAGG + Exonic
1084657665 11:70528623-70528645 CCGGCAGAGCCTGAGGCTGAGGG + Intronic
1084860237 11:72013380-72013402 CCTGCTCGGCCTGCAGCTGCTGG + Exonic
1084860369 11:72014124-72014146 CCCGCAGTGCCTCCAGCTTGGGG + Exonic
1084929347 11:72542115-72542137 CCAGCAGAGCCTAAAGCTGTAGG + Intergenic
1087292741 11:96338323-96338345 CCTGCAGACTCTGCAGCAGCGGG + Intronic
1088808163 11:113370432-113370454 CCCACAGGGCCGGGAGCTGCTGG - Intronic
1088920199 11:114254941-114254963 CCCGGGGAGGCCGCAGCTGCTGG - Intergenic
1088981766 11:114870821-114870843 CCGGCAGAAACAGCAGCTGCTGG - Intergenic
1089012887 11:115145056-115145078 CAGGCAGGGCCTGCAGCTCCAGG + Intergenic
1089391223 11:118103232-118103254 CCCGAAGGGCCTGCAGTGGCAGG + Exonic
1089498344 11:118918990-118919012 TCCACACAGCCTGCAGCTCCAGG + Intronic
1089619743 11:119715276-119715298 CCAGCTGGGCCTGCAGCTGAAGG - Intronic
1089734294 11:120539065-120539087 CCAGCCGAGACTGCAGCTGGGGG + Intronic
1090099458 11:123778774-123778796 CCCACAGAGTCTGCAGCTGCAGG - Intergenic
1090190539 11:124763496-124763518 CCCGCAGAGCGGGCAGCGTCAGG - Intergenic
1091315141 11:134609444-134609466 CCCGCAGGACCTTCAGCGGCAGG - Intergenic
1202805003 11_KI270721v1_random:2146-2168 ACCGCTGCGCTTGCAGCTGCTGG - Intergenic
1091713851 12:2762219-2762241 CCAGCACAGCATGCAGCTTCTGG + Intergenic
1091829921 12:3542315-3542337 ACAGCTGAGCCTGCAGCTTCTGG + Intronic
1092181788 12:6451385-6451407 CCCCCTGAGCCAGCACCTGCGGG + Exonic
1096080119 12:48827578-48827600 CCCCCAGAACCAGCAGCTGCTGG + Exonic
1096516204 12:52156958-52156980 CGCTCAGAGCCTGCAGATGGTGG + Intergenic
1096770630 12:53933920-53933942 CAAGCAGAGTCTGCAGCTGGGGG + Intergenic
1096997359 12:55847145-55847167 CCCCTAGAGTCTGGAGCTGCAGG + Intergenic
1100618048 12:96247035-96247057 CCGGGAGAGCCTTCTGCTGCAGG + Exonic
1101963666 12:109267726-109267748 CCTGCAGAGCCAGGAGCTGCTGG - Exonic
1102965430 12:117121622-117121644 CCCGCAGATCCTGCAGCCCCCGG - Intergenic
1103560469 12:121790765-121790787 CCCCCAGACCCTGCTGCAGCGGG - Intronic
1103701186 12:122849498-122849520 CCAGCTGGGCCTGCATCTGCAGG - Intronic
1104391942 12:128398185-128398207 CCAGCAGTGCCTGAAGCTGGAGG - Intronic
1104604777 12:130179879-130179901 CCCGCAGCAGCTGAAGCTGCAGG - Intergenic
1104660710 12:130609828-130609850 CCCGCAGATGCTGAAGCTCCTGG - Intronic
1104780166 12:131414558-131414580 GGGGCGGAGCCTGCAGCTGCTGG - Intergenic
1104867039 12:131961738-131961760 CCTTCAGAGCCTGCATCTCCTGG - Exonic
1104885588 12:132105106-132105128 CCTTCAGAGCCTGCATCTCCTGG - Exonic
1104965958 12:132508961-132508983 CCCGCGGAGGAAGCAGCTGCAGG - Intronic
1105071409 12:133236128-133236150 CCCGCAGAGCCTGCTCCTTCCGG - Intergenic
1105794856 13:23841302-23841324 CCTGCTCAGCCTGCAGTTGCAGG - Intronic
1106224031 13:27771668-27771690 CCCCCAGTGTCTTCAGCTGCCGG + Intergenic
1106414414 13:29534526-29534548 TCAGCAGATACTGCAGCTGCTGG + Intronic
1106510508 13:30408640-30408662 GCCGCAGCGCGCGCAGCTGCCGG - Intergenic
1107561712 13:41562694-41562716 CCTACAGAGCCTGAGGCTGCTGG - Intergenic
1109008633 13:56910386-56910408 CCGGCGGAGCCGGCAGCTCCAGG - Intergenic
1109595594 13:64549553-64549575 AAGGCAGTGCCTGCAGCTGCAGG + Intergenic
1112443829 13:99445476-99445498 CTCCCAGAGCCGGCAGCAGCTGG - Intergenic
1112621933 13:101062069-101062091 CCGGAAGAGCTTGCAGCTGGAGG - Exonic
1113355214 13:109572603-109572625 GTCGCAGAGCCTGTGGCTGCGGG + Intergenic
