ID: 1042930533

View in Genome Browser
Species Human (GRCh38)
Location 8:74008903-74008925
Sequence TGGTGCAACCACTCCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042930533_1042930540 8 Left 1042930533 8:74008903-74008925 CCTGGAAGGGAGTGGTTGCACCA No data
Right 1042930540 8:74008934-74008956 GAAGGTTTAGGGAAAGGAGCAGG No data
1042930533_1042930535 -4 Left 1042930533 8:74008903-74008925 CCTGGAAGGGAGTGGTTGCACCA No data
Right 1042930535 8:74008922-74008944 ACCAACACCAAAGAAGGTTTAGG No data
1042930533_1042930534 -10 Left 1042930533 8:74008903-74008925 CCTGGAAGGGAGTGGTTGCACCA No data
Right 1042930534 8:74008916-74008938 GGTTGCACCAACACCAAAGAAGG No data
1042930533_1042930538 2 Left 1042930533 8:74008903-74008925 CCTGGAAGGGAGTGGTTGCACCA No data
Right 1042930538 8:74008928-74008950 ACCAAAGAAGGTTTAGGGAAAGG No data
1042930533_1042930537 -3 Left 1042930533 8:74008903-74008925 CCTGGAAGGGAGTGGTTGCACCA No data
Right 1042930537 8:74008923-74008945 CCAACACCAAAGAAGGTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042930533 Original CRISPR TGGTGCAACCACTCCCTTCC AGG (reversed) Intronic