ID: 1042926589

View in Genome Browser
Species Human (GRCh38)
Location 8:73973598-73973620
Sequence TTCTGTGTTTTTAGTGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042926578_1042926589 29 Left 1042926578 8:73973546-73973568 CCCCCTGAGTAGCTGGGATTACG 0: 554
1: 56355
2: 144914
3: 231978
4: 202616
Right 1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG No data
1042926579_1042926589 28 Left 1042926579 8:73973547-73973569 CCCCTGAGTAGCTGGGATTACGG 0: 14
1: 1312
2: 3693
3: 5903
4: 7158
Right 1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG No data
1042926581_1042926589 27 Left 1042926581 8:73973548-73973570 CCCTGAGTAGCTGGGATTACGGG 0: 15
1: 1227
2: 3251
3: 5510
4: 6471
Right 1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG No data
1042926587_1042926589 -5 Left 1042926587 8:73973580-73973602 CCACGCCGGGCGACTTTTTTCTG 0: 1
1: 0
2: 4
3: 147
4: 4812
Right 1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG No data
1042926586_1042926589 -2 Left 1042926586 8:73973577-73973599 CCACCACGCCGGGCGACTTTTTT 0: 1
1: 3
2: 804
3: 39641
4: 135277
Right 1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG No data
1042926588_1042926589 -10 Left 1042926588 8:73973585-73973607 CCGGGCGACTTTTTTCTGTGTTT 0: 1
1: 0
2: 15
3: 570
4: 11591
Right 1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG No data
1042926583_1042926589 26 Left 1042926583 8:73973549-73973571 CCTGAGTAGCTGGGATTACGGGT 0: 272
1: 31590
2: 152150
3: 255301
4: 209878
Right 1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042926589 Original CRISPR TTCTGTGTTTTTAGTGAAGA CGG Intronic
No off target data available for this crispr