1117546489 14:56798082-56798104 CCAGCAGGGCCCGCGGCTGCTGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118051999 14:62039241-62039263 AATGCAGACCCTGCAGCTGCAGG + Intronic
1118312502 14:64704309-64704331 CCCGCAGAGCCGCCAATTGCTGG + Intronic
1118327780 14:64793181-64793203 CCCGCAGGGCCTGCAGCCGATGG + Exonic
1119021729 14:71121889-71121911 CACACAGAGCCTGCTCCTGCTGG + Intergenic
1119711831 14:76828092-76828114 CCCGTAGACCCTGCAGCCGGAGG + Intronic
1119759643 14:77141483-77141505 CCGGCAGCGCCGGCAGCCGCGGG + Intronic
1119806304 14:77484636-77484658 CAGGCAGAGCCAGGAGCTGCTGG + Intronic
1120955631 14:90079548-90079570 GCAGCAGAGCCTGCAACTGCTGG + Intronic
1121310975 14:92934854-92934876 GCCGTAGTGCCTGCAGCTGGTGG - Exonic
1121850725 14:97219212-97219234 CCCTCAGCCCCTGCAACTGCGGG - Intergenic
1122156889 14:99755290-99755312 CCCGGGGAGCCTGGGGCTGCCGG + Intronic
1122308401 14:100779732-100779754 CCCCCGGAGCCTGGAGCTGCAGG + Intergenic
1122773506 14:104107319-104107341 CCCGCACGGCCAGCAGCAGCGGG - Exonic
1123030788 14:105450149-105450171 CGGGCAGAGACTCCAGCTGCCGG - Exonic
1125675738 15:41501783-41501805 CGAGCAGGTCCTGCAGCTGCAGG - Exonic
1125725455 15:41866157-41866179 TCCGCAGGCCCTGCAGCCGCTGG + Exonic
1125726296 15:41870005-41870027 CCAGCAGTTCCTGCAGCTGCGGG + Exonic
1127174365 15:56338190-56338212 CCTGCAGAGCCTGAAGTTGCTGG + Intronic
1128106009 15:65045407-65045429 CCTGGAGAGCCTGCGGCAGCTGG - Exonic
1128146516 15:65335029-65335051 CCTGCAGAGCCCGCAGCAGAGGG - Intronic
1128264679 15:66255462-66255484 CCCTCAGAGTCTGCAACTGAGGG + Intergenic
1128667167 15:69547102-69547124 CCTCCAGGGCCAGCAGCTGCAGG - Intergenic
1129329787 15:74821118-74821140 CCCGCAGAGCCTGCAGGATCCGG - Exonic
1129530644 15:76261575-76261597 CTCCCAGAGTCCGCAGCTGCAGG - Intronic
1129696173 15:77741711-77741733 CCCACAGAGCCTGCAGCCTCAGG - Intronic
1130928343 15:88401823-88401845 CCCAGAGAGGCAGCAGCTGCCGG - Intergenic
1130962793 15:88674685-88674707 ACCGCAGAGCCTGCAGAGGGGGG - Intergenic
1131943429 15:97592841-97592863 CCCCAACAACCTGCAGCTGCGGG + Intergenic
1132381545 15:101369873-101369895 CCTGCAGAACCTGCACCAGCAGG - Intronic
1132399134 15:101494598-101494620 GACGCAGAGCCTGAAGCTGCAGG - Intronic
1132739227 16:1403057-1403079 CCAGCAGAGCCTGCAGCAGCAGG + Intronic
1132739235 16:1403111-1403133 CCAGCAGAGCCCACAGCAGCAGG + Intronic
1132775421 16:1591106-1591128 CCCACAAAGCCTACAGCTCCCGG + Intronic
1132797508 16:1732520-1732542 GCCGTGGAGCCTGCAGCAGCAGG + Intronic
1132941986 16:2513076-2513098 CACGCAAAGCCTGCACCTTCAGG - Intronic
1133095767 16:3444075-3444097 CTCGCTTAGGCTGCAGCTGCGGG - Intronic
1133116132 16:3578969-3578991 ACAGCCGAGGCTGCAGCTGCTGG - Intergenic
1133234386 16:4381099-4381121 CCTGCCGGGCCTGCAGCTCCTGG + Exonic
1134061466 16:11202094-11202116 CCTGCAGCTCCTGCAGCTCCCGG + Intergenic
1134100242 16:11446867-11446889 CCCGCAGAGCCTCCTCCTGCAGG - Exonic
1136591254 16:31219106-31219128 ACAGCAGAAACTGCAGCTGCAGG + Exonic
1136592236 16:31224449-31224471 CTCGCAGGGCCTGTGGCTGCTGG + Exonic
1136705925 16:32188061-32188083 CCGGCTGAGCCAGCGGCTGCTGG - Intergenic
1136761987 16:32741344-32741366 CCGGCTGAGCCAGCGGCTGCTGG + Intergenic
1136806113 16:33129044-33129066 CCGGCTGAGCCAGCGGCTGCTGG - Intergenic
1137365937 16:47859488-47859510 CCTGCAGATCCTGCTGCTTCTGG - Intergenic
1138294394 16:55874022-55874044 CCCGCAGGGCCTTCTGCTGAAGG - Exonic
