ID: 1042927879

View in Genome Browser
Species Human (GRCh38)
Location 8:73985139-73985161
Sequence ATAGCAAAGTGGCATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042927879_1042927891 16 Left 1042927879 8:73985139-73985161 CCTCCCTCATGCCACTTTGCTAT No data
Right 1042927891 8:73985178-73985200 TAATCTCAGGAAGACTGGGAAGG No data
1042927879_1042927890 12 Left 1042927879 8:73985139-73985161 CCTCCCTCATGCCACTTTGCTAT No data
Right 1042927890 8:73985174-73985196 AGAGTAATCTCAGGAAGACTGGG No data
1042927879_1042927889 11 Left 1042927879 8:73985139-73985161 CCTCCCTCATGCCACTTTGCTAT No data
Right 1042927889 8:73985173-73985195 CAGAGTAATCTCAGGAAGACTGG No data
1042927879_1042927885 3 Left 1042927879 8:73985139-73985161 CCTCCCTCATGCCACTTTGCTAT No data
Right 1042927885 8:73985165-73985187 ACCCCAGGCAGAGTAATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042927879 Original CRISPR ATAGCAAAGTGGCATGAGGG AGG (reversed) Intergenic
No off target data available for this crispr