ID: 1042918898 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:73902203-73902225 |
| Sequence | CACCAATCACTTCTTCAACA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1042918898_1042918903 | 29 | Left | 1042918898 | 8:73902203-73902225 | CCATGTTGAAGAAGTGATTGGTG | No data | ||
| Right | 1042918903 | 8:73902255-73902277 | GCACATTTGAGCAACAACGGAGG | No data | ||||
| 1042918898_1042918902 | 26 | Left | 1042918898 | 8:73902203-73902225 | CCATGTTGAAGAAGTGATTGGTG | No data | ||
| Right | 1042918902 | 8:73902252-73902274 | AAGGCACATTTGAGCAACAACGG | No data | ||||
| 1042918898_1042918900 | 7 | Left | 1042918898 | 8:73902203-73902225 | CCATGTTGAAGAAGTGATTGGTG | No data | ||
| Right | 1042918900 | 8:73902233-73902255 | GTCAGTGTCAAAACCTTTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1042918898 | Original CRISPR | CACCAATCACTTCTTCAACA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||