1138331359 16:56218426-56218448 CCTGCCGAGCCTGCTGCAGCAGG - Intronic
1138641695 16:58392813-58392835 CCCGGAAAGACTGCAGCTCCCGG + Intronic
1140850727 16:78932637-78932659 ACCCCAGAGGCCGCAGCTGCAGG - Intronic
1140977457 16:80073794-80073816 CTTCCAGAGCCTGCTGCTGCAGG - Intergenic
1141489507 16:84362625-84362647 CCAGCAGTGCCCACAGCTGCAGG + Intergenic
1141495773 16:84408413-84408435 CCCCCTGATCCTGCTGCTGCTGG + Exonic
1141567573 16:84913517-84913539 CCATCAGAGTCAGCAGCTGCAGG - Intronic
1141880329 16:86854233-86854255 CCAGAAGAGTCTGCTGCTGCCGG - Intergenic
1141967776 16:87458545-87458567 TCAACAGAGGCTGCAGCTGCTGG + Intronic
1142270760 16:89088246-89088268 GCCGCAGAGCCTGCAGTGGGAGG + Intergenic
1142418206 16:89954477-89954499 CCCACGGAGCCGGCACCTGCTGG + Intronic
1203064146 16_KI270728v1_random:1001660-1001682 CCGGCTGAGCCAGCGGCTGCTGG + Intergenic
1142549798 17:731990-732012 CCCGGAGCGGCTGCAGCCGCTGG + Intergenic
1142696902 17:1638832-1638854 CCTGCTGTGCCTGCTGCTGCTGG - Exonic
1142849649 17:2698179-2698201 CCCGCGGTACCTGGAGCTGCTGG - Exonic
1143022726 17:3925140-3925162 CCCTCCCAGCCTGCAGCTCCTGG + Intronic
1143188108 17:5022646-5022668 CCCGCAGGGCCTGCAGCTCCCGG - Exonic
1143323038 17:6080430-6080452 TGGGCAGAGGCTGCAGCTGCAGG + Exonic
1143600792 17:7944521-7944543 CCCGCTGCTCCTCCAGCTGCTGG - Exonic
1144388333 17:14770667-14770689 CCAGCAGAGCCTAAAGTTGCAGG + Intergenic
1144519104 17:15942621-15942643 CCTGCACGCCCTGCAGCTGCTGG - Intergenic
1144930631 17:18856141-18856163 CCTGCTGATGCTGCAGCTGCTGG - Intronic
1145063202 17:19745027-19745049 GCTGCAGCGCCTCCAGCTGCTGG + Exonic
1146398416 17:32486469-32486491 GCCGCGGCGCCCGCAGCTGCCGG - Intergenic
1147159882 17:38563613-38563635 GCCTCAGACCCTGCCGCTGCGGG - Intronic
1147475119 17:40703532-40703554 CCCACTCAGGCTGCAGCTGCTGG + Exonic
1147947167 17:44086701-44086723 CCTGCAAAGGCTGCAGCGGCTGG + Exonic
1147994734 17:44354452-44354474 CCCCCAGCGCCCGCAGATGCCGG - Exonic
1148201771 17:45754051-45754073 CCTGCAGAGCTGGAAGCTGCAGG - Intergenic
1148236918 17:45975129-45975151 CCTGCACAGCCTGGAGCTCCTGG + Intronic
1149486478 17:57046473-57046495 CCCGCTGCGCCTGAGGCTGCGGG + Intergenic
1149753978 17:59172667-59172689 CGCGCACCCCCTGCAGCTGCTGG - Intronic
1149796159 17:59521924-59521946 CCCTGACAGCCTGCAGCTGGCGG + Intergenic
1150656312 17:67042039-67042061 CCCGCAGTAGCTGCAGCTGCGGG + Intergenic
1150722928 17:67628732-67628754 CACGCAGTGCCTGCAGCAGGAGG + Intronic
1150983358 17:70168990-70169012 CCCGCGGAGGCTGCAGCGCCCGG - Intronic
1151324291 17:73369347-73369369 CCCGCTGCACCAGCAGCTGCTGG + Intronic
1151414132 17:73950630-73950652 CCCGGAGAGCCTGAAGCTCCGGG - Intergenic
1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG + Intergenic
1151745232 17:76008362-76008384 GCAGCAGACACTGCAGCTGCAGG - Exonic
1151936436 17:77264828-77264850 CCCACAGGGGCTGCAGCTGCAGG - Intergenic
1152092010 17:78252358-78252380 CCCACAGAGTGTGCAGCTGGTGG - Intergenic
1152209952 17:78997707-78997729 CCTCCAGCGCCTGCAGCTTCCGG - Exonic
1152287798 17:79422590-79422612 CCCGCCCAGCCTGAGGCTGCTGG - Intronic
1152323381 17:79621817-79621839 CCCACAAAGGCAGCAGCTGCTGG + Intergenic
1152323421 17:79622173-79622195 CCCACAAAGGCAGCAGCTGCTGG + Intergenic
1152500895 17:80708417-80708439 AGCCCAGAGCCTGCACCTGCAGG - Intronic
1152563830 17:81091407-81091429 CCAGCATAGGGTGCAGCTGCTGG - Intronic
