ID: 1042918898

View in Genome Browser
Species Human (GRCh38)
Location 8:73902203-73902225
Sequence CACCAATCACTTCTTCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042918898_1042918903 29 Left 1042918898 8:73902203-73902225 CCATGTTGAAGAAGTGATTGGTG No data
Right 1042918903 8:73902255-73902277 GCACATTTGAGCAACAACGGAGG No data
1042918898_1042918902 26 Left 1042918898 8:73902203-73902225 CCATGTTGAAGAAGTGATTGGTG No data
Right 1042918902 8:73902252-73902274 AAGGCACATTTGAGCAACAACGG No data
1042918898_1042918900 7 Left 1042918898 8:73902203-73902225 CCATGTTGAAGAAGTGATTGGTG No data
Right 1042918900 8:73902233-73902255 GTCAGTGTCAAAACCTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042918898 Original CRISPR CACCAATCACTTCTTCAACA TGG (reversed) Intergenic
No off target data available for this crispr