1152724984 17:81940760-81940782 CTCGCAGAGCCTGGAGCTGGTGG + Exonic
1152804473 17:82348559-82348581 CCCCCAGGGCCTGGGGCTGCAGG + Intergenic
1152889912 17:82874447-82874469 CACACCGAGCCAGCAGCTGCTGG + Intronic
1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG + Intergenic
1153027021 18:681310-681332 GCTGCAGAGCCTGCAGGTCCAGG - Intronic
1153658720 18:7307751-7307773 ACCGCAGGGCCAGAAGCTGCTGG + Intergenic
1155654645 18:28178209-28178231 CCCGCAGCCCCTCCACCTGCCGG - Intergenic
1160515693 18:79478165-79478187 CCCGAGGAGCCAGGAGCTGCCGG + Intronic
1161001654 19:1913919-1913941 CACGCAGAGCCCCCACCTGCCGG - Intronic
1161003017 19:1920641-1920663 CCTGCAGAGGCTGTGGCTGCAGG + Intronic
1161074054 19:2276438-2276460 CCCGTGGGGCCTGGAGCTGCAGG - Exonic
1161124086 19:2546300-2546322 CCTGGAGAGGCTGCAGGTGCAGG - Intronic
1161221795 19:3121229-3121251 TCCACGGAGCCTGCGGCTGCCGG + Exonic
1161384229 19:3982464-3982486 TGCGCAGAGCCTGAAGCTACGGG + Intronic
1161428581 19:4217701-4217723 CCCGCAGAACCTCCAGCTCCCGG - Exonic
1161590580 19:5127494-5127516 CACGCATAGCCCGCACCTGCTGG - Intronic
1161907635 19:7169011-7169033 CCTGCAGTTTCTGCAGCTGCAGG - Intronic
1162052999 19:8046404-8046426 CCCGCACATCCTGCAGGGGCAGG + Intronic
1162559260 19:11406442-11406464 CCCGCAGAGGGCGCAGCGGCTGG - Exonic
1162932186 19:13962754-13962776 CCCGGAGACCCTGGAGCCGCCGG - Exonic
1163013788 19:14441385-14441407 CGTGCAGCTCCTGCAGCTGCTGG - Exonic
1163089736 19:15011350-15011372 CCAGCAGAGCGTCAAGCTGCGGG + Exonic
1163635614 19:18435942-18435964 GCCGCAGGGCCTGCAGCTGCTGG - Intronic
1163662858 19:18589030-18589052 CGCGCTCAGCCTGCAGCTGGTGG - Exonic
1164507997 19:28875127-28875149 CCTACAGAGCCTGCCCCTGCAGG + Intergenic
1164529591 19:29038208-29038230 CCAGCAGAGCCTGAAGCTTTGGG - Intergenic
1165093179 19:33397077-33397099 CCCCGAGGTCCTGCAGCTGCTGG + Intronic
1165284173 19:34825461-34825483 GGCGCAGATCCTGGAGCTGCTGG + Intergenic
1165907806 19:39204227-39204249 CCCGCTGCGCCCGCTGCTGCTGG - Exonic
1166781466 19:45345634-45345656 CCCGCAGCGCCTCCAGCCCCTGG - Exonic
1166959614 19:46489668-46489690 CCAGCACAGGCTGCAGCAGCCGG - Intronic
1167050023 19:47072434-47072456 CCCGCAGCAGCTGCAGCAGCAGG - Exonic
1167433579 19:49466277-49466299 CCCACAGACCCTTCACCTGCAGG - Exonic
1167468373 19:49662242-49662264 CCCGGAGGGCCTGCGGCTGGTGG - Exonic
1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG + Exonic
1167633355 19:50639351-50639373 CCAGCAGATCCTGCAGCGCCGGG - Intronic
1167649388 19:50721152-50721174 CCCGGAGAGCCTGCAGCTGGAGG - Intergenic
1167979296 19:53259490-53259512 ACTGCAGAGCCTGGATCTGCTGG - Exonic
1168217853 19:54939591-54939613 CCCGCAGGGCGCACAGCTGCGGG - Exonic
1168224265 19:54983009-54983031 CCCGCAGGGCGCACAGCTGCGGG + Exonic
925577017 2:5370551-5370573 CCCACACAGCATGCACCTGCTGG - Intergenic
925609858 2:5693477-5693499 CCAGCAGCTCCTGCAGCCGCCGG + Exonic
927672657 2:25082112-25082134 AGAGCAGATCCTGCAGCTGCTGG - Intronic
930946782 2:57084869-57084891 TCCACAGAGCCTGCAGGAGCCGG - Intergenic
931516969 2:63055696-63055718 CCCGCAGCCGCTGCAGCCGCTGG - Exonic
931563705 2:63591103-63591125 AGCACAGAGCCTGCATCTGCAGG + Intronic
933703743 2:85274409-85274431 CCTCCAGAGCATGCAGCTGTCGG + Intronic
934704881 2:96470584-96470606 ACCGCGGACCCTGCAGCTTCGGG - Intergenic
935137566 2:100321454-100321476 CCTGCAGCGCCAGCAGCAGCCGG - Exonic
935147215 2:100403984-100404006 CACTCAGAGCCTGCCCCTGCAGG - Intronic
935191408 2:100781667-100781689 GCCGTAGAGCCGGCGGCTGCAGG - Intergenic
936038225 2:109129283-109129305 AGCGCAGCGCCTGCGGCTGCGGG - Intergenic
937053843 2:118914521-118914543 CCCTCAGATCCTGCACCTGCTGG + Intergenic
938065688 2:128280882-128280904 CAGGCAGAGCCTGCAGCTGATGG + Intronic
938407377 2:131040000-131040022 CACGCATGGCCTGCAGCTGAGGG + Exonic
938911074 2:135886571-135886593 ACCACAGAGTCTGCAGCTGTGGG + Intergenic
939418967 2:141941441-141941463 ACAGCAGAGCCTCCTGCTGCTGG + Intronic
939502713 2:143006822-143006844 CCAACAGACCCTGCAGCTGAGGG + Intronic
943212108 2:184980192-184980214 CCCTCATCTCCTGCAGCTGCAGG + Intergenic
945485467 2:210390306-210390328 CCTGCAAAGCCTGTAGCAGCAGG - Intergenic
946756605 2:222953768-222953790 CCCCCAGAGCCTCCTGCTGTGGG + Intergenic
947043337 2:225949355-225949377 CCTGCAGACTCTGCTGCTGCTGG + Intergenic
947399103 2:229714547-229714569 ACCGCGGATCCCGCAGCTGCAGG - Exonic
947537971 2:230952849-230952871 CATGCAGAGGCTTCAGCTGCTGG - Intronic
948058713 2:235028281-235028303 CCAGGACAGCCTGCAGTTGCAGG - Intronic
948201588 2:236133390-236133412 CCAGCAGACTCTGCAGCTGTTGG - Intergenic
948209165 2:236179550-236179572 CCCGAAGAGCTTGCAGCCGCCGG - Intergenic
948733782 2:239984840-239984862 CCGGCAGAGCTTTCAGCAGCAGG + Intronic
948806707 2:240456222-240456244 CCCTCAGAACCTGCAGGTGGGGG + Intronic
1168813278 20:720112-720134 CCTGCAGAGTCTCCAGCTGGAGG + Intergenic
1169130813 20:3165643-3165665 CCAGCAGGGCCTACAGCTGCAGG - Intronic
1169342401 20:4806203-4806225 CCAGCAGAGCCAGGAGCTGGTGG + Intronic
1170091517 20:12594178-12594200 CCCACAGAGGCTGAATCTGCAGG - Intergenic
1171099985 20:22373913-22373935 TCAGCAGAGCTTGCAGCTGCTGG + Intergenic
1172446125 20:34994386-34994408 GACTCACAGCCTGCAGCTGCAGG - Exonic
1172511510 20:35504186-35504208 CCCGCAGAGCTTCCAGCTCCTGG - Exonic
1173172526 20:40738959-40738981 CTCACAGAGGCTGAAGCTGCCGG - Intergenic
1173704668 20:45101018-45101040 CCCGCCGAGCCTCCTGCTGCAGG + Exonic
1174082761 20:47982884-47982906 CCCGCACATCATGCAGTTGCCGG - Intergenic
1174133195 20:48360098-48360120 CCCGCACATCATGCAGTTGCAGG + Intergenic
1174170893 20:48617685-48617707 GGCGCAGAGCCTACAGCTGCTGG - Intergenic
1174179999 20:48668731-48668753 CCCGCAGGCCCTCCAGCTACTGG - Intronic
1174423395 20:50415560-50415582 CCCTCTGAGCCTGGGGCTGCAGG - Intergenic
1175429561 20:58891843-58891865 CACGCACCGCCTGCTGCTGCTGG + Intronic
1175722701 20:61296943-61296965 CGCTCAGAGCCAGCAGCTCCAGG - Intronic
1176178178 20:63738302-63738324 CCTGCGGTGGCTGCAGCTGCCGG - Exonic
1176298040 21:5084840-5084862 CCCCAAGACCATGCAGCTGCAGG + Intergenic
1176547494 21:8208128-8208150 CCCGCAGAGGCGGCGGCTCCGGG - Intergenic
1176566445 21:8391175-8391197 CCCGCAGAGGCGGCGGCTCCGGG - Intergenic
1178680478 21:34669470-34669492 CCCGGAGAGCCAGGAGCCGCGGG + Exonic
1178915698 21:36704648-36704670 TCCTCGGAGCCAGCAGCTGCTGG + Intronic
1179466646 21:41580268-41580290 CCAGCACAGCCAGCAGCTGGAGG + Intergenic
1179858989 21:44177109-44177131 CCCCAAGACCATGCAGCTGCAGG - Intergenic
1179902835 21:44402768-44402790 CCCACGGTGCCTGCACCTGCTGG + Intronic
1180006379 21:45022978-45023000 CTCACAGATCCTGCAGCTGTGGG + Intergenic
1180184944 21:46134844-46134866 ACCACACAGCCTGCAGCTCCAGG + Intergenic
1181267886 22:21641872-21641894 CCTCAAGACCCTGCAGCTGCGGG + Intergenic
1181438284 22:22922834-22922856 CCCACAGAAGCTACAGCTGCCGG + Intergenic
1181671758 22:24428763-24428785 CCTGCAGTGCCTGAAACTGCAGG + Intronic
1181673081 22:24434988-24435010 CTCGCAGAGCCTGCACCAGGTGG + Intronic
1182287165 22:29255291-29255313 CCAGCTGAGCCTGCTGCTGCAGG - Intronic
1182696073 22:32200155-32200177 CCCGCAGCAGCTACAGCTGCCGG + Intronic
1183583741 22:38740272-38740294 CCCGCACGGCCTGGATCTGCTGG + Exonic
1183774657 22:39956044-39956066 CCTCCAGAGCATGCAGCTGAAGG + Intronic
1183780350 22:39995225-39995247 CCCGCAGGGCCTGGCGCTCCGGG - Exonic
1184037767 22:41926596-41926618 CGCGCGGCGCCGGCAGCTGCGGG - Intronic
1184262692 22:43328428-43328450 CCCACAGAGCCTGCAGTTTTTGG - Intronic
1184863210 22:47188616-47188638 CCAGCAAAGCCGGCAGGTGCAGG + Intergenic
1185182743 22:49372611-49372633 ACGGCAGAGACTGCAGCTGCGGG - Intergenic
1185206232 22:49540801-49540823 CTCCAAGAACCTGCAGCTGCAGG - Intronic
1185327222 22:50232651-50232673 CCCTCAGCGCCGGCAGCAGCTGG + Intronic
950042584 3:9929860-9929882 CTCGGAGAAGCTGCAGCTGCAGG + Exonic
950195393 3:11005815-11005837 CCCGCAGAGACGTCTGCTGCAGG - Intronic
950431426 3:12953255-12953277 CCATCAGAGCCTGGAACTGCCGG + Intronic
950454659 3:13085536-13085558 CCAGCAGAGCCTGCAGGAGACGG + Intergenic
952644646 3:35640086-35640108 CCCGCTGCCCCTGCTGCTGCTGG - Intronic
952990038 3:38823909-38823931 CCCACAGGGGCTGCAGCTGCAGG - Intergenic
953016397 3:39080951-39080973 CCCAAAGAGCCTTAAGCTGCAGG + Intronic
953975812 3:47381042-47381064 CCCGTAGCTGCTGCAGCTGCTGG - Exonic
959480370 3:106865172-106865194 TCCTCAAGGCCTGCAGCTGCAGG + Intergenic
961191836 3:124968673-124968695 CCCCCAGAACCCGCAGCTGTGGG - Exonic
961204409 3:125069407-125069429 GCTGCAGAGCCTGGAGCTGATGG + Intergenic
968583380 4:1405032-1405054 CGCTCAGAGCCTCCACCTGCGGG - Intronic
968585971 4:1416244-1416266 CCGGCCAAGTCTGCAGCTGCAGG - Intergenic
968635550 4:1676670-1676692 CCCGCAGACACTGCTGCTCCTGG + Intronic
968657165 4:1783617-1783639 ACCGCAGAGCCAGCAGCAGCTGG + Intergenic
968874041 4:3255893-3255915 GGTGCAGAGCCTGCAGCTGCAGG + Exonic
968904995 4:3446919-3446941 CCTGCAGAACCTGCAGCCGGCGG + Intronic
969574868 4:8030879-8030901 CCTGCAGAGCCAGCAGCAGCTGG - Intronic
969608216 4:8212708-8212730 TCCGCACAGCCAGCAGCTGCAGG - Exonic
969669052 4:8579758-8579780 CTGGCAGAGCCTGCAGGTGAGGG + Intronic
969685665 4:8672658-8672680 CCAGCAGAGCAGGCAGCTTCTGG - Intergenic
972330373 4:38058468-38058490 GCAGCTGAGCCTGCAGCCGCTGG + Intronic
975587917 4:75969656-75969678 TCCACAGACCCAGCAGCTGCTGG + Intronic
976292723 4:83437488-83437510 CCCCCATAGCCTGGAACTGCAGG - Intronic
978815127 4:112895607-112895629 GCCCCAGAGCTTGCAGATGCTGG + Intronic
984837152 4:184032745-184032767 CTCACAGAGCCTGCAGTGGCTGG + Intergenic
984891534 4:184498536-184498558 ACAACAGAGCCTGCAGCTGCTGG + Intergenic
985777785 5:1853928-1853950 CCCTCAGTGCCTGCTGCTGAGGG - Intergenic
985904062 5:2819243-2819265 GAGGCAGAGCCTGCAGCTGTGGG + Intergenic
987295565 5:16547456-16547478 CCCGCAGAGCCTGGAACTGTTGG + Intronic
988534388 5:32053229-32053251 AAAGCAGAGCCTGCAGCTTCAGG + Intronic
990744930 5:58950093-58950115 AACGCAGACCCTGCTGCTGCTGG + Intergenic
994400527 5:99274235-99274257 CCCGGAAGCCCTGCAGCTGCTGG + Intergenic
995658406 5:114453001-114453023 CTCTCTGAGCCTGCAGCTGGTGG + Intronic
996905758 5:128597641-128597663 CCAGCAGAGCCTGGAGCTGATGG + Intronic
997644712 5:135473984-135474006 CCTGGAGAGTCTGCACCTGCAGG + Intergenic
998098792 5:139414718-139414740 CACACAGAGCCTACTGCTGCCGG + Intronic
998172565 5:139881139-139881161 CACGGAGTCCCTGCAGCTGCAGG + Intronic
999328237 5:150656625-150656647 CCAGAAGCGCCTGCAGCTGGCGG - Intronic
999993155 5:157067173-157067195 CCCCCATAGCCTGCACCTGCAGG - Intergenic
1001392274 5:171388467-171388489 GCCTCAGAGCCTGGAGCTGCCGG + Intronic
1001423122 5:171601803-171601825 GCCCCAGAACCTGCTGCTGCTGG - Intergenic
1001431539 5:171666454-171666476 CCAGCAGAGACAGCTGCTGCGGG + Intergenic
1001452617 5:171838009-171838031 CCAGCAGAGCATGGAGCTGAGGG + Intergenic
1001640795 5:173242796-173242818 CCAGCAGGGACTCCAGCTGCAGG + Intergenic
1003342983 6:5239736-5239758 CCCTGACAGCCTGCAGCTGGTGG - Intronic
1004424155 6:15496506-15496528 GCGGGAGGGCCTGCAGCTGCGGG + Exonic
1006634568 6:35452626-35452648 CCTGCAGCGCCTGCAGCAGGAGG - Exonic
1007316114 6:40990560-40990582 CCCCCAGAGCCTGTTCCTGCAGG + Intergenic
1007680289 6:43629052-43629074 CCCGCAGCCGCTGCTGCTGCCGG + Exonic
1010559540 6:77333073-77333095 TCCGCAGAGCCAGCAGGGGCTGG + Intergenic
1010687309 6:78867861-78867883 CACGCAGAGCCTCCAGCAGCAGG + Exonic
1011930277 6:92701935-92701957 TCTGCAGAGCCTGCAGGGGCTGG - Intergenic
1013318859 6:108967283-108967305 CCCGCATAGGCAGCAGCTACCGG + Intronic
1013423067 6:109983841-109983863 CCCCCAGAGCCAGCACCAGCAGG + Intergenic
1014474924 6:121860363-121860385 TCTGCAGAGCCTGCTGCTGGGGG + Intergenic
1014925589 6:127266859-127266881 GCCTCGGAGCCCGCAGCTGCCGG - Exonic
1015843935 6:137498185-137498207 CAGGCAGAGCCGGCAGCTGCTGG - Intergenic
1017906563 6:158760787-158760809 TCTGCAGAGCCTGGTGCTGCAGG + Intronic
1018058582 6:160072322-160072344 CCTGGAGAGCCTAGAGCTGCTGG - Intronic
1019159063 6:170057569-170057591 TCCGAGGAACCTGCAGCTGCAGG + Intergenic
1019401976 7:860262-860284 TCCGCAGGATCTGCAGCTGCAGG - Exonic
1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019997415 7:4733801-4733823 CCCACCCAGCCTGCAGCTTCGGG - Intronic
1020026465 7:4903429-4903451 CTCGCGGAGCCTGAAGCTGATGG + Intergenic
1020271674 7:6600298-6600320 CCTGCAGAGCCTGCGCCAGCCGG - Exonic
1021891154 7:25187614-25187636 TCCTCACAGCCTCCAGCTGCTGG + Intergenic
1023256487 7:38317878-38317900 CCCACACAGCCTGCAGCACCGGG + Intergenic
1023871996 7:44268355-44268377 CCCCCACAGCCAGCATCTGCAGG - Intronic
1023929533 7:44696871-44696893 CAGGCAGGGCCTGCAGCAGCTGG + Intronic
1024325819 7:48108297-48108319 CCAGCAGAGGCCGCAGCGGCTGG + Exonic
1028922403 7:96322268-96322290 GCCGCAGAGGCCGCCGCTGCTGG - Intergenic
1029414708 7:100435708-100435730 CCTGGTGAGCCTGCAGGTGCCGG - Exonic
1029452261 7:100647622-100647644 ACAGCAGAGCCTGCAGCGCCAGG - Intronic
1030079842 7:105767815-105767837 CCCACATGGGCTGCAGCTGCTGG - Intronic
1032220525 7:129990819-129990841 CTCGCAGCTCCTGCAGCTTCCGG + Intergenic
1033342390 7:140502219-140502241 CCAGCAAAACCGGCAGCTGCAGG - Intergenic
1034099695 7:148440003-148440025 CCGGCAGAGCCTGTGGCTGAAGG - Intergenic
1035131340 7:156656865-156656887 CCCGCAGGGCCTGGCGCTGGTGG + Intronic
1036656397 8:10679943-10679965 CCTGGAGAGGCTGGAGCTGCCGG + Intronic
1038280402 8:26159072-26159094 CCAGGAAAGGCTGCAGCTGCAGG - Intergenic
1039951986 8:42179971-42179993 CCCGGCGGACCTGCAGCTGCCGG - Exonic
1040840904 8:51783295-51783317 CCCGAAGTGCCTGCAACTACTGG + Intronic
1042190037 8:66177288-66177310 CCGGCCGAGCCTGCGGCTGCTGG + Exonic
1042609117 8:70577908-70577930 CACACAGAGCCAGCACCTGCTGG + Intronic
1042903073 8:73747110-73747132 CCCGCAGAGCCTGCAGCTGCTGG - Intronic
1043002038 8:74771549-74771571 CCCGCCAAAGCTGCAGCTGCTGG + Intronic
1045276055 8:100706751-100706773 GCTGCAGCGGCTGCAGCTGCAGG + Exonic
1048338220 8:133518867-133518889 GCCACAGAGCCTGTAGGTGCTGG + Intronic
1048461610 8:134626003-134626025 CCCTGAGAGCCAGCAGCCGCAGG + Intronic
1049090464 8:140510637-140510659 CCCTCCCAGCCGGCAGCTGCAGG + Intergenic
1049479732 8:142816177-142816199 CCTGCAGGGCCTACAGCTGGGGG + Intergenic
1049758561 8:144321598-144321620 CCCCCAGAGCCTGCACCTCCAGG + Intronic
1049761524 8:144333975-144333997 GGCGCAGACCCTGCAGCCGCCGG + Exonic
1049828539 8:144685533-144685555 CCCGCGGCGACTGCAGCGGCGGG - Intergenic
1051170466 9:14315051-14315073 TCCGCGGAGCCTGCGGCTGCCGG + Intronic
1056730983 9:89166553-89166575 CCCGCAGACCCTGATGCTGTTGG - Intronic
1056770527 9:89475113-89475135 CCTGCAGAACCTGCAGCTGGAGG + Intronic
1057148200 9:92772757-92772779 CCCACACAGCATGGAGCTGCAGG - Intergenic
1057196265 9:93116908-93116930 GCCACAGAGGCTGCAGCTGGTGG + Intergenic
1057208119 9:93185130-93185152 CCCGCAGCCCCTGCAGCGCCGGG + Exonic
1057341638 9:94207332-94207354 GCCTGAGAGCCTCCAGCTGCAGG + Intergenic
1057704633 9:97388173-97388195 CCAGAAGAGGCAGCAGCTGCAGG - Intergenic
1057763111 9:97892106-97892128 CCCCCAGATCCTGCTGCTGACGG - Intergenic
1059827652 9:118049887-118049909 CCAGCAGAGCTAGCAGGTGCTGG + Intergenic
1060730394 9:126033458-126033480 CCCCAAGAGCCTGCAGGGGCAGG + Intergenic
1060750539 9:126165591-126165613 CCAGCAATGCCTGCAGCTGTGGG - Intergenic
1060800965 9:126545681-126545703 CCCTCACACCCTGCAACTGCTGG + Intergenic
1061193678 9:129096084-129096106 CCTGCTGGGCCTGAAGCTGCAGG - Exonic
1062109938 9:134776817-134776839 TCCGCAGACACTGCATCTGCTGG - Intronic
1188276482 X:28207296-28207318 CCCCCAGAGCCTACAGAGGCAGG - Intergenic
1191109375 X:56793158-56793180 CCTCCAAAGCCTGGAGCTGCAGG - Intergenic
1194127765 X:90041015-90041037 CCCGCAGAGCCAGCTGCTGTTGG - Intergenic
1196855770 X:119982076-119982098 CACCCAGAGCCAGCAGCTGATGG - Intergenic
1198115684 X:133542747-133542769 CCCCCAGAGGCTGAAGCTGGGGG + Intronic
1198887448 X:141354883-141354905 CCAGCAGAGCAAGCAGCTGCCGG + Intergenic
1199092207 X:143705463-143705485 TCCACAGAGCCTGCAGGAGCTGG + Intergenic
1199635402 X:149807933-149807955 CCAGCAGAGGCTGAGGCTGCAGG - Intergenic
1199986839 X:152958942-152958964 CAGGCAGAGTCTGCGGCTGCAGG - Intronic
1200085794 X:153604173-153604195 CCCCCAGAGCCTGCAGAGGAGGG - Intergenic
1200686823 Y:6265603-6265625 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1200695664 Y:6356484-6356506 GCCCCAGAGCCTCCTGCTGCAGG + Intergenic
1200989701 Y:9336519-9336541 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1200992370 Y:9356852-9356874 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1200995021 Y:9377130-9377152 CCCCCAGAGCCTACGGGTGCGGG - Intronic
1200997686 Y:9397476-9397498 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1201000198 Y:9466012-9466034 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1201002857 Y:9486322-9486344 CCCCCAGAGCCTACGGGTGCGGG - Intronic
1201005513 Y:9506605-9506627 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1201008176 Y:9526935-9526957 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1201039613 Y:9818226-9818248 GCCCCAGAGCCTCCTGCTGCAGG - Intergenic